Human CNPY2(Canopy 2 Homolog) ELISA Kit
To Order Contact us: Mark@operatiebrp.nl
Human Canopy 2 Homolog (CNPY2) ELISA Kit |
RDR-CNPY2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 589 |
Human Canopy 2 Homolog (CNPY2) ELISA Kit |
RDR-CNPY2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 820 |
Human Canopy 2 Homolog (CNPY2) ELISA Kit |
RD-CNPY2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 563 |
Human Canopy 2 Homolog (CNPY2) ELISA Kit |
RD-CNPY2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 783 |
Human Canopy 2 Homolog (CNPY2) ELISA Kit |
20-abx150920 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Canopy 2 Homolog (CNPY2) ELISA Kit |
SEM449Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5189.65 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Canopy 2 Homolog (CNPY2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Canopy 2 Homolog (CNPY2) in Tissue homogenates, cell lysates and other biological fluids. |
Human Canopy 2 Homolog (CNPY2) ELISA Kit |
SEM449Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 515.03 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Canopy 2 Homolog (CNPY2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Canopy 2 Homolog (CNPY2) in Tissue homogenates, cell lysates and other biological fluids. |
Human Canopy 2 Homolog (CNPY2) ELISA Kit |
SEM449Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 692.9 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Canopy 2 Homolog (CNPY2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Canopy 2 Homolog (CNPY2) in Tissue homogenates, cell lysates and other biological fluids. |
Human Canopy 2 Homolog (CNPY2) ELISA Kit |
SEM449Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2818.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Canopy 2 Homolog (CNPY2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Canopy 2 Homolog (CNPY2) in Tissue homogenates, cell lysates and other biological fluids. |
Human Canopy 2 Homolog (CNPY2) ELISA Kit |
4-SEM449Hu |
Cloud-Clone |
-
EUR 5240.00
-
EUR 2769.00
-
EUR 693.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Canopy 2 Homolog elisa. Alternative names of the recognized antigen: ZSIG9
- Cnpy2
- MSAP
- TMEM4
- Transmembrane Protein 4
- MIR-interacting saposin-like protein
- Putative secreted protein Zsig9
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Canopy 2 Homolog (CNPY2) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Canopy 2 Homolog (CNPY2) Antibody |
20-abx175688 |
Abbexa |
|
|
|
Canopy 2 Homolog (CNPY2) Antibody |
20-abx175689 |
Abbexa |
|
|
|
Canopy 2 Homolog (CNPY2) Antibody |
20-abx110134 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Canopy 2 Homolog (CNPY2) Antibody |
20-abx111355 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Canopy 2 Homolog (CNPY2) Antibody |
20-abx125690 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Canopy 2 Homolog (CNPY2) Antibody |
20-abx128004 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1316.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Canopy 2 Homolog (CNPY2) Antibody |
20-abx171545 |
Abbexa |
|
|
|
Recombinant Canopy 2 Homolog (CNPY2) |
4-RPM449Hu01 |
Cloud-Clone |
-
EUR 485.28
-
EUR 233.00
-
EUR 1544.80
-
EUR 581.60
-
EUR 1063.20
-
EUR 388.00
-
EUR 3712.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q9Y2B0
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 22.1kDa
- Isoelectric Point: 5.4
|
Description: Recombinant Human Canopy 2 Homolog expressed in: E.coli |
Mouse Canopy 2 Homolog (CNPY2) ELISA Kit |
20-abx153762 |
Abbexa |
-
EUR 7504.00
-
EUR 3996.00
-
EUR 926.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Canopy 2 Homolog (CNPY2) ELISA Kit |
SEM449Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5333.64 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Canopy 2 Homolog (CNPY2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Canopy 2 Homolog (CNPY2) in Tissue homogenates, cell lysates and other biological fluids. |
Mouse Canopy 2 Homolog (CNPY2) ELISA Kit |
SEM449Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 526.89 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Canopy 2 Homolog (CNPY2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Canopy 2 Homolog (CNPY2) in Tissue homogenates, cell lysates and other biological fluids. |
Mouse Canopy 2 Homolog (CNPY2) ELISA Kit |
SEM449Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 709.84 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Canopy 2 Homolog (CNPY2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Canopy 2 Homolog (CNPY2) in Tissue homogenates, cell lysates and other biological fluids. |
Mouse Canopy 2 Homolog (CNPY2) ELISA Kit |
SEM449Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2894.28 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Canopy 2 Homolog (CNPY2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Canopy 2 Homolog (CNPY2) in Tissue homogenates, cell lysates and other biological fluids. |
Mouse Canopy 2 Homolog (CNPY2) ELISA Kit |
4-SEM449Mu |
Cloud-Clone |
-
EUR 5384.00
-
EUR 2845.00
-
EUR 710.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Canopy 2 Homolog elisa. Alternative names of the recognized antigen: ZSIG9
- Cnpy2
- MSAP
- TMEM4
- Transmembrane Protein 4
- MIR-interacting saposin-like protein
- Putative secreted protein Zsig9
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Canopy 2 Homolog (CNPY2) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Human Protein canopy homolog 2 (CNPY2) |
1-CSB-RP050344h |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 45.4 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Protein canopy homolog 2(CNPY2) expressed in E.coli |
Human Canopy 2 Homolog (CNPY2) Protein |
20-abx166861 |
Abbexa |
-
EUR 676.00
-
EUR 286.00
-
EUR 2082.00
-
EUR 801.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Canopy 2 Homolog (CNPY2) CLIA Kit |
20-abx496060 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human CNPY2 (Canopy 2 Homolog) |
ELK7033 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Canopy 2 Homolog (CNPY2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Canopy 2
- Show more
|
Description: A sandwich ELISA kit for detection of Canopy 2 Homolog from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human Protein canopy homolog 2, CNPY2 ELISA KIT |
ELI-33716h |
Lifescience Market |
96 Tests |
EUR 824 |
Canopy 2 Homolog (CNPY2) Antibody (Biotin) |
20-abx105819 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Canopy 2 Homolog (CNPY2) Antibody (FITC) |
20-abx107236 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Canopy 2 Homolog (CNPY2) Antibody (HRP) |
20-abx108656 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Canopy 2 Homolog (CNPY2) Antibody Pair |
abx117460-1pair5x96wellplates |
Abbexa |
1 pair (5x96 well plates) |
EUR 1010 |
- Shipped within 5-10 working days.
|
Mouse Canopy 2 Homolog (CNPY2) Protein |
20-abx652760 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Mouse Canopy 2 Homolog (CNPY2) Protein |
20-abx652761 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Mouse Canopy 2 Homolog (CNPY2) CLIA Kit |
20-abx496061 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Mouse Protein canopy homolog 2, Cnpy2 ELISA KIT |
ELI-10845m |
Lifescience Market |
96 Tests |
EUR 865 |
ELISA kit for Mouse CNPY2 (Canopy 2 Homolog) |
ELK8075 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Canopy 2 Homolog (CNPY2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Canopy 2
- Show more
|
Description: A sandwich ELISA kit for detection of Canopy 2 Homolog from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Canopy 2 Homolog (CNPY2) Polyclonal Antibody (Human, Pig) |
4-PAM449Hu01 |
Cloud-Clone |
-
EUR 262.00
-
EUR 2747.00
-
EUR 679.00
-
EUR 331.00
-
EUR 220.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CNPY2 (Arg21~Leu182)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig Canopy 2 Homolog (CNPY2) |
Canopy 2 Homolog (CNPY2) Polyclonal Antibody (Human, Pig), APC |
4-PAM449Hu01-APC |
Cloud-Clone |
-
EUR 368.00
-
EUR 3599.00
-
EUR 993.00
-
EUR 472.00
-
EUR 229.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CNPY2 (Arg21~Leu182)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig Canopy 2 Homolog (CNPY2). This antibody is labeled with APC. |
Canopy 2 Homolog (CNPY2) Polyclonal Antibody (Human, Pig), Biotinylated |
4-PAM449Hu01-Biotin |
Cloud-Clone |
-
EUR 328.00
-
EUR 2697.00
-
EUR 786.00
-
EUR 404.00
-
EUR 226.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CNPY2 (Arg21~Leu182)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig Canopy 2 Homolog (CNPY2). This antibody is labeled with Biotin. |
Canopy 2 Homolog (CNPY2) Polyclonal Antibody (Human, Pig), Cy3 |
4-PAM449Hu01-Cy3 |
Cloud-Clone |
-
EUR 449.00
-
EUR 4757.00
-
EUR 1283.00
-
EUR 588.00
-
EUR 264.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CNPY2 (Arg21~Leu182)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig Canopy 2 Homolog (CNPY2). This antibody is labeled with Cy3. |
Canopy 2 Homolog (CNPY2) Polyclonal Antibody (Human, Pig), FITC |
4-PAM449Hu01-FITC |
Cloud-Clone |
-
EUR 314.00
-
EUR 2899.00
-
EUR 814.00
-
EUR 397.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CNPY2 (Arg21~Leu182)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig Canopy 2 Homolog (CNPY2). This antibody is labeled with FITC. |
Canopy 2 Homolog (CNPY2) Polyclonal Antibody (Human, Pig), HRP |
4-PAM449Hu01-HRP |
Cloud-Clone |
-
EUR 335.00
-
EUR 3135.00
-
EUR 877.00
-
EUR 426.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CNPY2 (Arg21~Leu182)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig Canopy 2 Homolog (CNPY2). This antibody is labeled with HRP. |
Canopy 2 Homolog (CNPY2) Polyclonal Antibody (Human, Pig), PE |
4-PAM449Hu01-PE |
Cloud-Clone |
-
EUR 314.00
-
EUR 2899.00
-
EUR 814.00
-
EUR 397.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CNPY2 (Arg21~Leu182)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig Canopy 2 Homolog (CNPY2). This antibody is labeled with PE. |
Canopy 2 Homolog (CNPY2) Polyclonal Antibody (Human, Pig), APC-Cy7 |
4-PAM449Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 616.00
-
EUR 7078.00
-
EUR 1867.00
-
EUR 824.00
-
EUR 338.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CNPY2 (Arg21~Leu182)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig Canopy 2 Homolog (CNPY2). This antibody is labeled with APC-Cy7. |
Human Canopy 3 Homolog (CNPY3) ELISA Kit |
abx386611-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Canopy 4 Homolog (CNPY4) ELISA Kit |
abx386612-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Protein canopy homolog 2 Polyclonal Antibody |
42421-100ul |
SAB |
100ul |
EUR 333 |
Human Protein canopy homolog 3(CNPY3) ELISA kit |
E01P0801-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Protein canopy homolog 3(CNPY3) ELISA kit |
E01P0801-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Protein canopy homolog 3(CNPY3) ELISA kit |
E01P0801-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Protein canopy homolog 1, CNPY1 ELISA KIT |
ELI-10076h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protein canopy homolog 4, CNPY4 ELISA KIT |
ELI-33026h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protein canopy homolog 3, CNPY3 ELISA KIT |
ELI-51011h |
Lifescience Market |
96 Tests |
EUR 824 |
Canopy 3 Homolog Protein |
20-abx261031 |
Abbexa |
-
EUR 3418.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Protein canopy homolog 2 Polyclonal Conjugated Antibody |
C42421 |
SAB |
100ul |
EUR 397 |
Rabbit Protein canopy homolog 3(CNPY3) ELISA kit |
E04P0801-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Protein canopy homolog 3(CNPY3) ELISA kit |
E04P0801-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Protein canopy homolog 3(CNPY3) ELISA kit |
E04P0801-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Protein canopy homolog 3(CNPY3) ELISA kit |
E02P0801-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Protein canopy homolog 3(CNPY3) ELISA kit |
E02P0801-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Protein canopy homolog 3(CNPY3) ELISA kit |
E02P0801-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Protein canopy homolog 3(CNPY3) ELISA kit |
E03P0801-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Protein canopy homolog 3(CNPY3) ELISA kit |
E03P0801-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Protein canopy homolog 3(CNPY3) ELISA kit |
E03P0801-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Protein canopy homolog 3(CNPY3) ELISA kit |
E06P0801-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Protein canopy homolog 3(CNPY3) ELISA kit |
E06P0801-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Protein canopy homolog 3(CNPY3) ELISA kit |
E06P0801-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Protein canopy homolog 3(CNPY3) ELISA kit |
E08P0801-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Protein canopy homolog 3(CNPY3) ELISA kit |
E08P0801-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Protein canopy homolog 3(CNPY3) ELISA kit |
E08P0801-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Protein canopy homolog 3(CNPY3) ELISA kit |
E07P0801-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Protein canopy homolog 3(CNPY3) ELISA kit |
E07P0801-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Protein canopy homolog 3(CNPY3) ELISA kit |
E07P0801-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Protein canopy homolog 3(CNPY3) ELISA kit |
E09P0801-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Protein canopy homolog 3(CNPY3) ELISA kit |
E09P0801-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Protein canopy homolog 3(CNPY3) ELISA kit |
E09P0801-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Protein canopy homolog 1, Cnpy1 ELISA KIT |
ELI-09145m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Protein canopy homolog 4, Cnpy4 ELISA KIT |
ELI-10077m |
Lifescience Market |
96 Tests |
EUR 865 |
Porcine Protein canopy homolog 3, CNPY3 ELISA KIT |
ELI-10589p |
Lifescience Market |
96 Tests |
EUR 928 |
Bovine Protein canopy homolog 4, CNPY4 ELISA KIT |
ELI-10846b |
Lifescience Market |
96 Tests |
EUR 928 |
Mouse Protein canopy homolog 3, Cnpy3 ELISA KIT |
ELI-25933m |
Lifescience Market |
96 Tests |
EUR 865 |
Bovine Protein canopy homolog 3, CNPY3 ELISA KIT |
ELI-50327b |
Lifescience Market |
96 Tests |
EUR 928 |
Canopy 3 Homolog (CNPY3) Antibody |
20-abx006907 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Canopy 3 Homolog (CNPY3) Antibody |
20-abx030445 |
Abbexa |
-
EUR 98.00
-
EUR 133.00
-
EUR 523.00
|
|
- Shipped within 5-10 working days.
|
Canopy 3 Homolog (CNPY3) Antibody |
abx030445-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Canopy 3 Homolog (CNPY3) Antibody |
20-abx320882 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Canopy 4 Homolog (CNPY4) Antibody |
20-abx309635 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Canopy 3 Homolog (CNPY3) Antibody |
20-abx321859 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Canopy 3 Homolog (CNPY3) Antibody |
20-abx225119 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Canopy 3 Homolog (CNPY3) Antibody |
abx231816-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Canopy 4 Homolog (CNPY4) Antibody |
abx231817-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
CNPY3 Canopy 3 Homolog Human Recombinant Protein |
PROTQ9BT09 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: CNPY3 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 271 amino acids (31-278 a.a.) and having a molecular mass of 29.9kDa. CNPY3 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
Guinea pig Protein canopy homolog 3(CNPY3) ELISA kit |
E05P0801-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Protein canopy homolog 3(CNPY3) ELISA kit |
E05P0801-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Protein canopy homolog 3(CNPY3) ELISA kit |
E05P0801-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Canopy 4 Homolog (CNPY4) Antibody (HRP) |
20-abx309636 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Canopy 4 Homolog (CNPY4) Antibody (FITC) |
20-abx309637 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Canopy 4 Homolog (CNPY4) Antibody (Biotin) |
20-abx309638 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
CNPY2 ELISA Kit (Human) (OKCD00621) |
OKCD00621 |
Aviva Systems Biology |
96 Wells |
EUR 909 |
Description: Description of target: Positive regulator of neurite outgrowth by stabilizing myosin regulatory light chain (MRLC). It prevents MIR-mediated MRLC ubiquitination and its subsequent proteasomal degradation. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.053 ng/mL |
CNPY2 ELISA Kit (Human) (OKDD00196) |
OKDD00196 |
Aviva Systems Biology |
96 Wells |
EUR 1053 |
Description: Description of target: Positive regulator of neurite outgrowth by stabilizing myosin regulatory light chain (MRLC). It prevents MIR-mediated MRLC ubiquitination and its subsequent proteasomal degradation.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.062 ng/mL |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Cnpy2 ELISA Kit (Mouse) (OKCD02073) |
OKCD02073 |
Aviva Systems Biology |
96 Wells |
EUR 936 |
Description: Description of target: Positive regulator of neurite outgrowth by stabilizing myosin regulatory light chain (MRLC). It prevents MIR-mediated MRLC ubiquitination and its subsequent proteasomal degradation.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.055 ng/mL |
CNPY2 antibody |
70R-21486 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal CNPY2 antibody |
CNPY2 antibody |
70R-15364 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal CNPY2 antibody |
CNPY2 Antibody |
42954-100ul |
SAB |
100ul |
EUR 252 |
CNPY2 Antibody |
1-CSB-PA005675GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against CNPY2. Recognizes CNPY2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
CNPY2 Antibody |
1-CSB-PA05034A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CNPY2. Recognizes CNPY2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
CNPY2 siRNA |
20-abx912295 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CNPY2 siRNA |
20-abx912296 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS |
AP-STR-KIT-2 |
CORNING |
1/pk |
EUR 367 |
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller |
CNPY2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0477803 |
ABM |
1.0 ug DNA |
EUR 154 |
Human CNPY2 shRNA Plasmid |
20-abx957003 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
CNPY2 Recombinant Protein (Human) |
RP007531 |
ABM |
100 ug |
Ask for price |
Human Slit Homolog 2 ELISA kit |
E01S0112-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Slit Homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Slit Homolog 2 ELISA kit |
E01S0112-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Slit Homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Slit Homolog 2 ELISA kit |
E01S0112-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Slit Homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
CNPY2 Rabbit pAb |
A12197-100ul |
Abclonal |
100 ul |
EUR 308 |
CNPY2 Rabbit pAb |
A12197-200ul |
Abclonal |
200 ul |
EUR 459 |
CNPY2 Rabbit pAb |
A12197-20ul |
Abclonal |
20 ul |
EUR 183 |
CNPY2 Rabbit pAb |
A12197-50ul |
Abclonal |
50 ul |
EUR 223 |
CNPY2 antibody (HRP) |
60R-1906 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal CNPY2 antibody (HRP) |
CNPY2 antibody (FITC) |
60R-1907 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal CNPY2 antibody (FITC) |
CNPY2 antibody (biotin) |
60R-1908 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal CNPY2 antibody (biotin) |
CNPY2 cloning plasmid |
CSB-CL896486HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 549
- Sequence: atgaaaggctggggttggctggccctgcttctgggggccctgctgggaaccgcctgggctcggaggagccaggatctccactgtggagcatgcagggctctggtggatgaactagaatgggaaattgcccaggtggaccccaagaagaccattcagatgggatctttccggatcaa
- Show more
|
Description: A cloning plasmid for the CNPY2 gene. |
CNPY2,MSAP Antibody |
DF12367 |
Affbiotech |
200ul |
EUR 304 |
Description: CNPY2,MSAP antibody detects endogenous levels of CNPY2,MSAP. |
CNPY2 Conjugated Antibody |
C42954 |
SAB |
100ul |
EUR 397 |
CNPY2, MSAP Antibody |
abx231814-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
CNPY2,MSAP Antibody |
abx231815-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
CNPY2 Polyclonal Antibody |
A53985 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
CNPY2 ORF Vector (Human) (pORF) |
ORF002511 |
ABM |
1.0 ug DNA |
EUR 95 |
human snail homolog 2,SNAI2 ELISA Kit |
201-12-1878 |
SunredBio |
96 tests |
EUR 440 |
- This snail homolog 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Frizzled Homolog 2 (FZD2)ELISA Kit |
201-12-2370 |
SunredBio |
96 tests |
EUR 440 |
- This Frizzled Homolog 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Chromobox Homolog 2 (CBX2)ELISA Kit |
201-12-2895 |
SunredBio |
96 tests |
EUR 440 |
- This Chromobox Homolog 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Slit Homolog 2 (Slit2) ELISA Kit |
DLR-Slit2-Hu-48T |
DL Develop |
48T |
EUR 479 |
- Should the Human Slit Homolog 2 (Slit2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Slit Homolog 2 (Slit2) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Slit Homolog 2 (Slit2) ELISA Kit |
DLR-Slit2-Hu-96T |
DL Develop |
96T |
EUR 621 |
- Should the Human Slit Homolog 2 (Slit2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Slit Homolog 2 (Slit2) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Slingshot Homolog 2 (SSH2) ELISA Kit |
DLR-SSH2-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Slingshot Homolog 2 (SSH2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Slingshot Homolog 2 (SSH2) in samples from tissue homogenates or other biological fluids. |
Human Slingshot Homolog 2 (SSH2) ELISA Kit |
DLR-SSH2-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Slingshot Homolog 2 (SSH2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Slingshot Homolog 2 (SSH2) in samples from tissue homogenates or other biological fluids. |
Human Notch Homolog 2 (NOTCH2) ELISA Kit |
DLR-NOTCH2-Hu-48T |
DL Develop |
48T |
EUR 554 |
- Should the Human Notch Homolog 2 (NOTCH2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Notch Homolog 2 (NOTCH2) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Notch Homolog 2 (NOTCH2) ELISA Kit |
DLR-NOTCH2-Hu-96T |
DL Develop |
96T |
EUR 725 |
- Should the Human Notch Homolog 2 (NOTCH2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Notch Homolog 2 (NOTCH2) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human DAB2/ Disabled homolog 2 ELISA Kit |
E0655Hu |
Sunlong |
1 Kit |
EUR 571 |
Human Anterior Gradient Homolog 2 ELISA kit |
E01A0457-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Anterior Gradient Homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Anterior Gradient Homolog 2 ELISA kit |
E01A0457-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Anterior Gradient Homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |