Human CNPY2(Canopy 2 Homolog) ELISA Kit

Human CNPY2(Canopy 2 Homolog) ELISA Kit

To Order Contact us:

Human Canopy 2 Homolog (CNPY2) ELISA Kit

RDR-CNPY2-Hu-48Tests 48 Tests
EUR 589

Human Canopy 2 Homolog (CNPY2) ELISA Kit

RDR-CNPY2-Hu-96Tests 96 Tests
EUR 820

Human Canopy 2 Homolog (CNPY2) ELISA Kit

RD-CNPY2-Hu-48Tests 48 Tests
EUR 563

Human Canopy 2 Homolog (CNPY2) ELISA Kit

RD-CNPY2-Hu-96Tests 96 Tests
EUR 783

Human Canopy 2 Homolog (CNPY2) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Canopy 2 Homolog (CNPY2) ELISA Kit

SEM449Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Canopy 2 Homolog (CNPY2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Canopy 2 Homolog (CNPY2) in Tissue homogenates, cell lysates and other biological fluids.

Human Canopy 2 Homolog (CNPY2) ELISA Kit

SEM449Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Canopy 2 Homolog (CNPY2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Canopy 2 Homolog (CNPY2) in Tissue homogenates, cell lysates and other biological fluids.

Human Canopy 2 Homolog (CNPY2) ELISA Kit

SEM449Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Canopy 2 Homolog (CNPY2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Canopy 2 Homolog (CNPY2) in Tissue homogenates, cell lysates and other biological fluids.

Human Canopy 2 Homolog (CNPY2) ELISA Kit

SEM449Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Canopy 2 Homolog (CNPY2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Canopy 2 Homolog (CNPY2) in Tissue homogenates, cell lysates and other biological fluids.

Human Canopy 2 Homolog (CNPY2) ELISA Kit

  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Canopy 2 Homolog elisa. Alternative names of the recognized antigen: ZSIG9
  • Cnpy2
  • MSAP
  • TMEM4
  • Transmembrane Protein 4
  • MIR-interacting saposin-like protein
  • Putative secreted protein Zsig9
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Canopy 2 Homolog (CNPY2) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Canopy 2 Homolog (CNPY2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Canopy 2 Homolog (CNPY2) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Canopy 2 Homolog (CNPY2) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Canopy 2 Homolog (CNPY2) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Canopy 2 Homolog (CNPY2) Antibody

  • EUR 1344.00
  • EUR 634.00
  • 1 mg
  • 200 ug
  • Please enquire.

Canopy 2 Homolog (CNPY2) Antibody

  • EUR 1344.00
  • EUR 634.00
  • 1 mg
  • 200 ug
  • Please enquire.

Canopy 2 Homolog (CNPY2) Antibody

  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Canopy 2 Homolog (CNPY2)

  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9Y2B0
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 22.1kDa
  • Isoelectric Point: 5.4
Description: Recombinant Human Canopy 2 Homolog expressed in: E.coli

Mouse Canopy 2 Homolog (CNPY2) ELISA Kit

  • EUR 7504.00
  • EUR 3996.00
  • EUR 926.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Canopy 2 Homolog (CNPY2) ELISA Kit

SEM449Mu-10x96wellstestplate 10x96-wells test plate
EUR 5333.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Canopy 2 Homolog (CNPY2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Canopy 2 Homolog (CNPY2) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Canopy 2 Homolog (CNPY2) ELISA Kit

SEM449Mu-1x48wellstestplate 1x48-wells test plate
EUR 526.89
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Canopy 2 Homolog (CNPY2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Canopy 2 Homolog (CNPY2) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Canopy 2 Homolog (CNPY2) ELISA Kit

SEM449Mu-1x96wellstestplate 1x96-wells test plate
EUR 709.84
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Canopy 2 Homolog (CNPY2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Canopy 2 Homolog (CNPY2) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Canopy 2 Homolog (CNPY2) ELISA Kit

SEM449Mu-5x96wellstestplate 5x96-wells test plate
EUR 2894.28
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Canopy 2 Homolog (CNPY2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Canopy 2 Homolog (CNPY2) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Canopy 2 Homolog (CNPY2) ELISA Kit

  • EUR 5384.00
  • EUR 2845.00
  • EUR 710.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Canopy 2 Homolog elisa. Alternative names of the recognized antigen: ZSIG9
  • Cnpy2
  • MSAP
  • TMEM4
  • Transmembrane Protein 4
  • MIR-interacting saposin-like protein
  • Putative secreted protein Zsig9
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Canopy 2 Homolog (CNPY2) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Canopy 2 Homolog (CNPY2) Protein

  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Protein canopy homolog 2 (CNPY2)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 45.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Protein canopy homolog 2(CNPY2) expressed in E.coli

