Human CNPY2(Canopy 2 Homolog) ELISA Kit

Human CNPY2(Canopy 2 Homolog) ELISA Kit

To Order Contact us:  Mark@operatiebrp.nl

Human Canopy 2 Homolog (CNPY2) ELISA Kit
RDR-CNPY2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 589

Human Canopy 2 Homolog (CNPY2) ELISA Kit
RDR-CNPY2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 820

Human Canopy 2 Homolog (CNPY2) ELISA Kit
RD-CNPY2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 563

Human Canopy 2 Homolog (CNPY2) ELISA Kit
RD-CNPY2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 783

Human Canopy 2 Homolog (CNPY2) ELISA Kit
20-abx150920	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Canopy 2 Homolog (CNPY2) ELISA Kit
SEM449Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5189.65
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Canopy 2 Homolog (CNPY2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Canopy 2 Homolog (CNPY2) in Tissue homogenates, cell lysates and other biological fluids.

Human Canopy 2 Homolog (CNPY2) ELISA Kit
SEM449Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 515.03
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Canopy 2 Homolog (CNPY2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Canopy 2 Homolog (CNPY2) in Tissue homogenates, cell lysates and other biological fluids.

Human Canopy 2 Homolog (CNPY2) ELISA Kit
SEM449Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 692.9
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Canopy 2 Homolog (CNPY2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Canopy 2 Homolog (CNPY2) in Tissue homogenates, cell lysates and other biological fluids.

Human Canopy 2 Homolog (CNPY2) ELISA Kit
SEM449Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2818.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Canopy 2 Homolog (CNPY2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Canopy 2 Homolog (CNPY2) in Tissue homogenates, cell lysates and other biological fluids.

Human Canopy 2 Homolog (CNPY2) ELISA Kit
4-SEM449Hu	Cloud-Clone	EUR 5240.00 EUR 2769.00 EUR 693.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Canopy 2 Homolog elisa. Alternative names of the recognized antigen: ZSIG9 Cnpy2 MSAP TMEM4 Transmembrane Protein 4 MIR-interacting saposin-like protein Putative secreted protein Zsig9
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Canopy 2 Homolog (CNPY2) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Canopy 2 Homolog (CNPY2) Antibody
20-abx175688	Abbexa	EUR 1344.00 EUR 634.00	1 mg 200 ug
Please enquire.

Canopy 2 Homolog (CNPY2) Antibody
20-abx175689	Abbexa	EUR 1344.00 EUR 634.00	1 mg 200 ug
Please enquire.

Canopy 2 Homolog (CNPY2) Antibody
20-abx110134	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Canopy 2 Homolog (CNPY2) Antibody
20-abx111355	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Canopy 2 Homolog (CNPY2) Antibody
20-abx125690	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Canopy 2 Homolog (CNPY2) Antibody
20-abx128004	Abbexa	EUR 453.00 EUR 133.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Canopy 2 Homolog (CNPY2) Antibody
20-abx171545	Abbexa	EUR 926.00 EUR 467.00	1 mg 200 ug
Please enquire.

Recombinant Canopy 2 Homolog (CNPY2)
4-RPM449Hu01	Cloud-Clone	EUR 485.28 EUR 233.00 EUR 1544.80 EUR 581.60 EUR 1063.20 EUR 388.00 EUR 3712.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9Y2B0 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 22.1kDa Isoelectric Point: 5.4
Description: Recombinant Human Canopy 2 Homolog expressed in: E.coli

Mouse Canopy 2 Homolog (CNPY2) ELISA Kit
20-abx153762	Abbexa	EUR 7504.00 EUR 3996.00 EUR 926.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Canopy 2 Homolog (CNPY2) ELISA Kit
SEM449Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5333.64
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Canopy 2 Homolog (CNPY2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Canopy 2 Homolog (CNPY2) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Canopy 2 Homolog (CNPY2) ELISA Kit
SEM449Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 526.89
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Canopy 2 Homolog (CNPY2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Canopy 2 Homolog (CNPY2) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Canopy 2 Homolog (CNPY2) ELISA Kit
SEM449Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 709.84
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Canopy 2 Homolog (CNPY2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Canopy 2 Homolog (CNPY2) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Canopy 2 Homolog (CNPY2) ELISA Kit
SEM449Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2894.28
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Canopy 2 Homolog (CNPY2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Canopy 2 Homolog (CNPY2) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Canopy 2 Homolog (CNPY2) ELISA Kit
4-SEM449Mu	Cloud-Clone	EUR 5384.00 EUR 2845.00 EUR 710.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Canopy 2 Homolog elisa. Alternative names of the recognized antigen: ZSIG9 Cnpy2 MSAP TMEM4 Transmembrane Protein 4 MIR-interacting saposin-like protein Putative secreted protein Zsig9
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Canopy 2 Homolog (CNPY2) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Protein canopy homolog 2 (CNPY2)
1-CSB-RP050344h	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 45.4 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Protein canopy homolog 2(CNPY2) expressed in E.coli

Human Canopy 2 Homolog (CNPY2) Protein
20-abx166861	Abbexa	EUR 676.00 EUR 286.00 EUR 2082.00 EUR 801.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Canopy 2 Homolog (CNPY2) CLIA Kit
20-abx496060	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human CNPY2 (Canopy 2 Homolog)
ELK7033	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Canopy 2 Homolog (CNPY2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Canopy 2 Show more
Description: A sandwich ELISA kit for detection of Canopy 2 Homolog from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Protein canopy homolog 2, CNPY2 ELISA KIT
ELI-33716h	Lifescience Market	96 Tests	EUR 824

Canopy 2 Homolog (CNPY2) Antibody (Biotin)
20-abx105819	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Canopy 2 Homolog (CNPY2) Antibody (FITC)
20-abx107236	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Canopy 2 Homolog (CNPY2) Antibody (HRP)
20-abx108656	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Canopy 2 Homolog (CNPY2) Antibody Pair
abx117460-1pair5x96wellplates	Abbexa	1 pair (5x96 well plates)	EUR 1010
Shipped within 5-10 working days.

Mouse Canopy 2 Homolog (CNPY2) Protein
20-abx652760	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Mouse Canopy 2 Homolog (CNPY2) Protein
20-abx652761	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Mouse Canopy 2 Homolog (CNPY2) CLIA Kit
20-abx496061	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Mouse Protein canopy homolog 2, Cnpy2 ELISA KIT
ELI-10845m	Lifescience Market	96 Tests	EUR 865

ELISA kit for Mouse CNPY2 (Canopy 2 Homolog)
ELK8075	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Canopy 2 Homolog (CNPY2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Canopy 2 Show more
Description: A sandwich ELISA kit for detection of Canopy 2 Homolog from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Canopy 2 Homolog (CNPY2) Polyclonal Antibody (Human, Pig)
4-PAM449Hu01	Cloud-Clone	EUR 262.00 EUR 2747.00 EUR 679.00 EUR 331.00 EUR 220.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CNPY2 (Arg21~Leu182) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Canopy 2 Homolog (CNPY2)

Canopy 2 Homolog (CNPY2) Polyclonal Antibody (Human, Pig), APC
4-PAM449Hu01-APC	Cloud-Clone	EUR 368.00 EUR 3599.00 EUR 993.00 EUR 472.00 EUR 229.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CNPY2 (Arg21~Leu182) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Canopy 2 Homolog (CNPY2). This antibody is labeled with APC.

Canopy 2 Homolog (CNPY2) Polyclonal Antibody (Human, Pig), Biotinylated
4-PAM449Hu01-Biotin	Cloud-Clone	EUR 328.00 EUR 2697.00 EUR 786.00 EUR 404.00 EUR 226.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CNPY2 (Arg21~Leu182) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Canopy 2 Homolog (CNPY2). This antibody is labeled with Biotin.

Canopy 2 Homolog (CNPY2) Polyclonal Antibody (Human, Pig), Cy3
4-PAM449Hu01-Cy3	Cloud-Clone	EUR 449.00 EUR 4757.00 EUR 1283.00 EUR 588.00 EUR 264.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CNPY2 (Arg21~Leu182) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Canopy 2 Homolog (CNPY2). This antibody is labeled with Cy3.

Canopy 2 Homolog (CNPY2) Polyclonal Antibody (Human, Pig), FITC
4-PAM449Hu01-FITC	Cloud-Clone	EUR 314.00 EUR 2899.00 EUR 814.00 EUR 397.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CNPY2 (Arg21~Leu182) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Canopy 2 Homolog (CNPY2). This antibody is labeled with FITC.

Canopy 2 Homolog (CNPY2) Polyclonal Antibody (Human, Pig), HRP
4-PAM449Hu01-HRP	Cloud-Clone	EUR 335.00 EUR 3135.00 EUR 877.00 EUR 426.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CNPY2 (Arg21~Leu182) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Canopy 2 Homolog (CNPY2). This antibody is labeled with HRP.

Canopy 2 Homolog (CNPY2) Polyclonal Antibody (Human, Pig), PE
4-PAM449Hu01-PE	Cloud-Clone	EUR 314.00 EUR 2899.00 EUR 814.00 EUR 397.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CNPY2 (Arg21~Leu182) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Canopy 2 Homolog (CNPY2). This antibody is labeled with PE.

Canopy 2 Homolog (CNPY2) Polyclonal Antibody (Human, Pig), APC-Cy7
4-PAM449Hu01-APC-Cy7	Cloud-Clone	EUR 616.00 EUR 7078.00 EUR 1867.00 EUR 824.00 EUR 338.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CNPY2 (Arg21~Leu182) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Canopy 2 Homolog (CNPY2). This antibody is labeled with APC-Cy7.

Human Canopy 3 Homolog (CNPY3) ELISA Kit
abx386611-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Canopy 4 Homolog (CNPY4) ELISA Kit
abx386612-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Protein canopy homolog 2 Polyclonal Antibody
42421-100ul	SAB	100ul	EUR 333

Human Protein canopy homolog 3(CNPY3) ELISA kit
E01P0801-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protein canopy homolog 3(CNPY3) ELISA kit
E01P0801-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protein canopy homolog 3(CNPY3) ELISA kit
E01P0801-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protein canopy homolog 1, CNPY1 ELISA KIT
ELI-10076h	Lifescience Market	96 Tests	EUR 824

Human Protein canopy homolog 4, CNPY4 ELISA KIT
ELI-33026h	Lifescience Market	96 Tests	EUR 824

Human Protein canopy homolog 3, CNPY3 ELISA KIT
ELI-51011h	Lifescience Market	96 Tests	EUR 824

Canopy 3 Homolog Protein
20-abx261031	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

Protein canopy homolog 2 Polyclonal Conjugated Antibody
C42421	SAB	100ul	EUR 397

Rabbit Protein canopy homolog 3(CNPY3) ELISA kit
E04P0801-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Protein canopy homolog 3(CNPY3) ELISA kit
E04P0801-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Protein canopy homolog 3(CNPY3) ELISA kit
E04P0801-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Protein canopy homolog 3(CNPY3) ELISA kit
E02P0801-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Protein canopy homolog 3(CNPY3) ELISA kit
E02P0801-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Protein canopy homolog 3(CNPY3) ELISA kit
E02P0801-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protein canopy homolog 3(CNPY3) ELISA kit
E03P0801-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protein canopy homolog 3(CNPY3) ELISA kit
E03P0801-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protein canopy homolog 3(CNPY3) ELISA kit
E03P0801-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Protein canopy homolog 3(CNPY3) ELISA kit
E06P0801-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Protein canopy homolog 3(CNPY3) ELISA kit
E06P0801-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Protein canopy homolog 3(CNPY3) ELISA kit
E06P0801-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Protein canopy homolog 3(CNPY3) ELISA kit
E08P0801-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Protein canopy homolog 3(CNPY3) ELISA kit
E08P0801-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Protein canopy homolog 3(CNPY3) ELISA kit
E08P0801-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Protein canopy homolog 3(CNPY3) ELISA kit
E07P0801-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Protein canopy homolog 3(CNPY3) ELISA kit
E07P0801-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Protein canopy homolog 3(CNPY3) ELISA kit
E07P0801-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Protein canopy homolog 3(CNPY3) ELISA kit
E09P0801-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Protein canopy homolog 3(CNPY3) ELISA kit
E09P0801-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Protein canopy homolog 3(CNPY3) ELISA kit
E09P0801-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protein canopy homolog 1, Cnpy1 ELISA KIT
ELI-09145m	Lifescience Market	96 Tests	EUR 865

Mouse Protein canopy homolog 4, Cnpy4 ELISA KIT
ELI-10077m	Lifescience Market	96 Tests	EUR 865

Porcine Protein canopy homolog 3, CNPY3 ELISA KIT
ELI-10589p	Lifescience Market	96 Tests	EUR 928

Bovine Protein canopy homolog 4, CNPY4 ELISA KIT
ELI-10846b	Lifescience Market	96 Tests	EUR 928

Mouse Protein canopy homolog 3, Cnpy3 ELISA KIT
ELI-25933m	Lifescience Market	96 Tests	EUR 865

Bovine Protein canopy homolog 3, CNPY3 ELISA KIT
ELI-50327b	Lifescience Market	96 Tests	EUR 928

Canopy 3 Homolog (CNPY3) Antibody
20-abx006907	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Canopy 3 Homolog (CNPY3) Antibody
20-abx030445	Abbexa	EUR 98.00 EUR 133.00 EUR 523.00	10 ul 20 ul 400 ul
Shipped within 5-10 working days.

Canopy 3 Homolog (CNPY3) Antibody
abx030445-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Canopy 3 Homolog (CNPY3) Antibody
20-abx320882	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Canopy 4 Homolog (CNPY4) Antibody
20-abx309635	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Canopy 3 Homolog (CNPY3) Antibody
20-abx321859	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Canopy 3 Homolog (CNPY3) Antibody
20-abx225119	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Canopy 3 Homolog (CNPY3) Antibody
abx231816-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Canopy 4 Homolog (CNPY4) Antibody
abx231817-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Guinea pig Protein canopy homolog 3(CNPY3) ELISA kit
E05P0801-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Protein canopy homolog 3(CNPY3) ELISA kit
E05P0801-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Protein canopy homolog 3(CNPY3) ELISA kit
E05P0801-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CNPY3 Canopy 3 Homolog Human Recombinant Protein
PROTQ9BT09	BosterBio	Regular: 20ug	EUR 317
Description: CNPY3 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 271 amino acids (31-278 a.a.) and having a molecular mass of 29.9kDa. CNPY3 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

CNPY2/MSAP ELISA KIT|Human
EF008766	Lifescience Market	96 Tests	EUR 689

Canopy 4 Homolog (CNPY4) Antibody (HRP)
20-abx309636	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Canopy 4 Homolog (CNPY4) Antibody (FITC)
20-abx309637	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Canopy 4 Homolog (CNPY4) Antibody (Biotin)
20-abx309638	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

CNPY2 antibody
70R-21486	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal CNPY2 antibody

CNPY2 antibody
70R-15364	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal CNPY2 antibody

CNPY2 Antibody
42954-100ul	SAB	100ul	EUR 252

CNPY2 Antibody
1-CSB-PA005675GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CNPY2. Recognizes CNPY2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CNPY2 Antibody
1-CSB-PA05034A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CNPY2. Recognizes CNPY2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

CNPY2 siRNA
20-abx912295	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CNPY2 siRNA
20-abx912296	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-2	CORNING	1/pk	EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

CNPY2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0477803	ABM	1.0 ug DNA	EUR 154

Human CNPY2 shRNA Plasmid
20-abx957003	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

CNPY2 Recombinant Protein (Human)
RP007531	ABM	100 ug	Ask for price

Human Slit Homolog 2 ELISA kit
E01S0112-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Slit Homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Slit Homolog 2 ELISA kit
E01S0112-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Slit Homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Slit Homolog 2 ELISA kit
E01S0112-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Slit Homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CNPY2 Rabbit pAb
A12197-100ul	Abclonal	100 ul	EUR 308

CNPY2 Rabbit pAb
A12197-200ul	Abclonal	200 ul	EUR 459

CNPY2 Rabbit pAb
A12197-20ul	Abclonal	20 ul	EUR 183

CNPY2 Rabbit pAb
A12197-50ul	Abclonal	50 ul	EUR 223

CNPY2 antibody (HRP)
60R-1906	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal CNPY2 antibody (HRP)

CNPY2 antibody (FITC)
60R-1907	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal CNPY2 antibody (FITC)

CNPY2 antibody (biotin)
60R-1908	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal CNPY2 antibody (biotin)

CNPY2 cloning plasmid
CSB-CL896486HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 549 Sequence: atgaaaggctggggttggctggccctgcttctgggggccctgctgggaaccgcctgggctcggaggagccaggatctccactgtggagcatgcagggctctggtggatgaactagaatgggaaattgcccaggtggaccccaagaagaccattcagatgggatctttccggatcaa Show more
Description: A cloning plasmid for the CNPY2 gene.

CNPY2,MSAP Antibody
DF12367	Affbiotech	200ul	EUR 304
Description: CNPY2,MSAP antibody detects endogenous levels of CNPY2,MSAP.

CNPY2 Conjugated Antibody
C42954	SAB	100ul	EUR 397

CNPY2, MSAP Antibody
abx231814-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

CNPY2,MSAP Antibody
abx231815-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

CNPY2 Polyclonal Antibody
A53985	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

Anti-CNPY2 antibody
STJ11100878	St John's Laboratory	100 µl	EUR 413

Anti-CNPY2 antibody
STJ114089	St John's Laboratory	100 µl	EUR 277

Anti-CNPY2 antibody
STJ13100106	St John's Laboratory	100 µl	EUR 427

CNPY2 ORF Vector (Human) (pORF)
ORF002511	ABM	1.0 ug DNA	EUR 95

human snail homolog 2,SNAI2 ELISA Kit
201-12-1878	SunredBio	96 tests	EUR 440
This snail homolog 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Frizzled Homolog 2 (FZD2)ELISA Kit
201-12-2370	SunredBio	96 tests	EUR 440
This Frizzled Homolog 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Chromobox Homolog 2 (CBX2)ELISA Kit
201-12-2895	SunredBio	96 tests	EUR 440
This Chromobox Homolog 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Slit Homolog 2 (Slit2) ELISA Kit
DLR-Slit2-Hu-48T	DL Develop	48T	EUR 479
Should the Human Slit Homolog 2 (Slit2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Slit Homolog 2 (Slit2) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Slit Homolog 2 (Slit2) ELISA Kit
DLR-Slit2-Hu-96T	DL Develop	96T	EUR 621
Should the Human Slit Homolog 2 (Slit2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Slit Homolog 2 (Slit2) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Slingshot Homolog 2 (SSH2) ELISA Kit
DLR-SSH2-Hu-48T	DL Develop	48T	EUR 517
Should the Human Slingshot Homolog 2 (SSH2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Slingshot Homolog 2 (SSH2) in samples from tissue homogenates or other biological fluids.

Human Slingshot Homolog 2 (SSH2) ELISA Kit
DLR-SSH2-Hu-96T	DL Develop	96T	EUR 673
Should the Human Slingshot Homolog 2 (SSH2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Slingshot Homolog 2 (SSH2) in samples from tissue homogenates or other biological fluids.

Human Notch Homolog 2 (NOTCH2) ELISA Kit
DLR-NOTCH2-Hu-48T	DL Develop	48T	EUR 554
Should the Human Notch Homolog 2 (NOTCH2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Notch Homolog 2 (NOTCH2) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Notch Homolog 2 (NOTCH2) ELISA Kit
DLR-NOTCH2-Hu-96T	DL Develop	96T	EUR 725
Should the Human Notch Homolog 2 (NOTCH2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Notch Homolog 2 (NOTCH2) in samples from tissue homogenates, cell lysates or other biological fluids.

Human DAB2/ Disabled homolog 2 ELISA Kit
E0655Hu	Sunlong	1 Kit	EUR 571

Human Anterior Gradient Homolog 2 ELISA kit
E01A0457-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Anterior Gradient Homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Anterior Gradient Homolog 2 ELISA kit
E01A0457-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Anterior Gradient Homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Anterior Gradient Homolog 2 ELISA kit
E01A0457-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Anterior Gradient Homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Crumbs homolog 2(CRB2) ELISA kit
E01C2039-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Crumbs homolog 2(CRB2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Crumbs homolog 2(CRB2) ELISA kit
E01C2039-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Crumbs homolog 2(CRB2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.