Mouse CRYgS(Crystallin Gamma S) ELISA Kit

Mouse CRYgS(Crystallin Gamma S) ELISA Kit

To Order Contact us:  Mark@operatiebrp.nl

Mouse Crystallin Gamma S (CRYgS) ELISA Kit

4-SEF353Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Crystallin Gamma S elisa. Alternative names of the recognized antigen: CRYG8
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Crystallin Gamma S (CRYgS) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Crystallin Gamma S (CRYgS) Antibody

20-abx129441
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Crystallin Gamma S (CRYGS) Antibody

abx145026-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Crystallin Gamma S (CRYGS) Antibody

20-abx006571
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Crystallin Gamma S (CRYGS) Antibody

20-abx322535
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Recombinant Crystallin Gamma S (CRYgS)

4-RPF353Mu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O35486
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 24.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Crystallin Gamma S expressed in: E.coli

Mouse Crystallin Gamma S (CRYgS) Protein

20-abx168389
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Crystallin Gamma S (CRYgS) CLIA Kit

20-abx494875
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Crystallin Gamma S (CRYGS) ELISA Kit

abx384739-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Crystallin Gamma S (CRYGS) ELISA Kit

abx391155-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

ELISA kit for Mouse CRYgS (Crystallin Gamma S)

ELK7344 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Crystallin Gamma S (CRY?S). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Crystal
  • Show more
Description: A sandwich ELISA kit for detection of Crystallin Gamma S from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Crystallin Gamma S (CRYgS) Polyclonal Antibody (Mouse, Rat)

4-PAF353Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRYgS (Ser2~Glu178)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Crystallin Gamma S (CRYgS)

CRYGS Crystallin, Gamma S Human Recombinant Protein

PROTP22914 Regular: 20ug
EUR 317
Description: CRYGS Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 202 amino acids (1-178) and having a molecular mass of 23.6 kDa.;The CRYGS is fused to a 24 amino acid His-Tag at N-terminus and purified by proprietary chromatographic techniques.

Mouse β crystallin S(CRYGS) ELISA kit

E03B0895-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β crystallin S(CRYGS) ELISA kit

E03B0895-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β crystallin S(CRYGS) ELISA kit

E03B0895-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Beta- crystallin S, Crygs ELISA KIT

ELI-09076m 96 Tests
EUR 865

Crystallin Gamma S (CRYgS) Polyclonal Antibody (Mouse, Rat), APC

4-PAF353Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRYgS (Ser2~Glu178)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Crystallin Gamma S (CRYgS). This antibody is labeled with APC.

Crystallin Gamma S (CRYgS) Polyclonal Antibody (Mouse, Rat), Biotinylated

4-PAF353Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRYgS (Ser2~Glu178)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Crystallin Gamma S (CRYgS). This antibody is labeled with Biotin.

Crystallin Gamma S (CRYgS) Polyclonal Antibody (Mouse, Rat), Cy3

4-PAF353Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRYgS (Ser2~Glu178)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Crystallin Gamma S (CRYgS). This antibody is labeled with Cy3.

Crystallin Gamma S (CRYgS) Polyclonal Antibody (Mouse, Rat), FITC

4-PAF353Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRYgS (Ser2~Glu178)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Crystallin Gamma S (CRYgS). This antibody is labeled with FITC.

Crystallin Gamma S (CRYgS) Polyclonal Antibody (Mouse, Rat), HRP

4-PAF353Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRYgS (Ser2~Glu178)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Crystallin Gamma S (CRYgS). This antibody is labeled with HRP.

Crystallin Gamma S (CRYgS) Polyclonal Antibody (Mouse, Rat), PE

4-PAF353Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRYgS (Ser2~Glu178)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Crystallin Gamma S (CRYgS). This antibody is labeled with PE.

Crygs ELISA Kit| Mouse Beta-crystallin S ELISA Kit

EF014554 96 Tests
EUR 689

Goat β crystallin S(CRYGS) ELISA kit

E06B0895-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat β crystallin S(CRYGS) ELISA kit

E06B0895-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat β crystallin S(CRYGS) ELISA kit

E06B0895-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat β crystallin S(CRYGS) ELISA kit

E02B0895-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat β crystallin S(CRYGS) ELISA kit

E02B0895-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat β crystallin S(CRYGS) ELISA kit

E02B0895-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human β crystallin S(CRYGS) ELISA kit

E01B0895-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human β crystallin S(CRYGS) ELISA kit

E01B0895-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human β crystallin S(CRYGS) ELISA kit

E01B0895-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit β crystallin S(CRYGS) ELISA kit

E04B0895-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit β crystallin S(CRYGS) ELISA kit

E04B0895-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit β crystallin S(CRYGS) ELISA kit

E04B0895-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig β crystallin S(CRYGS) ELISA kit

E07B0895-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig β crystallin S(CRYGS) ELISA kit

E07B0895-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig β crystallin S(CRYGS) ELISA kit

E07B0895-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey β crystallin S(CRYGS) ELISA kit

E09B0895-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey β crystallin S(CRYGS) ELISA kit

E09B0895-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey β crystallin S(CRYGS) ELISA kit

E09B0895-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog β crystallin S(CRYGS) ELISA kit

E08B0895-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog β crystallin S(CRYGS) ELISA kit

E08B0895-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog β crystallin S(CRYGS) ELISA kit

E08B0895-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Beta- crystallin S, CRYGS ELISA KIT

ELI-26440h 96 Tests
EUR 824

Rabbit Beta- crystallin S, CRYGS ELISA KIT

ELI-09077Ra 96 Tests
EUR 928

Bovine Beta- crystallin S, CRYGS ELISA KIT

ELI-50472b 96 Tests
EUR 928

Human Beta-crystallin S (CRYGS

1-CSB-EP006025HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 47.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Beta-crystallin S(CRYGS expressed in E.coli

Crystallin Gamma S (CRYgS) Polyclonal Antibody (Mouse, Rat), APC-Cy7

4-PAF353Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRYgS (Ser2~Glu178)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Crystallin Gamma S (CRYgS). This antibody is labeled with APC-Cy7.

Guinea pig β crystallin S(CRYGS) ELISA kit

E05B0895-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig β crystallin S(CRYGS) ELISA kit

E05B0895-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig β crystallin S(CRYGS) ELISA kit

E05B0895-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Crygs ELISA Kit| Rat Beta-crystallin S ELISA Kit

EF018509 96 Tests
EUR 689

CRYGS ELISA Kit| Bovine Beta-crystallin S ELISA Kit

EF011257 96 Tests
EUR 689

Gamma-S-crystallin Antibody

20-abx141438
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Crystallin, gamma S Protein

20-abx261512
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Crygs/ Rat Crygs ELISA Kit

ELI-10496r 96 Tests
EUR 886

Mouse Gamma-crystallin D (Crygd) ELISA Kit

abx556044-96tests 96 tests
EUR 668
  • Shipped within 1-3 weeks.

Mouse Gamma- crystallin E, Cryge ELISA KIT

ELI-10114m 96 Tests
EUR 865

Mouse Gamma- crystallin A, Cryga ELISA KIT

ELI-25517m 96 Tests
EUR 865

Mouse Gamma- crystallin B, Crygb ELISA KIT

ELI-25694m 96 Tests
EUR 865

Mouse Gamma- crystallin D, Crygd ELISA KIT

ELI-26464m 96 Tests
EUR 865

Mouse Gamma- crystallin C, Crygc ELISA KIT

ELI-46664m 96 Tests
EUR 865

Mouse Gamma- crystallin F, Crygf ELISA KIT

ELI-31981m 96 Tests
EUR 865

Mouse Gamma- crystallin N, Crygn ELISA KIT

ELI-32335m 96 Tests
EUR 865

Mouse Crystallin Gamma F (CRYGF) ELISA Kit

20-abx156978
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Crystallin Gamma F (CRYgF) ELISA Kit

SEC989Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Gamma F (CRYgF) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Gamma F (CRYgF) in tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Gamma F (CRYgF) ELISA Kit

SEC989Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Gamma F (CRYgF) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Gamma F (CRYgF) in tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Gamma F (CRYgF) ELISA Kit

SEC989Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Gamma F (CRYgF) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Gamma F (CRYgF) in tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Gamma F (CRYgF) ELISA Kit

SEC989Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Gamma F (CRYgF) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Gamma F (CRYgF) in tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Gamma F (CRYgF) ELISA Kit

4-SEC989Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Crystallin Gamma F elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Crystallin Gamma F (CRYgF) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Mouse CRYgF (Crystallin Gamma F)

ELK7345 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Crystallin Gamma F (CRY?F). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Crystal
  • Show more
Description: A sandwich ELISA kit for detection of Crystallin Gamma F from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

CRYGS ELISA Kit (Mouse) (OKCD00461)

OKCD00461 96 Wells
EUR 857
Description: Description of target: Crystallins are the dominant structural components of the vertebrate eye lens. ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.063 ng/mL

Mouse Crystallin Gamma F (CRYgF) CLIA Kit

20-abx494033
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

anti-Beta crystallin S

YF-PA11110 50 ul
EUR 363
Description: Mouse polyclonal to Beta crystallin S

anti-Beta crystallin S

YF-PA11111 50 ug
EUR 363
Description: Mouse polyclonal to Beta crystallin S

Cow Gamma-crystallin D (CRYGD) ELISA Kit

abx555742-96tests 96 tests
EUR 911
  • Shipped within 1-3 weeks.

Human Gamma-crystallin D (CRYGD) ELISA Kit

abx555998-96tests 96 tests
EUR 668
  • Shipped within 1-3 weeks.

Rat Gamma-crystallin D (Crygd) ELISA Kit

abx556196-96tests 96 tests
EUR 668
  • Shipped within 1-3 weeks.

Human CRYGD/ Gamma-crystallin D ELISA Kit

E0566Hu 1 Kit
EUR 605

ELISA kit for Human Gamma-crystallin D

EK2890 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Gamma-crystallin D in samples from serum, plasma, tissue homogenates and other biological fluids.

Human Gamma- crystallin A, CRYGA ELISA KIT

ELI-10457h 96 Tests
EUR 824

Bovine Gamma- crystallin C, CRYGC ELISA KIT

ELI-25518b 96 Tests
EUR 928

Bovine Gamma- crystallin B, CRYGB ELISA KIT

ELI-25693b 96 Tests
EUR 928

Bovine Gamma- crystallin F, CRYGF ELISA KIT

ELI-09008b 96 Tests
EUR 928

Bovine Gamma- crystallin A, CRYGA ELISA KIT

ELI-09329b 96 Tests
EUR 928

Human Gamma- crystallin B, CRYGB ELISA KIT

ELI-33747h 96 Tests
EUR 824

Human Gamma- crystallin D, CRYGD ELISA KIT

ELI-46665h 96 Tests
EUR 824

Bovine Gamma- crystallin D, CRYGD ELISA KIT

ELI-47522b 96 Tests
EUR 928

Human Gamma- crystallin C, CRYGC ELISA KIT

ELI-31980h 96 Tests
EUR 824

Human Gamma- crystallin N, CRYGN ELISA KIT

ELI-50461h 96 Tests
EUR 824

Cow Crystallin Gamma D (CRYGD) ELISA Kit

20-abx380207
  • EUR 7911.00
  • EUR 4215.00
  • EUR 973.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human Crystallin Gamma D (CRYGD) ELISA Kit

20-abx384740
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human Crystallin Gamma C (CRYGC) ELISA Kit

abx386689-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Crystallin Gamma N (CRYGN) ELISA Kit

abx386690-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Crystallin Gamma D (CRYGD) ELISA Kit