Human Canopy 2 Homolog (CNPY2) CLIA Kit

  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human CNPY2 (Canopy 2 Homolog)

ELK7033 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Canopy 2 Homolog (CNPY2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Canopy 2
  • Show more
Description: A sandwich ELISA kit for detection of Canopy 2 Homolog from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Protein canopy homolog 2, CNPY2 ELISA KIT

ELI-33716h 96 Tests
EUR 824

Mouse Canopy 2 Homolog (CNPY2) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse Canopy 2 Homolog (CNPY2) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Canopy 2 Homolog (CNPY2) Antibody Pair

abx117460-1pair5x96wellplates 1 pair (5x96 well plates)
EUR 1010
  • Shipped within 5-10 working days.

Canopy 2 Homolog (CNPY2) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Canopy 2 Homolog (CNPY2) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Canopy 2 Homolog (CNPY2) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mouse Canopy 2 Homolog (CNPY2) CLIA Kit

  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Protein canopy homolog 2, Cnpy2 ELISA KIT

ELI-10845m 96 Tests
EUR 865

ELISA kit for Mouse CNPY2 (Canopy 2 Homolog)

ELK8075 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Canopy 2 Homolog (CNPY2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Canopy 2
  • Show more
Description: A sandwich ELISA kit for detection of Canopy 2 Homolog from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Canopy 2 Homolog (CNPY2) Polyclonal Antibody (Human, Pig)

  • EUR 262.00
  • EUR 2747.00
  • EUR 679.00
  • EUR 331.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNPY2 (Arg21~Leu182)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Canopy 2 Homolog (CNPY2)

Canopy 2 Homolog (CNPY2) Polyclonal Antibody (Human, Pig), APC

  • EUR 368.00
  • EUR 3599.00
  • EUR 993.00
  • EUR 472.00
  • EUR 229.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNPY2 (Arg21~Leu182)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Canopy 2 Homolog (CNPY2). This antibody is labeled with APC.

Canopy 2 Homolog (CNPY2) Polyclonal Antibody (Human, Pig), Biotinylated

  • EUR 328.00
  • EUR 2697.00
  • EUR 786.00
  • EUR 404.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNPY2 (Arg21~Leu182)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Canopy 2 Homolog (CNPY2). This antibody is labeled with Biotin.

Canopy 2 Homolog (CNPY2) Polyclonal Antibody (Human, Pig), Cy3

  • EUR 449.00
  • EUR 4757.00
  • EUR 1283.00
  • EUR 588.00
  • EUR 264.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNPY2 (Arg21~Leu182)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Canopy 2 Homolog (CNPY2). This antibody is labeled with Cy3.

Canopy 2 Homolog (CNPY2) Polyclonal Antibody (Human, Pig), FITC

  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNPY2 (Arg21~Leu182)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Canopy 2 Homolog (CNPY2). This antibody is labeled with FITC.

Canopy 2 Homolog (CNPY2) Polyclonal Antibody (Human, Pig), HRP

  • EUR 335.00
  • EUR 3135.00
  • EUR 877.00
  • EUR 426.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNPY2 (Arg21~Leu182)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Canopy 2 Homolog (CNPY2). This antibody is labeled with HRP.

Canopy 2 Homolog (CNPY2) Polyclonal Antibody (Human, Pig), PE

  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNPY2 (Arg21~Leu182)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Canopy 2 Homolog (CNPY2). This antibody is labeled with PE.

Canopy 2 Homolog (CNPY2) Polyclonal Antibody (Human, Pig), APC-Cy7

  • EUR 616.00
  • EUR 7078.00
  • EUR 1867.00
  • EUR 824.00
  • EUR 338.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNPY2 (Arg21~Leu182)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Canopy 2 Homolog (CNPY2). This antibody is labeled with APC-Cy7.

Human Canopy 3 Homolog (CNPY3) ELISA Kit

abx386611-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Canopy 4 Homolog (CNPY4) ELISA Kit

abx386612-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Protein canopy homolog 2 Polyclonal Antibody

42421-100ul 100ul
EUR 333

Human Protein canopy homolog 3(CNPY3) ELISA kit

E01P0801-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protein canopy homolog 3(CNPY3) ELISA kit

E01P0801-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protein canopy homolog 3(CNPY3) ELISA kit

E01P0801-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protein canopy homolog 1, CNPY1 ELISA KIT

ELI-10076h 96 Tests
EUR 824

Human Protein canopy homolog 4, CNPY4 ELISA KIT

ELI-33026h 96 Tests
EUR 824

Human Protein canopy homolog 3, CNPY3 ELISA KIT

ELI-51011h 96 Tests
EUR 824

Canopy 3 Homolog Protein

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Protein canopy homolog 2 Polyclonal Conjugated Antibody

C42421 100ul
EUR 397

Rat Protein canopy homolog 3(CNPY3) ELISA kit

E02P0801-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Protein canopy homolog 3(CNPY3) ELISA kit

E02P0801-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Protein canopy homolog 3(CNPY3) ELISA kit

E02P0801-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protein canopy homolog 3(CNPY3) ELISA kit

E03P0801-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protein canopy homolog 3(CNPY3) ELISA kit

E03P0801-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protein canopy homolog 3(CNPY3) ELISA kit

E03P0801-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Protein canopy homolog 3(CNPY3) ELISA kit

E04P0801-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Protein canopy homolog 3(CNPY3) ELISA kit

E04P0801-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Protein canopy homolog 3(CNPY3) ELISA kit

E04P0801-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Protein canopy homolog 3(CNPY3) ELISA kit

E06P0801-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Protein canopy homolog 3(CNPY3) ELISA kit

E06P0801-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Protein canopy homolog 3(CNPY3) ELISA kit

E06P0801-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Protein canopy homolog 3(CNPY3) ELISA kit

E07P0801-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Protein canopy homolog 3(CNPY3) ELISA kit

E07P0801-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Protein canopy homolog 3(CNPY3) ELISA kit

E07P0801-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Protein canopy homolog 3(CNPY3) ELISA kit

E08P0801-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Protein canopy homolog 3(CNPY3) ELISA kit

E08P0801-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Protein canopy homolog 3(CNPY3) ELISA kit

E08P0801-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Protein canopy homolog 3(CNPY3) ELISA kit

E09P0801-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Protein canopy homolog 3(CNPY3) ELISA kit

E09P0801-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Protein canopy homolog 3(CNPY3) ELISA kit

E09P0801-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protein canopy homolog 4, Cnpy4 ELISA KIT

ELI-10077m 96 Tests
EUR 865

Porcine Protein canopy homolog 3, CNPY3 ELISA KIT

ELI-10589p 96 Tests
EUR 928

Bovine Protein canopy homolog 4, CNPY4 ELISA KIT

ELI-10846b 96 Tests
EUR 928

Mouse Protein canopy homolog 3, Cnpy3 ELISA KIT

ELI-25933m 96 Tests
EUR 865

Mouse Protein canopy homolog 1, Cnpy1 ELISA KIT

ELI-09145m 96 Tests
EUR 865

Bovine Protein canopy homolog 3, CNPY3 ELISA KIT

ELI-50327b 96 Tests
EUR 928

Canopy 3 Homolog (CNPY3) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Canopy 3 Homolog (CNPY3) Antibody

  • EUR 98.00
  • EUR 133.00
  • EUR 523.00
  • 10 ul
  • 20 ul
  • 400 ul
  • Shipped within 5-10 working days.

Canopy 3 Homolog (CNPY3) Antibody

abx030445-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Canopy 3 Homolog (CNPY3) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Canopy 3 Homolog (CNPY3) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Canopy 4 Homolog (CNPY4) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Canopy 3 Homolog (CNPY3) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Canopy 3 Homolog (CNPY3) Antibody

abx231816-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Canopy 4 Homolog (CNPY4) Antibody

abx231817-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

CNPY3 Canopy 3 Homolog Human Recombinant Protein

PROTQ9BT09 Regular: 20ug
EUR 317
Description: CNPY3 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 271 amino acids (31-278 a.a.) and having a molecular mass of 29.9kDa. CNPY3 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Guinea pig Protein canopy homolog 3(CNPY3) ELISA kit

E05P0801-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Protein canopy homolog 3(CNPY3) ELISA kit

E05P0801-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Protein canopy homolog 3(CNPY3) ELISA kit

E05P0801-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Canopy 4 Homolog (CNPY4) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Canopy 4 Homolog (CNPY4) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Canopy 4 Homolog (CNPY4) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.


EF008766 96 Tests
EUR 689

CNPY2 ELISA Kit (Human) (OKCD00621)

OKCD00621 96 Wells
EUR 909
Description: Description of target: Positive regulator of neurite outgrowth by stabilizing myosin regulatory light chain (MRLC). It prevents MIR-mediated MRLC ubiquitination and its subsequent proteasomal degradation. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.053 ng/mL

CNPY2 ELISA Kit (Human) (OKDD00196)

OKDD00196 96 Wells
EUR 1053
Description: Description of target: Positive regulator of neurite outgrowth by stabilizing myosin regulatory light chain (MRLC). It prevents MIR-mediated MRLC ubiquitination and its subsequent proteasomal degradation.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.062 ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Cnpy2 ELISA Kit (Mouse) (OKCD02073)

