Mouse CRYgS(Crystallin Gamma S) ELISA Kit

Mouse CRYgS(Crystallin Gamma S) ELISA Kit

To Order Contact us:  Mark@operatiebrp.nl

Mouse Crystallin Gamma S (CRYgS) ELISA Kit

4-SEF353Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Crystallin Gamma S elisa. Alternative names of the recognized antigen: CRYG8
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Crystallin Gamma S (CRYgS) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Crystallin Gamma S (CRYgS) Antibody

20-abx129441
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Crystallin Gamma S (CRYGS) Antibody

abx145026-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Crystallin Gamma S (CRYGS) Antibody

20-abx006571
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Crystallin Gamma S (CRYGS) Antibody

20-abx322535
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Recombinant Crystallin Gamma S (CRYgS)

4-RPF353Mu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O35486
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 24.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Crystallin Gamma S expressed in: E.coli

Mouse Crystallin Gamma S (CRYgS) Protein

20-abx168389
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Crystallin Gamma S (CRYgS) CLIA Kit

20-abx494875
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Crystallin Gamma S (CRYGS) ELISA Kit

abx384739-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Crystallin Gamma S (CRYGS) ELISA Kit

abx391155-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

ELISA kit for Mouse CRYgS (Crystallin Gamma S)

ELK7344 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Crystallin Gamma S (CRY?S). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Crystal
  • Show more
Description: A sandwich ELISA kit for detection of Crystallin Gamma S from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Crystallin Gamma S (CRYgS) Polyclonal Antibody (Mouse, Rat)

4-PAF353Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRYgS (Ser2~Glu178)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Crystallin Gamma S (CRYgS)

CRYGS Crystallin, Gamma S Human Recombinant Protein

PROTP22914 Regular: 20ug
EUR 317
Description: CRYGS Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 202 amino acids (1-178) and having a molecular mass of 23.6 kDa.;The CRYGS is fused to a 24 amino acid His-Tag at N-terminus and purified by proprietary chromatographic techniques.

Mouse β crystallin S(CRYGS) ELISA kit

E03B0895-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β crystallin S(CRYGS) ELISA kit

E03B0895-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β crystallin S(CRYGS) ELISA kit

E03B0895-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Beta- crystallin S, Crygs ELISA KIT

ELI-09076m 96 Tests
EUR 865

Crystallin Gamma S (CRYgS) Polyclonal Antibody (Mouse, Rat), APC

4-PAF353Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRYgS (Ser2~Glu178)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Crystallin Gamma S (CRYgS). This antibody is labeled with APC.

Crystallin Gamma S (CRYgS) Polyclonal Antibody (Mouse, Rat), Biotinylated

4-PAF353Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRYgS (Ser2~Glu178)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Crystallin Gamma S (CRYgS). This antibody is labeled with Biotin.

Crystallin Gamma S (CRYgS) Polyclonal Antibody (Mouse, Rat), Cy3

4-PAF353Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRYgS (Ser2~Glu178)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Crystallin Gamma S (CRYgS). This antibody is labeled with Cy3.

Crystallin Gamma S (CRYgS) Polyclonal Antibody (Mouse, Rat), FITC

4-PAF353Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRYgS (Ser2~Glu178)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Crystallin Gamma S (CRYgS). This antibody is labeled with FITC.

Crystallin Gamma S (CRYgS) Polyclonal Antibody (Mouse, Rat), HRP

4-PAF353Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRYgS (Ser2~Glu178)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Crystallin Gamma S (CRYgS). This antibody is labeled with HRP.

Crystallin Gamma S (CRYgS) Polyclonal Antibody (Mouse, Rat), PE

4-PAF353Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRYgS (Ser2~Glu178)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Crystallin Gamma S (CRYgS). This antibody is labeled with PE.

Crygs ELISA Kit| Mouse Beta-crystallin S ELISA Kit

EF014554 96 Tests
EUR 689

Goat β crystallin S(CRYGS) ELISA kit

E06B0895-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat β crystallin S(CRYGS) ELISA kit

E06B0895-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat β crystallin S(CRYGS) ELISA kit

E06B0895-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat β crystallin S(CRYGS) ELISA kit

E02B0895-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat β crystallin S(CRYGS) ELISA kit

E02B0895-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat β crystallin S(CRYGS) ELISA kit

E02B0895-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human β crystallin S(CRYGS) ELISA kit

E01B0895-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human β crystallin S(CRYGS) ELISA kit

E01B0895-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human β crystallin S(CRYGS) ELISA kit

E01B0895-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit β crystallin S(CRYGS) ELISA kit

E04B0895-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit β crystallin S(CRYGS) ELISA kit

E04B0895-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit β crystallin S(CRYGS) ELISA kit

E04B0895-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig β crystallin S(CRYGS) ELISA kit

E07B0895-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig β crystallin S(CRYGS) ELISA kit

E07B0895-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig β crystallin S(CRYGS) ELISA kit

E07B0895-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey β crystallin S(CRYGS) ELISA kit

E09B0895-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey β crystallin S(CRYGS) ELISA kit

E09B0895-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey β crystallin S(CRYGS) ELISA kit

E09B0895-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog β crystallin S(CRYGS) ELISA kit

E08B0895-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog β crystallin S(CRYGS) ELISA kit

E08B0895-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog β crystallin S(CRYGS) ELISA kit

E08B0895-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Beta- crystallin S, CRYGS ELISA KIT

ELI-26440h 96 Tests
EUR 824

Rabbit Beta- crystallin S, CRYGS ELISA KIT

ELI-09077Ra 96 Tests
EUR 928

Bovine Beta- crystallin S, CRYGS ELISA KIT

ELI-50472b 96 Tests
EUR 928

Human Beta-crystallin S (CRYGS

1-CSB-EP006025HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 47.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Beta-crystallin S(CRYGS expressed in E.coli

Crystallin Gamma S (CRYgS) Polyclonal Antibody (Mouse, Rat), APC-Cy7

4-PAF353Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRYgS (Ser2~Glu178)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Crystallin Gamma S (CRYgS). This antibody is labeled with APC-Cy7.

Guinea pig β crystallin S(CRYGS) ELISA kit

E05B0895-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig β crystallin S(CRYGS) ELISA kit

E05B0895-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig β crystallin S(CRYGS) ELISA kit

E05B0895-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Crygs ELISA Kit| Rat Beta-crystallin S ELISA Kit

EF018509 96 Tests
EUR 689

CRYGS ELISA Kit| Bovine Beta-crystallin S ELISA Kit

EF011257 96 Tests
EUR 689

Gamma-S-crystallin Antibody

20-abx141438
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Crystallin, gamma S Protein

20-abx261512
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Crygs/ Rat Crygs ELISA Kit

ELI-10496r 96 Tests
EUR 886

Mouse Gamma-crystallin D (Crygd) ELISA Kit

abx556044-96tests 96 tests
EUR 668
  • Shipped within 1-3 weeks.

Mouse Gamma- crystallin E, Cryge ELISA KIT

ELI-10114m 96 Tests
EUR 865

Mouse Gamma- crystallin A, Cryga ELISA KIT

ELI-25517m 96 Tests
EUR 865

Mouse Gamma- crystallin B, Crygb ELISA KIT

ELI-25694m 96 Tests
EUR 865

Mouse Gamma- crystallin D, Crygd ELISA KIT

ELI-26464m 96 Tests
EUR 865

Mouse Gamma- crystallin C, Crygc ELISA KIT

ELI-46664m 96 Tests
EUR 865

Mouse Gamma- crystallin F, Crygf ELISA KIT

ELI-31981m 96 Tests
EUR 865

Mouse Gamma- crystallin N, Crygn ELISA KIT

ELI-32335m 96 Tests
EUR 865

Mouse Crystallin Gamma F (CRYGF) ELISA Kit

20-abx156978
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Crystallin Gamma F (CRYgF) ELISA Kit

SEC989Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Gamma F (CRYgF) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Gamma F (CRYgF) in tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Gamma F (CRYgF) ELISA Kit

SEC989Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Gamma F (CRYgF) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Gamma F (CRYgF) in tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Gamma F (CRYgF) ELISA Kit

SEC989Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Gamma F (CRYgF) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Gamma F (CRYgF) in tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Gamma F (CRYgF) ELISA Kit

SEC989Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Gamma F (CRYgF) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Gamma F (CRYgF) in tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Gamma F (CRYgF) ELISA Kit

4-SEC989Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Crystallin Gamma F elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Crystallin Gamma F (CRYgF) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Mouse CRYgF (Crystallin Gamma F)

ELK7345 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Crystallin Gamma F (CRY?F). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Crystal
  • Show more
Description: A sandwich ELISA kit for detection of Crystallin Gamma F from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse Crystallin Gamma F (CRYgF) CLIA Kit

20-abx494033
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

anti-Beta crystallin S

YF-PA11110 50 ul
EUR 363
Description: Mouse polyclonal to Beta crystallin S

anti-Beta crystallin S

YF-PA11111 50 ug
EUR 363
Description: Mouse polyclonal to Beta crystallin S

Cow Gamma-crystallin D (CRYGD) ELISA Kit

abx555742-96tests 96 tests
EUR 911
  • Shipped within 1-3 weeks.

Human Gamma-crystallin D (CRYGD) ELISA Kit

abx555998-96tests 96 tests
EUR 668
  • Shipped within 1-3 weeks.

Rat Gamma-crystallin D (Crygd) ELISA Kit

abx556196-96tests 96 tests
EUR 668
  • Shipped within 1-3 weeks.

Human CRYGD/ Gamma-crystallin D ELISA Kit

E0566Hu 1 Kit
EUR 605

ELISA kit for Human Gamma-crystallin D

EK2890 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Gamma-crystallin D in samples from serum, plasma, tissue homogenates and other biological fluids.

Human Gamma- crystallin A, CRYGA ELISA KIT

ELI-10457h 96 Tests
EUR 824

Bovine Gamma- crystallin C, CRYGC ELISA KIT

ELI-25518b 96 Tests
EUR 928

Bovine Gamma- crystallin B, CRYGB ELISA KIT

ELI-25693b 96 Tests
EUR 928

Bovine Gamma- crystallin F, CRYGF ELISA KIT

ELI-09008b 96 Tests
EUR 928

Bovine Gamma- crystallin A, CRYGA ELISA KIT

ELI-09329b 96 Tests
EUR 928

Human Gamma- crystallin B, CRYGB ELISA KIT

ELI-33747h 96 Tests
EUR 824

Human Gamma- crystallin D, CRYGD ELISA KIT

ELI-46665h 96 Tests
EUR 824

Bovine Gamma- crystallin D, CRYGD ELISA KIT

ELI-47522b 96 Tests
EUR 928

Human Gamma- crystallin C, CRYGC ELISA KIT

ELI-31980h 96 Tests
EUR 824

Human Gamma- crystallin N, CRYGN ELISA KIT

ELI-50461h 96 Tests
EUR 824

Cow Crystallin Gamma D (CRYGD) ELISA Kit

20-abx380207
  • EUR 7911.00
  • EUR 4215.00
  • EUR 973.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human Crystallin Gamma D (CRYGD) ELISA Kit

20-abx384740
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human Crystallin Gamma C (CRYGC) ELISA Kit

abx386689-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Crystallin Gamma N (CRYGN) ELISA Kit

abx386690-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Crystallin Gamma D (CRYGD) ELISA Kit

20-abx391156
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Crystallin, gamma C Protein

20-abx260888
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Crystallin, gamma N Protein

20-abx260916
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Crystallin, gamma D Protein

20-abx261483
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Crystallin Gamma C antibody

70R-2030 50 ug
EUR 467
Description: Rabbit polyclonal Crystallin Gamma C antibody raised against the middle region of CRYGC

Crygd ELISA Kit| Rat Gamma-crystallin D ELISA Kit

EF018510 96 Tests
EUR 689

CRYGD ELISA Kit| Bovine Gamma-crystallin D ELISA Kit

EF011258 96 Tests
EUR 689

Mouse Crystallin Gamma F (CRYgF) Protein

20-abx168437
  • EUR 718.00
  • EUR 286.00
  • EUR 2207.00
  • EUR 843.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Canine CRYGS ELISA KIT

ELI-25690d 96 Tests
EUR 928

CRYGS ELISA KIT|Human

EF004793 96 Tests
EUR 689

Anti-Beta crystallin S Antibody

STJ500306 100 µg
EUR 476

Anti-Beta crystallin S Antibody

STJ500307 100 µg
EUR 476

CRYGD Crystallin, Gamma D Mouse Recombinant Protein

PROTP04342 Regular: 20ug
EUR 317
Description: CRYGD Mouse Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 197 amino acids (1-174 a.a.) and having a molecular mass of 23.5kDa.;CRYGD is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Crystallin Gamma F (CRYgF) Polyclonal Antibody (Mouse)

4-PAC989Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRYgF (Met1~Phe173)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Crystallin Gamma F (CRYgF)

Crystallin Gamma C (CRYGC) Antibody

20-abx123514
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Crystallin Gamma C (CRYGC) Antibody

20-abx111825
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Crystallin Gamma F (CRYgF) Antibody

20-abx129483
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Gamma-Crystallin D (CRYGD) Antibody

abx145056-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Crystallin Gamma N (CRYGN) Antibody

abx145327-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Gamma-Crystallin D (CRYGD) Antibody

20-abx004390
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Gamma-Crystallin D (CRYGD) Antibody

abx030580-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Gamma-Crystallin D (CRYGD) Antibody

abx030580-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Gamma-Crystallin D (CRYGD) Antibody

20-abx321764
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Crystallin Gamma N (CRYGN) Antibody

20-abx309489
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Crystallin Gamma C (CRYGC) Antibody

abx232005-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Crystallin Gamma N (CRYGN) Antibody

abx232006-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Crystallin Gamma C Blocking Peptide

33R-3422 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CRYGC antibody, catalog no. 70R-2030

Human gamma C Crystallin Antibody

33355-05111 150 ug
EUR 261

Rat Gamma-crystallin B (Crygb)

1-CSB-YP006018RA
  • EUR 504.00
  • EUR 265.00
  • EUR 1832.00
  • EUR 763.00
  • EUR 1216.00
  • EUR 334.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 23 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Gamma-crystallin B(Crygb) expressed in Yeast

Human Gamma-crystallin B (CRYGB)

1-CSB-EP006018HU
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 24.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Gamma-crystallin B(CRYGB) expressed in E.coli

Human Gamma-crystallin D (CRYGD)

1-CSB-EP006020HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 47.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Gamma-crystallin D(CRYGD) expressed in E.coli

Recombinant human Gamma-crystallin B

P1661 100ug Ask for price
  • Uniprot ID: P07316
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Gamma-crystallin B

Recombinant Crystallin Gamma F (CRYgF)

4-RPC989Mu01
  • EUR 510.37
  • EUR 239.00
  • EUR 1638.88
  • EUR 612.96
  • EUR 1125.92
  • EUR 404.00
  • EUR 3947.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9CXV3
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 24.8KDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Crystallin Gamma F expressed in: E.coli

Anti-gamma C Crystallin (7C4)

YF-MA12545 50 ug
EUR 363
Description: Mouse monoclonal to gamma C Crystallin

Anti-gamma C Crystallin (7C4)

YF-MA12546 200 ul
EUR 363
Description: Mouse monoclonal to gamma C Crystallin

Anti-gamma C Crystallin (7C4)

YF-MA12547 200 ul
EUR 363
Description: Mouse monoclonal to gamma C Crystallin

Anti-gamma C Crystallin (7C4)

YF-MA12548 50 ug
EUR 363
Description: Mouse monoclonal to gamma C Crystallin

(S)-Crizotinib

A8802-S Evaluation Sample
EUR 81
Description: (S)-crizotinibthe selectively inhibited MTH1 catalytic activity with IC50 of 72 nM, while clinically used (R)-enantiomer of the drug was inactive with IC50 of 1375 nM.

Mouse β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit

E03B0894-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit

E03B0894-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit

E03B0894-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Anti-Beta crystallin S Antibody BIOTIN

STJ500308 100 µg
EUR 586

Anti-Beta crystallin S Antibody FITC

STJ500309 100 µg
EUR 586

Anti-Beta crystallin S Antibody BIOTIN

STJ500310 100 µg
EUR 586

Anti-Beta crystallin S Antibody FITC

STJ500311 100 µg
EUR 586

Crystallin Gamma F (CRYgF) Polyclonal Antibody (Mouse), APC

4-PAC989Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRYgF (Met1~Phe173)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Crystallin Gamma F (CRYgF). This antibody is labeled with APC.

Crystallin Gamma F (CRYgF) Polyclonal Antibody (Mouse), Biotinylated

4-PAC989Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRYgF (Met1~Phe173)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Crystallin Gamma F (CRYgF). This antibody is labeled with Biotin.

Crystallin Gamma F (CRYgF) Polyclonal Antibody (Mouse), Cy3

4-PAC989Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRYgF (Met1~Phe173)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Crystallin Gamma F (CRYgF). This antibody is labeled with Cy3.

Crystallin Gamma F (CRYgF) Polyclonal Antibody (Mouse), FITC

4-PAC989Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRYgF (Met1~Phe173)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Crystallin Gamma F (CRYgF). This antibody is labeled with FITC.

Crystallin Gamma F (CRYgF) Polyclonal Antibody (Mouse), HRP

4-PAC989Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRYgF (Met1~Phe173)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Crystallin Gamma F (CRYgF). This antibody is labeled with HRP.

Crystallin Gamma F (CRYgF) Polyclonal Antibody (Mouse), PE

4-PAC989Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRYgF (Met1~Phe173)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Crystallin Gamma F (CRYgF). This antibody is labeled with PE.

Mouse CRYGS shRNA Plasmid

20-abx969838
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CRYGS Recombinant Protein (Mouse)

RP126197 100 ug Ask for price

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Crystallin Gamma N (CRYGN) Antibody (HRP)

20-abx309490
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Crystallin Gamma N (CRYGN) Antibody (FITC)

20-abx309491
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Crystallin Gamma N (CRYGN) Antibody (Biotin)

20-abx309492
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

CRYGS siRNA

20-abx901283
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CRYGS siRNA

20-abx912893
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CRYGS siRNA

20-abx912894
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CRYGS Antibody

46546-100ul 100ul
EUR 252

CRYGS Antibody

1-CSB-PA006025ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CRYGS. Recognizes CRYGS from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

Rabbit Anti-Mouse Synuclein-gamma antiserum # 1

SYN14-S 100 ul
EUR 457

Mouse Alpha B Crystallin ELISA kit

E03C0343-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Alpha B Crystallin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Alpha B Crystallin ELISA kit

E03C0343-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Alpha B Crystallin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Alpha B Crystallin ELISA kit

E03C0343-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Alpha B Crystallin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Crystallin Gamma F (CRYgF) Polyclonal Antibody (Mouse), APC-Cy7

4-PAC989Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRYgF (Met1~Phe173)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Crystallin Gamma F (CRYgF). This antibody is labeled with APC-Cy7.

Rabbit Anti-Mouse Neprilysin-beta (NEPL-gamma) antiserum

NEPLG31-S 100 ul
EUR 457

Mouse Cystatin S(Cys-S)ELISA Kit

QY-E20430 96T
EUR 361

Goat β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit

E06B0894-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit

E06B0894-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit

E06B0894-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit

E02B0894-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit

E02B0894-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit

E02B0894-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit

E01B0894-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit

E01B0894-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit

E01B0894-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit

E04B0894-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit

E04B0894-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit

E04B0894-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit

E07B0894-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit

E07B0894-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit

E07B0894-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit

E09B0894-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit

E09B0894-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit

E09B0894-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit

E08B0894-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit

E08B0894-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit

E08B0894-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Crygs ORF Vector (Mouse) (pORF)

ORF042067 1.0 ug DNA
EUR 506

Human gamma C Crystallin Antibody (Biotin Conjugate)

33355-05121 150 ug
EUR 369

CRYGC Crystallin, Gamma C Human Recombinant Protein

PROTP07315 Regular: 20ug
EUR 317
Description: CRYGC Human Recombinant produced in E. coli is a single polypeptide chain containing 198 amino acids (1-174) and having a molecular mass of 23.5kDa.;CRYGC is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

CRYGD Crystallin, Gamma D Human Recombinant Protein

PROTP07320 Regular: 20ug
EUR 317
Description: CRYGD Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 194 amino acids (1-174 a.a.) and having a molecular mass of 22.9kDa.;CRYGD is fused to a 20 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

CRYGN Crystallin, Gamma N Human Recombinant Protein

PROTQ8WXF5 Regular: 20ug
EUR 317
Description: CRYGN Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 206 amino acids (1-182 a.a) and having a molecular mass of 23.1kDa.;CRYGN is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

(S)-3-Hydroxy-Gamma-Butyrolactone

abx188035-1000g 1000 g
EUR 871
  • Shipped within 1-2 weeks.

Mouse Lambda crystallin homolog(CRYL1) ELISA kit

E03L0316-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Lambda crystallin homolog(CRYL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Lambda crystallin homolog(CRYL1) ELISA kit

E03L0316-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Lambda crystallin homolog(CRYL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Lambda crystallin homolog(CRYL1) ELISA kit

E03L0316-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Lambda crystallin homolog(CRYL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β crystallin A2(CRYBA2) ELISA kit

E03B0889-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin A2(CRYBA2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β crystallin A2(CRYBA2) ELISA kit

E03B0889-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin A2(CRYBA2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β crystallin A2(CRYBA2) ELISA kit

E03B0889-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin A2(CRYBA2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β crystallin A4(CRYBA4) ELISA kit

E03B0890-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin A4(CRYBA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β crystallin A4(CRYBA4) ELISA kit

E03B0890-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin A4(CRYBA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β crystallin A4(CRYBA4) ELISA kit

E03B0890-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin A4(CRYBA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β crystallin B1(CRYBB1) ELISA kit

E03B0891-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin B1(CRYBB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β crystallin B1(CRYBB1) ELISA kit

E03B0891-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin B1(CRYBB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β crystallin B1(CRYBB1) ELISA kit

E03B0891-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin B1(CRYBB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β crystallin B2(CRYBB2) ELISA kit

E03B0892-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin B2(CRYBB2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β crystallin B2(CRYBB2) ELISA kit

E03B0892-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin B2(CRYBB2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β crystallin B2(CRYBB2) ELISA kit

E03B0892-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin B2(CRYBB2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β crystallin B3(CRYBB3) ELISA kit

E03B0893-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin B3(CRYBB3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β crystallin B3(CRYBB3) ELISA kit

E03B0893-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin B3(CRYBB3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β crystallin B3(CRYBB3) ELISA kit

E03B0893-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin B3(CRYBB3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse crystallin, β A1 (CRYBA1) ELISA kit

E03C2086-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse crystallin, β A1 (CRYBA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse crystallin, β A1 (CRYBA1) ELISA kit

E03C2086-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse crystallin, β A1 (CRYBA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse crystallin, β A1 (CRYBA1) ELISA kit

E03C2086-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse crystallin, β A1 (CRYBA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Beta- crystallin A1, Cryba1 ELISA KIT

ELI-10489m 96 Tests
EUR 865

Mouse Beta- crystallin A4, Cryba4 ELISA KIT

ELI-10490m 96 Tests
EUR 865

Mouse Beta- crystallin B2, Crybb2 ELISA KIT

ELI-26113m 96 Tests
EUR 865

Mouse Beta- crystallin B3, Crybb3 ELISA KIT

ELI-26438m 96 Tests
EUR 865

Mouse Lambda- crystallin homolog, Cryl1 ELISA KIT

ELI-26469m 96 Tests
EUR 865

Mouse Beta- crystallin B1, Crybb1 ELISA KIT

ELI-33761m 96 Tests
EUR 865

Mouse Beta- crystallin A2, Cryba2 ELISA KIT

ELI-31972m 96 Tests
EUR 865

Mouse Crystallin Beta A1 (CRYBA1) ELISA Kit

20-abx156974
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Crystallin Beta B1 (CRYBB1) ELISA Kit

20-abx156975
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Crystallin Beta B2 (CRYBB2) ELISA Kit

20-abx156976
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Crystallin alpha B (CRYaB) ELISA Kit

20-abx153876
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Crystallin Alpha B (CRYaB) ELISA Kit

DLR-CRYaB-Mu-48T 48T
EUR 527
  • Should the Mouse Crystallin Alpha B (CRYaB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Crystallin Alpha B (CRYaB) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Crystallin Alpha B (CRYaB) ELISA Kit

DLR-CRYaB-Mu-96T 96T
EUR 688
  • Should the Mouse Crystallin Alpha B (CRYaB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Crystallin Alpha B (CRYaB) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Crystallin Alpha B (CRYaB) ELISA Kit

SEC944Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Alpha B (CRYaB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Alpha B (CRYaB) in tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Alpha B (CRYaB) ELISA Kit

SEC944Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Alpha B (CRYaB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Alpha B (CRYaB) in tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Alpha B (CRYaB) ELISA Kit

SEC944Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Alpha B (CRYaB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Alpha B (CRYaB) in tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Alpha B (CRYaB) ELISA Kit

SEC944Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Alpha B (CRYaB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Alpha B (CRYaB) in tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Alpha B (CRYaB) ELISA Kit

4-SEC944Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Crystallin Alpha B elisa. Alternative names of the recognized antigen: CRY-AB
  • CRYA-B
  • CRYA2
  • CTPP2
  • HSPB5
  • Heat shock protein beta-5
  • Renal carcinoma antigen NY-REN-27
  • Rosenthal fiber component
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Crystallin Alpha B (CRYaB) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Crystallin Beta B2 ELISA Kit (CRYbB2)

RK02713 96 Tests
EUR 521

Mouse Crystallin Alpha B (CRYaB) ELISA Kit

RDR-CRYaB-Mu-48Tests 48 Tests
EUR 557

Mouse Crystallin Alpha B (CRYaB) ELISA Kit

RDR-CRYaB-Mu-96Tests 96 Tests
EUR 774

Mouse Crystallin Alpha B (CRYaB) ELISA Kit

RD-CRYaB-Mu-48Tests 48 Tests
EUR 533

Mouse Crystallin Alpha B (CRYaB) ELISA Kit

RD-CRYaB-Mu-96Tests 96 Tests
EUR 740

Mouse Crystallin Beta A1 (CRYbA1) ELISA Kit

SEF342Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta A1 (CRYbA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta A1 (CRYbA1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Beta A1 (CRYbA1) ELISA Kit

SEF342Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta A1 (CRYbA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta A1 (CRYbA1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Beta A1 (CRYbA1) ELISA Kit

SEF342Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta A1 (CRYbA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta A1 (CRYbA1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Beta A1 (CRYbA1) ELISA Kit

SEF342Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta A1 (CRYbA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta A1 (CRYbA1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Beta A1 (CRYbA1) ELISA Kit

4-SEF342Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Crystallin Beta A1 elisa. Alternative names of the recognized antigen: CRYB1
  • Eye Lens Structural Protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Crystallin Beta A1 (CRYbA1) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Crystallin Beta B1 (CRYbB1) ELISA Kit

SEF345Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta B1 (CRYbB1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta B1 (CRYbB1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Beta B1 (CRYbB1) ELISA Kit

SEF345Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta B1 (CRYbB1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta B1 (CRYbB1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Beta B1 (CRYbB1) ELISA Kit

SEF345Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta B1 (CRYbB1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta B1 (CRYbB1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Beta B1 (CRYbB1) ELISA Kit

SEF345Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta B1 (CRYbB1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta B1 (CRYbB1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Beta B1 (CRYbB1) ELISA Kit

4-SEF345Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Crystallin Beta B1 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Crystallin Beta B1 (CRYbB1) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Crystallin Beta B2 (CRYbB2) ELISA Kit

SEF346Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta B2 (CRYbB2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta B2 (CRYbB2) in tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Beta B2 (CRYbB2) ELISA Kit

SEF346Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta B2 (CRYbB2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta B2 (CRYbB2) in tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Beta B2 (CRYbB2) ELISA Kit

SEF346Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta B2 (CRYbB2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta B2 (CRYbB2) in tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Beta B2 (CRYbB2) ELISA Kit

SEF346Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta B2 (CRYbB2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta B2 (CRYbB2) in tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Beta B2 (CRYbB2) ELISA Kit

4-SEF346Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Crystallin Beta B2 elisa. Alternative names of the recognized antigen: CCA2
  • CRYB2
  • CRYB2A
  • Beta-crystallin Bp
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Crystallin Beta B2 (CRYbB2) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

CRYGS Conjugated Antibody

C46546 100ul
EUR 397

CRYGS cloning plasmid

CSB-CL006025HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 537
  • Sequence: atgtctaaaactggaaccaagattactttctatgaagacaaaaattttcaaggccgtcgctatgactgtgattgcgactgtgcagatttccacacatacctaagtcgctgcaactccattaaagtggaaggaggcacctgggctgtttatgaaaggcccaactttgctgggtacat
  • Show more
Description: A cloning plasmid for the CRYGS gene.

CRYGS Rabbit pAb

A7888-100ul 100 ul
EUR 308

CRYGS Rabbit pAb

A7888-200ul 200 ul
EUR 459

CRYGS Rabbit pAb

A7888-20ul 20 ul
EUR 183

CRYGS Rabbit pAb

A7888-50ul 50 ul
EUR 223

Human CRYGS Antibody

32845-05111 150 ug