20-abx391156
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Crystallin, gamma C Protein

20-abx260888
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Crystallin, gamma N Protein

20-abx260916
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Crystallin, gamma D Protein

20-abx261483
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Crystallin Gamma C antibody

70R-2030 50 ug
EUR 467
Description: Rabbit polyclonal Crystallin Gamma C antibody raised against the middle region of CRYGC

Mouse Crystallin Gamma F (CRYgF) Protein

20-abx168437
  • EUR 718.00
  • EUR 286.00
  • EUR 2207.00
  • EUR 843.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Crygd ELISA Kit| Rat Gamma-crystallin D ELISA Kit

EF018510 96 Tests
EUR 689

CRYGD ELISA Kit| Bovine Gamma-crystallin D ELISA Kit

EF011258 96 Tests
EUR 689

Canine CRYGS ELISA KIT

ELI-25690d 96 Tests
EUR 928

CRYGS ELISA KIT|Human

EF004793 96 Tests
EUR 689

Anti-Beta crystallin S Antibody

STJ500306 100 µg
EUR 476

Anti-Beta crystallin S Antibody

STJ500307 100 µg
EUR 476

CRYGD Crystallin, Gamma D Mouse Recombinant Protein

PROTP04342 Regular: 20ug
EUR 317
Description: CRYGD Mouse Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 197 amino acids (1-174 a.a.) and having a molecular mass of 23.5kDa.;CRYGD is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Crystallin Gamma F (CRYgF) Polyclonal Antibody (Mouse)

4-PAC989Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRYgF (Met1~Phe173)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Crystallin Gamma F (CRYgF)

Crystallin Gamma C (CRYGC) Antibody

20-abx123514
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Crystallin Gamma C (CRYGC) Antibody

20-abx111825
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Crystallin Gamma F (CRYgF) Antibody

20-abx129483
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Gamma-Crystallin D (CRYGD) Antibody

abx145056-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Crystallin Gamma N (CRYGN) Antibody

abx145327-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Gamma-Crystallin D (CRYGD) Antibody

20-abx004390
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Gamma-Crystallin D (CRYGD) Antibody

abx030580-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Gamma-Crystallin D (CRYGD) Antibody

abx030580-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Gamma-Crystallin D (CRYGD) Antibody

20-abx321764
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Crystallin Gamma N (CRYGN) Antibody

20-abx309489
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Crystallin Gamma C (CRYGC) Antibody

abx232005-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Crystallin Gamma N (CRYGN) Antibody

abx232006-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Crystallin Gamma C Blocking Peptide

33R-3422 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CRYGC antibody, catalog no. 70R-2030

Human gamma C Crystallin Antibody

33355-05111 150 ug
EUR 261

Rat Gamma-crystallin B (Crygb)

1-CSB-YP006018RA
  • EUR 504.00
  • EUR 265.00
  • EUR 1832.00
  • EUR 763.00
  • EUR 1216.00
  • EUR 334.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 23 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Gamma-crystallin B(Crygb) expressed in Yeast

Human Gamma-crystallin B (CRYGB)

1-CSB-EP006018HU
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 24.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Gamma-crystallin B(CRYGB) expressed in E.coli

Human Gamma-crystallin D (CRYGD)

1-CSB-EP006020HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 47.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Gamma-crystallin D(CRYGD) expressed in E.coli

Recombinant human Gamma-crystallin B

P1661 100ug Ask for price
  • Uniprot ID: P07316
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Gamma-crystallin B

Recombinant Crystallin Gamma F (CRYgF)

4-RPC989Mu01
  • EUR 510.37
  • EUR 239.00
  • EUR 1638.88
  • EUR 612.96
  • EUR 1125.92
  • EUR 404.00
  • EUR 3947.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9CXV3
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 24.8KDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Crystallin Gamma F expressed in: E.coli

Anti-gamma C Crystallin (7C4)

YF-MA12545 50 ug
EUR 363
Description: Mouse monoclonal to gamma C Crystallin

Anti-gamma C Crystallin (7C4)

YF-MA12546 200 ul
EUR 363
Description: Mouse monoclonal to gamma C Crystallin

Anti-gamma C Crystallin (7C4)

YF-MA12547 200 ul
EUR 363
Description: Mouse monoclonal to gamma C Crystallin

Anti-gamma C Crystallin (7C4)

YF-MA12548 50 ug
EUR 363
Description: Mouse monoclonal to gamma C Crystallin

(S)-Crizotinib

A8802-S Evaluation Sample
EUR 81
Description: (S)-crizotinibthe selectively inhibited MTH1 catalytic activity with IC50 of 72 nM, while clinically used (R)-enantiomer of the drug was inactive with IC50 of 1375 nM.

Mouse β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit

E03B0894-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit

E03B0894-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit

E03B0894-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Anti-Beta crystallin S Antibody BIOTIN

STJ500308 100 µg
EUR 586

Anti-Beta crystallin S Antibody FITC

STJ500309 100 µg
EUR 586

Anti-Beta crystallin S Antibody BIOTIN

STJ500310 100 µg
EUR 586

Anti-Beta crystallin S Antibody FITC

STJ500311 100 µg
EUR 586

Crystallin Gamma F (CRYgF) Polyclonal Antibody (Mouse), APC

4-PAC989Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRYgF (Met1~Phe173)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Crystallin Gamma F (CRYgF). This antibody is labeled with APC.

Crystallin Gamma F (CRYgF) Polyclonal Antibody (Mouse), Biotinylated

4-PAC989Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRYgF (Met1~Phe173)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Crystallin Gamma F (CRYgF). This antibody is labeled with Biotin.

Crystallin Gamma F (CRYgF) Polyclonal Antibody (Mouse), Cy3

4-PAC989Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRYgF (Met1~Phe173)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Crystallin Gamma F (CRYgF). This antibody is labeled with Cy3.

Crystallin Gamma F (CRYgF) Polyclonal Antibody (Mouse), FITC

4-PAC989Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRYgF (Met1~Phe173)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Crystallin Gamma F (CRYgF). This antibody is labeled with FITC.

Crystallin Gamma F (CRYgF) Polyclonal Antibody (Mouse), HRP

4-PAC989Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRYgF (Met1~Phe173)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Crystallin Gamma F (CRYgF). This antibody is labeled with HRP.

Crystallin Gamma F (CRYgF) Polyclonal Antibody (Mouse), PE

4-PAC989Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRYgF (Met1~Phe173)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Crystallin Gamma F (CRYgF). This antibody is labeled with PE.

Mouse CRYGS shRNA Plasmid

20-abx969838
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CRYGS Recombinant Protein (Mouse)

RP126197 100 ug Ask for price

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Crystallin Gamma N (CRYGN) Antibody (HRP)

20-abx309490
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Crystallin Gamma N (CRYGN) Antibody (FITC)

20-abx309491
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Crystallin Gamma N (CRYGN) Antibody (Biotin)

20-abx309492
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

CRYGS siRNA

20-abx901283
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CRYGS siRNA

20-abx912893
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CRYGS siRNA

20-abx912894
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CRYGS Antibody

46546-100ul 100ul
EUR 252

CRYGS Antibody

1-CSB-PA006025ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CRYGS. Recognizes CRYGS from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

Rabbit Anti-Mouse Synuclein-gamma antiserum # 1

SYN14-S 100 ul
EUR 457

Mouse Alpha B Crystallin ELISA kit

E03C0343-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Alpha B Crystallin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Alpha B Crystallin ELISA kit

E03C0343-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Alpha B Crystallin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Alpha B Crystallin ELISA kit

E03C0343-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Alpha B Crystallin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Crystallin Gamma F (CRYgF) Polyclonal Antibody (Mouse), APC-Cy7

4-PAC989Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRYgF (Met1~Phe173)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Crystallin Gamma F (CRYgF). This antibody is labeled with APC-Cy7.

Rabbit Anti-Mouse Neprilysin-beta (NEPL-gamma) antiserum

NEPLG31-S 100 ul
EUR 457

Mouse Cystatin S(Cys-S)ELISA Kit

QY-E20430 96T
EUR 361

Goat β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit

E06B0894-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit

E06B0894-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit

E06B0894-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit

E02B0894-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit

E02B0894-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit

E02B0894-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit

E01B0894-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit

E01B0894-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit

E01B0894-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit

E04B0894-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit

E04B0894-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit

E04B0894-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit

E07B0894-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit

E07B0894-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit

E07B0894-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit

E09B0894-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit

E09B0894-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit

E09B0894-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit

E08B0894-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit

E08B0894-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit

E08B0894-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Crygs ORF Vector (Mouse) (pORF)

ORF042067 1.0 ug DNA
EUR 506

Human gamma C Crystallin Antibody (Biotin Conjugate)

33355-05121 150 ug
EUR 369

CRYGC Crystallin, Gamma C Human Recombinant Protein

PROTP07315 Regular: 20ug
EUR 317
Description: CRYGC Human Recombinant produced in E. coli is a single polypeptide chain containing 198 amino acids (1-174) and having a molecular mass of 23.5kDa.;CRYGC is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

CRYGD Crystallin, Gamma D Human Recombinant Protein

PROTP07320 Regular: 20ug
EUR 317
Description: CRYGD Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 194 amino acids (1-174 a.a.) and having a molecular mass of 22.9kDa.;CRYGD is fused to a 20 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

CRYGN Crystallin, Gamma N Human Recombinant Protein

PROTQ8WXF5 Regular: 20ug
EUR 317
Description: CRYGN Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 206 amino acids (1-182 a.a) and having a molecular mass of 23.1kDa.;CRYGN is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

(S)-3-Hydroxy-Gamma-Butyrolactone

abx188035-1000g 1000 g
EUR 871
  • Shipped within 1-2 weeks.

CRYGS Conjugated Antibody

C46546 100ul
EUR 397

CRYGS cloning plasmid

CSB-CL006025HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 537
  • Sequence: atgtctaaaactggaaccaagattactttctatgaagacaaaaattttcaaggccgtcgctatgactgtgattgcgactgtgcagatttccacacatacctaagtcgctgcaactccattaaagtggaaggaggcacctgggctgtttatgaaaggcccaactttgctgggtacat
  • Show more
Description: A cloning plasmid for the CRYGS gene.

CRYGS Rabbit pAb

A7888-100ul 100 ul
EUR 308

CRYGS Rabbit pAb

A7888-200ul 200 ul
EUR 459

CRYGS Rabbit pAb

A7888-20ul 20 ul
EUR 183

CRYGS Rabbit pAb

A7888-50ul 50 ul
EUR 223

Human CRYGS Antibody

32845-05111 150 ug
EUR 261

Anti-CRYGS antibody

STJ110198 100 µl
EUR 277
Description: Crystallins are separated into two classes: taxon-specific, or enzyme, and ubiquitous. The latter class constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. Since lens central fiber cells lose their nuclei during development, these crystallins are made and then retained throughout life, making them extremely stable proteins. Mammalian lens crystallins are divided into alpha, beta, and gamma families; beta and gamma crystallins are also considered as a superfamily. Alpha and beta families are further divided into acidic and basic groups. Seven protein regions exist in crystallins: four homologous motifs, a connecting peptide, and N- and C-terminal extensions. Gamma-crystallins are a homogeneous group of highly symmetrical, monomeric proteins typically lacking connecting peptides and terminal extensions. They are differentially regulated after early development. This gene encodes a protein initially considered to be a beta-crystallin but the encoded protein is monomeric and has greater sequence similarity to other gamma-crystallins. This gene encodes the most significant gamma-crystallin in adult eye lens tissue. Whether due to aging or mutations in specific genes, gamma-crystallins have been involved in cataract formation.

Mouse Lambda crystallin homolog(CRYL1) ELISA kit

E03L0316-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Lambda crystallin homolog(CRYL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Lambda crystallin homolog(CRYL1) ELISA kit

E03L0316-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Lambda crystallin homolog(CRYL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Lambda crystallin homolog(CRYL1) ELISA kit

E03L0316-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Lambda crystallin homolog(CRYL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β crystallin A2(CRYBA2) ELISA kit

E03B0889-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin A2(CRYBA2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β crystallin A2(CRYBA2) ELISA kit

E03B0889-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin A2(CRYBA2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β crystallin A2(CRYBA2) ELISA kit

E03B0889-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin A2(CRYBA2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β crystallin A4(CRYBA4) ELISA kit

E03B0890-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin A4(CRYBA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β crystallin A4(CRYBA4) ELISA kit

E03B0890-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin A4(CRYBA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β crystallin A4(CRYBA4) ELISA kit

E03B0890-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin A4(CRYBA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β crystallin B1(CRYBB1) ELISA kit

E03B0891-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin B1(CRYBB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β crystallin B1(CRYBB1) ELISA kit

E03B0891-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin B1(CRYBB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β crystallin B1(CRYBB1) ELISA kit

E03B0891-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin B1(CRYBB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β crystallin B2(CRYBB2) ELISA kit

E03B0892-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin B2(CRYBB2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β crystallin B2(CRYBB2) ELISA kit

E03B0892-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin B2(CRYBB2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β crystallin B2(CRYBB2) ELISA kit

E03B0892-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin B2(CRYBB2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β crystallin B3(CRYBB3) ELISA kit

E03B0893-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin B3(CRYBB3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β crystallin B3(CRYBB3) ELISA kit

E03B0893-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin B3(CRYBB3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β crystallin B3(CRYBB3) ELISA kit

E03B0893-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin B3(CRYBB3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse crystallin, β A1 (CRYBA1) ELISA kit

E03C2086-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse crystallin, β A1 (CRYBA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse crystallin, β A1 (CRYBA1) ELISA kit

E03C2086-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse crystallin, β A1 (CRYBA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse crystallin, β A1 (CRYBA1) ELISA kit

E03C2086-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse crystallin, β A1 (CRYBA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Beta- crystallin A1, Cryba1 ELISA KIT

ELI-10489m 96 Tests
EUR 865

Mouse Beta- crystallin A4, Cryba4 ELISA KIT

ELI-10490m 96 Tests
EUR 865

Mouse Beta- crystallin B2, Crybb2 ELISA KIT

ELI-26113m 96 Tests
EUR 865

Mouse Beta- crystallin B3, Crybb3 ELISA KIT

ELI-26438m 96 Tests
EUR 865

Mouse Lambda- crystallin homolog, Cryl1 ELISA KIT

ELI-26469m 96 Tests
EUR 865

Mouse Beta- crystallin B1, Crybb1 ELISA KIT

ELI-33761m 96 Tests
EUR 865

Mouse Beta- crystallin A2, Cryba2 ELISA KIT

ELI-31972m 96 Tests
EUR 865

Mouse Crystallin Beta A1 (CRYBA1) ELISA Kit

20-abx156974
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Crystallin Beta B1 (CRYBB1) ELISA Kit

20-abx156975
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Crystallin Beta B2 (CRYBB2) ELISA Kit

20-abx156976
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Crystallin alpha B (CRYaB) ELISA Kit

20-abx153876
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Crystallin Alpha B (CRYaB) ELISA Kit

DLR-CRYaB-Mu-48T 48T
EUR 527
  • Should the Mouse Crystallin Alpha B (CRYaB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Crystallin Alpha B (CRYaB) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Crystallin Alpha B (CRYaB) ELISA Kit

DLR-CRYaB-Mu-96T 96T
EUR 688
  • Should the Mouse Crystallin Alpha B (CRYaB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Crystallin Alpha B (CRYaB) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Crystallin Alpha B (CRYaB) ELISA Kit

SEC944Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Alpha B (CRYaB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Alpha B (CRYaB) in tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Alpha B (CRYaB) ELISA Kit

SEC944Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Alpha B (CRYaB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Alpha B (CRYaB) in tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Alpha B (CRYaB) ELISA Kit

SEC944Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Alpha B (CRYaB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Alpha B (CRYaB) in tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Alpha B (CRYaB) ELISA Kit

SEC944Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Alpha B (CRYaB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Alpha B (CRYaB) in tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Alpha B (CRYaB) ELISA Kit

4-SEC944Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Crystallin Alpha B elisa. Alternative names of the recognized antigen: CRY-AB
  • CRYA-B
  • CRYA2
  • CTPP2
  • HSPB5
  • Heat shock protein beta-5
  • Renal carcinoma antigen NY-REN-27
  • Rosenthal fiber component
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Crystallin Alpha B (CRYaB) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Crystallin Beta B2 ELISA Kit (CRYbB2)

RK02713 96 Tests
EUR 521

Mouse Crystallin Alpha B (CRYaB) ELISA Kit

RDR-CRYaB-Mu-48Tests 48 Tests
EUR 557

Mouse Crystallin Alpha B (CRYaB) ELISA Kit

RDR-CRYaB-Mu-96Tests 96 Tests
EUR 774

Mouse Crystallin Alpha B (CRYaB) ELISA Kit

RD-CRYaB-Mu-48Tests 48 Tests
EUR 533

Mouse Crystallin Alpha B (CRYaB) ELISA Kit

RD-CRYaB-Mu-96Tests 96 Tests
EUR 740

Mouse Crystallin Beta A1 (CRYbA1) ELISA Kit

SEF342Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta A1 (CRYbA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta A1 (CRYbA1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Beta A1 (CRYbA1) ELISA Kit

SEF342Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta A1 (CRYbA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta A1 (CRYbA1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Beta A1 (CRYbA1) ELISA Kit

SEF342Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta A1 (CRYbA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta A1 (CRYbA1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Beta A1 (CRYbA1) ELISA Kit

SEF342Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta A1 (CRYbA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta A1 (CRYbA1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Beta A1 (CRYbA1) ELISA Kit

4-SEF342Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Crystallin Beta A1 elisa. Alternative names of the recognized antigen: CRYB1
  • Eye Lens Structural Protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Crystallin Beta A1 (CRYbA1) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Crystallin Beta B1 (CRYbB1) ELISA Kit

SEF345Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta B1 (CRYbB1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta B1 (CRYbB1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Beta B1 (CRYbB1) ELISA Kit

SEF345Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta B1 (CRYbB1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta B1 (CRYbB1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Beta B1 (CRYbB1) ELISA Kit

SEF345Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta B1 (CRYbB1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta B1 (CRYbB1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Beta B1 (CRYbB1) ELISA Kit

SEF345Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta B1 (CRYbB1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta B1 (CRYbB1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Beta B1 (CRYbB1) ELISA Kit

4-SEF345Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Crystallin Beta B1 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Crystallin Beta B1 (CRYbB1) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Crystallin Beta B2 (CRYbB2) ELISA Kit

SEF346Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta B2 (CRYbB2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta B2 (CRYbB2) in tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Beta B2 (CRYbB2) ELISA Kit

SEF346Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta B2 (CRYbB2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta B2 (CRYbB2) in tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Beta B2 (CRYbB2) ELISA Kit

SEF346Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta B2 (CRYbB2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta B2 (CRYbB2) in tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Beta B2 (CRYbB2) ELISA Kit

SEF346Mu-5x96wellstestplate 5x96-wells test plate