OKCD02073 96 Wells
EUR 936
Description: Description of target: Positive regulator of neurite outgrowth by stabilizing myosin regulatory light chain (MRLC). It prevents MIR-mediated MRLC ubiquitination and its subsequent proteasomal degradation.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.055 ng/mL


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CNPY2 antibody

70R-21486 50 ul
EUR 435
Description: Rabbit polyclonal CNPY2 antibody

CNPY2 Antibody

42954-100ul 100ul
EUR 252

CNPY2 antibody

70R-15364 100 ug
EUR 327
Description: Rabbit polyclonal CNPY2 antibody

CNPY2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CNPY2. Recognizes CNPY2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CNPY2 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CNPY2. Recognizes CNPY2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200


AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

CNPY2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0477803 1.0 ug DNA
EUR 154

Human CNPY2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CNPY2 Recombinant Protein (Human)

RP007531 100 ug Ask for price

Human Slit Homolog 2 ELISA kit

E01S0112-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Slit Homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Slit Homolog 2 ELISA kit

E01S0112-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Slit Homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Slit Homolog 2 ELISA kit

E01S0112-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Slit Homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CNPY2 Conjugated Antibody

C42954 100ul
EUR 397

CNPY2, MSAP Antibody

abx231814-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

CNPY2,MSAP Antibody

abx231815-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

CNPY2 Rabbit pAb

A12197-100ul 100 ul
EUR 308

CNPY2 Rabbit pAb

A12197-200ul 200 ul
EUR 459

CNPY2 Rabbit pAb

A12197-20ul 20 ul
EUR 183

CNPY2 Rabbit pAb

A12197-50ul 50 ul
EUR 223

CNPY2 Polyclonal Antibody

A53985 100 µg
EUR 570.55
Description: Ask the seller for details

CNPY2 antibody (HRP)

60R-1906 100 ug
EUR 327
Description: Rabbit polyclonal CNPY2 antibody (HRP)

CNPY2 antibody (FITC)

60R-1907 100 ug
EUR 327
Description: Rabbit polyclonal CNPY2 antibody (FITC)

CNPY2 antibody (biotin)

60R-1908 100 ug
EUR 327
Description: Rabbit polyclonal CNPY2 antibody (biotin)

CNPY2,MSAP Antibody

DF12367 200ul
EUR 304
Description: CNPY2,MSAP antibody detects endogenous levels of CNPY2,MSAP.

CNPY2 cloning plasmid

CSB-CL896486HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 549
  • Sequence: atgaaaggctggggttggctggccctgcttctgggggccctgctgggaaccgcctgggctcggaggagccaggatctccactgtggagcatgcagggctctggtggatgaactagaatgggaaattgcccaggtggaccccaagaagaccattcagatgggatctttccggatcaa
  • Show more
Description: A cloning plasmid for the CNPY2 gene.

Anti-CNPY2 antibody

STJ11100878 100 µl
EUR 413

Anti-CNPY2 antibody

STJ114089 100 µl
EUR 277

Anti-CNPY2 antibody

STJ13100106 100 µl
EUR 427

CNPY2 ORF Vector (Human) (pORF)

ORF002511 1.0 ug DNA
EUR 95

Human DAB2/ Disabled homolog 2 ELISA Kit

E0655Hu 1 Kit
EUR 571

Human Anterior Gradient Homolog 2 ELISA kit

E01A0457-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Anterior Gradient Homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Anterior Gradient Homolog 2 ELISA kit

E01A0457-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Anterior Gradient Homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Anterior Gradient Homolog 2 ELISA kit

E01A0457-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Anterior Gradient Homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Crumbs homolog 2(CRB2) ELISA kit

E01C2039-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Crumbs homolog 2(CRB2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Crumbs homolog 2(CRB2) ELISA kit

E01C2039-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Crumbs homolog 2(CRB2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Crumbs homolog 2(CRB2) ELISA kit

E01C2039-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Crumbs homolog 2(CRB2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Disabled homolog 2

EK4306 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Disabled homolog 2 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Ovostatin homolog 2

EK5050 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Ovostatin homolog 2 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human OVOS2/ Ovostatin homolog 2 ELISA Kit

E1845Hu 1 Kit
EUR 605

Human DAB2(Disabled homolog 2) ELISA Kit

EH2115 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P98082
  • Alias: Disabled-2/DOC2/Differentially-expressed protein 2/disabled(Drosophila) homolog 2(mitogen-responsive phosphoprotein)/disabled homolog 2, mitogen-responsive phosphoprotein(Drosophila)/DOC-2DOC2
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human OVOS2(Ovostatin homolog 2) ELISA Kit

EH2517 96T
EUR 567.6
  • Detection range: 78-5000 pg/ml
  • Uniprot ID: Q6IE36
  • Alias: OVOS2/Ovostatin homolog 2
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml