Mouse CRYgS(Crystallin Gamma S) ELISA Kit

Mouse CRYgS(Crystallin Gamma S) ELISA Kit

To Order Contact us:  Mark@operatiebrp.nl

Mouse Crystallin Gamma S (CRYgS) ELISA Kit
4-SEF353Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Crystallin Gamma S elisa. Alternative names of the recognized antigen: CRYG8
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Crystallin Gamma S (CRYgS) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Crystallin Gamma S (CRYgS) Antibody
20-abx129441	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Crystallin Gamma S (CRYGS) Antibody
abx145026-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Crystallin Gamma S (CRYGS) Antibody
20-abx006571	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Crystallin Gamma S (CRYGS) Antibody
20-abx322535	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Recombinant Crystallin Gamma S (CRYgS)
4-RPF353Mu01	Cloud-Clone	EUR 494.24 EUR 235.00 EUR 1578.40 EUR 592.80 EUR 1085.60 EUR 394.00 EUR 3796.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O35486 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 24.4kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Crystallin Gamma S expressed in: E.coli

Mouse Crystallin Gamma S (CRYgS) Protein
20-abx168389	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Crystallin Gamma S (CRYgS) CLIA Kit
20-abx494875	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Crystallin Gamma S (CRYGS) ELISA Kit
abx384739-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rat Crystallin Gamma S (CRYGS) ELISA Kit
abx391155-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

ELISA kit for Mouse CRYgS (Crystallin Gamma S)
ELK7344	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Crystallin Gamma S (CRY?S). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Crystal Show more
Description: A sandwich ELISA kit for detection of Crystallin Gamma S from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Crystallin Gamma S (CRYgS) Polyclonal Antibody (Mouse, Rat)
4-PAF353Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CRYgS (Ser2~Glu178) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Crystallin Gamma S (CRYgS)

CRYGS Crystallin, Gamma S Human Recombinant Protein
PROTP22914	BosterBio	Regular: 20ug	EUR 317
Description: CRYGS Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 202 amino acids (1-178) and having a molecular mass of 23.6 kDa.;The CRYGS is fused to a 24 amino acid His-Tag at N-terminus and purified by proprietary chromatographic techniques.

Mouse β crystallin S(CRYGS) ELISA kit
E03B0895-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β crystallin S(CRYGS) ELISA kit
E03B0895-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β crystallin S(CRYGS) ELISA kit
E03B0895-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Beta- crystallin S, Crygs ELISA KIT
ELI-09076m	Lifescience Market	96 Tests	EUR 865

Crystallin Gamma S (CRYgS) Polyclonal Antibody (Mouse, Rat), APC
4-PAF353Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CRYgS (Ser2~Glu178) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Crystallin Gamma S (CRYgS). This antibody is labeled with APC.

Crystallin Gamma S (CRYgS) Polyclonal Antibody (Mouse, Rat), Biotinylated
4-PAF353Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CRYgS (Ser2~Glu178) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Crystallin Gamma S (CRYgS). This antibody is labeled with Biotin.

Crystallin Gamma S (CRYgS) Polyclonal Antibody (Mouse, Rat), Cy3
4-PAF353Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CRYgS (Ser2~Glu178) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Crystallin Gamma S (CRYgS). This antibody is labeled with Cy3.

Crystallin Gamma S (CRYgS) Polyclonal Antibody (Mouse, Rat), FITC
4-PAF353Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CRYgS (Ser2~Glu178) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Crystallin Gamma S (CRYgS). This antibody is labeled with FITC.

Crystallin Gamma S (CRYgS) Polyclonal Antibody (Mouse, Rat), HRP
4-PAF353Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CRYgS (Ser2~Glu178) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Crystallin Gamma S (CRYgS). This antibody is labeled with HRP.

Crystallin Gamma S (CRYgS) Polyclonal Antibody (Mouse, Rat), PE
4-PAF353Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CRYgS (Ser2~Glu178) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Crystallin Gamma S (CRYgS). This antibody is labeled with PE.

Crygs ELISA Kit| Mouse Beta-crystallin S ELISA Kit
EF014554	Lifescience Market	96 Tests	EUR 689

Goat β crystallin S(CRYGS) ELISA kit
E06B0895-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat β crystallin S(CRYGS) ELISA kit
E06B0895-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat β crystallin S(CRYGS) ELISA kit
E06B0895-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat β crystallin S(CRYGS) ELISA kit
E02B0895-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat β crystallin S(CRYGS) ELISA kit
E02B0895-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat β crystallin S(CRYGS) ELISA kit
E02B0895-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human β crystallin S(CRYGS) ELISA kit
E01B0895-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human β crystallin S(CRYGS) ELISA kit
E01B0895-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human β crystallin S(CRYGS) ELISA kit
E01B0895-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit β crystallin S(CRYGS) ELISA kit
E04B0895-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit β crystallin S(CRYGS) ELISA kit
E04B0895-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit β crystallin S(CRYGS) ELISA kit
E04B0895-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig β crystallin S(CRYGS) ELISA kit
E07B0895-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig β crystallin S(CRYGS) ELISA kit
E07B0895-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig β crystallin S(CRYGS) ELISA kit
E07B0895-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey β crystallin S(CRYGS) ELISA kit
E09B0895-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey β crystallin S(CRYGS) ELISA kit
E09B0895-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey β crystallin S(CRYGS) ELISA kit
E09B0895-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog β crystallin S(CRYGS) ELISA kit
E08B0895-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog β crystallin S(CRYGS) ELISA kit
E08B0895-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog β crystallin S(CRYGS) ELISA kit
E08B0895-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Beta- crystallin S, CRYGS ELISA KIT
ELI-26440h	Lifescience Market	96 Tests	EUR 824

Rabbit Beta- crystallin S, CRYGS ELISA KIT
ELI-09077Ra	Lifescience Market	96 Tests	EUR 928

Bovine Beta- crystallin S, CRYGS ELISA KIT
ELI-50472b	Lifescience Market	96 Tests	EUR 928

Human Beta-crystallin S (CRYGS
1-CSB-EP006025HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 47.9 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Beta-crystallin S(CRYGS expressed in E.coli

Crystallin Gamma S (CRYgS) Polyclonal Antibody (Mouse, Rat), APC-Cy7
4-PAF353Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CRYgS (Ser2~Glu178) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Crystallin Gamma S (CRYgS). This antibody is labeled with APC-Cy7.

Guinea pig β crystallin S(CRYGS) ELISA kit
E05B0895-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig β crystallin S(CRYGS) ELISA kit
E05B0895-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig β crystallin S(CRYGS) ELISA kit
E05B0895-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Crygs ELISA Kit| Rat Beta-crystallin S ELISA Kit
EF018509	Lifescience Market	96 Tests	EUR 689

CRYGS ELISA Kit| Bovine Beta-crystallin S ELISA Kit
EF011257	Lifescience Market	96 Tests	EUR 689

Gamma-S-crystallin Antibody
20-abx141438	Abbexa	EUR 370.00 EUR 606.00 EUR 300.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Crystallin, gamma S Protein
20-abx261512	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

Crygs/ Rat Crygs ELISA Kit
ELI-10496r	Lifescience Market	96 Tests	EUR 886

Mouse Gamma-crystallin D (Crygd) ELISA Kit
abx556044-96tests	Abbexa	96 tests	EUR 668
Shipped within 1-3 weeks.

Mouse Gamma- crystallin E, Cryge ELISA KIT
ELI-10114m	Lifescience Market	96 Tests	EUR 865

Mouse Gamma- crystallin A, Cryga ELISA KIT
ELI-25517m	Lifescience Market	96 Tests	EUR 865

Mouse Gamma- crystallin B, Crygb ELISA KIT
ELI-25694m	Lifescience Market	96 Tests	EUR 865

Mouse Gamma- crystallin D, Crygd ELISA KIT
ELI-26464m	Lifescience Market	96 Tests	EUR 865

Mouse Gamma- crystallin C, Crygc ELISA KIT
ELI-46664m	Lifescience Market	96 Tests	EUR 865

Mouse Gamma- crystallin F, Crygf ELISA KIT
ELI-31981m	Lifescience Market	96 Tests	EUR 865

Mouse Gamma- crystallin N, Crygn ELISA KIT
ELI-32335m	Lifescience Market	96 Tests	EUR 865

Mouse Crystallin Gamma F (CRYGF) ELISA Kit
20-abx156978	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Crystallin Gamma F (CRYgF) ELISA Kit
SEC989Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Gamma F (CRYgF) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Gamma F (CRYgF) in tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Gamma F (CRYgF) ELISA Kit
SEC989Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Gamma F (CRYgF) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Gamma F (CRYgF) in tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Gamma F (CRYgF) ELISA Kit
SEC989Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Gamma F (CRYgF) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Gamma F (CRYgF) in tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Gamma F (CRYgF) ELISA Kit
SEC989Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Gamma F (CRYgF) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Gamma F (CRYgF) in tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Gamma F (CRYgF) ELISA Kit
4-SEC989Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Crystallin Gamma F elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Crystallin Gamma F (CRYgF) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Mouse CRYgF (Crystallin Gamma F)
ELK7345	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Crystallin Gamma F (CRY?F). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Crystal Show more
Description: A sandwich ELISA kit for detection of Crystallin Gamma F from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse Crystallin Gamma F (CRYgF) CLIA Kit
20-abx494033	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

anti-Beta crystallin S
YF-PA11110	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to Beta crystallin S

anti-Beta crystallin S
YF-PA11111	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to Beta crystallin S

Cow Gamma-crystallin D (CRYGD) ELISA Kit
abx555742-96tests	Abbexa	96 tests	EUR 911
Shipped within 1-3 weeks.

Human Gamma-crystallin D (CRYGD) ELISA Kit
abx555998-96tests	Abbexa	96 tests	EUR 668
Shipped within 1-3 weeks.

Rat Gamma-crystallin D (Crygd) ELISA Kit
abx556196-96tests	Abbexa	96 tests	EUR 668
Shipped within 1-3 weeks.

Human CRYGD/ Gamma-crystallin D ELISA Kit
E0566Hu	Sunlong	1 Kit	EUR 605

ELISA kit for Human Gamma-crystallin D
EK2890	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Gamma-crystallin D in samples from serum, plasma, tissue homogenates and other biological fluids.

Human Gamma- crystallin A, CRYGA ELISA KIT
ELI-10457h	Lifescience Market	96 Tests	EUR 824

Bovine Gamma- crystallin C, CRYGC ELISA KIT
ELI-25518b	Lifescience Market	96 Tests	EUR 928

Bovine Gamma- crystallin B, CRYGB ELISA KIT
ELI-25693b	Lifescience Market	96 Tests	EUR 928

Bovine Gamma- crystallin F, CRYGF ELISA KIT
ELI-09008b	Lifescience Market	96 Tests	EUR 928

Bovine Gamma- crystallin A, CRYGA ELISA KIT
ELI-09329b	Lifescience Market	96 Tests	EUR 928

Human Gamma- crystallin B, CRYGB ELISA KIT
ELI-33747h	Lifescience Market	96 Tests	EUR 824

Human Gamma- crystallin D, CRYGD ELISA KIT
ELI-46665h	Lifescience Market	96 Tests	EUR 824

Bovine Gamma- crystallin D, CRYGD ELISA KIT
ELI-47522b	Lifescience Market	96 Tests	EUR 928

Human Gamma- crystallin C, CRYGC ELISA KIT
ELI-31980h	Lifescience Market	96 Tests	EUR 824

Human Gamma- crystallin N, CRYGN ELISA KIT
ELI-50461h	Lifescience Market	96 Tests	EUR 824

Cow Crystallin Gamma D (CRYGD) ELISA Kit
20-abx380207	Abbexa	EUR 7911.00 EUR 4215.00 EUR 973.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-12 working days.

Human Crystallin Gamma D (CRYGD) ELISA Kit
20-abx384740	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-12 working days.

Human Crystallin Gamma C (CRYGC) ELISA Kit
abx386689-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Crystallin Gamma N (CRYGN) ELISA Kit
abx386690-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rat Crystallin Gamma D (CRYGD) ELISA Kit
20-abx391156	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-12 working days.

Crystallin, gamma C Protein
20-abx260888	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

Crystallin, gamma N Protein
20-abx260916	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

Crystallin, gamma D Protein
20-abx261483	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

Crystallin Gamma C antibody
70R-2030	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal Crystallin Gamma C antibody raised against the middle region of CRYGC

Crygd ELISA Kit| Rat Gamma-crystallin D ELISA Kit
EF018510	Lifescience Market	96 Tests	EUR 689

CRYGD ELISA Kit| Bovine Gamma-crystallin D ELISA Kit
EF011258	Lifescience Market	96 Tests	EUR 689

Mouse Crystallin Gamma F (CRYgF) Protein
20-abx168437	Abbexa	EUR 718.00 EUR 286.00 EUR 2207.00 EUR 843.00 EUR 509.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Canine CRYGS ELISA KIT
ELI-25690d	Lifescience Market	96 Tests	EUR 928

CRYGS ELISA KIT|Human
EF004793	Lifescience Market	96 Tests	EUR 689

Anti-Beta crystallin S Antibody
STJ500306	St John's Laboratory	100 µg	EUR 476

Anti-Beta crystallin S Antibody
STJ500307	St John's Laboratory	100 µg	EUR 476

CRYGD Crystallin, Gamma D Mouse Recombinant Protein
PROTP04342	BosterBio	Regular: 20ug	EUR 317
Description: CRYGD Mouse Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 197 amino acids (1-174 a.a.) and having a molecular mass of 23.5kDa.;CRYGD is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Crystallin Gamma F (CRYgF) Polyclonal Antibody (Mouse)
4-PAC989Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CRYgF (Met1~Phe173) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Crystallin Gamma F (CRYgF)

Crystallin Gamma C (CRYGC) Antibody
20-abx123514	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Crystallin Gamma C (CRYGC) Antibody
20-abx111825	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Crystallin Gamma F (CRYgF) Antibody
20-abx129483	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Gamma-Crystallin D (CRYGD) Antibody
abx145056-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Crystallin Gamma N (CRYGN) Antibody
abx145327-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Gamma-Crystallin D (CRYGD) Antibody
20-abx004390	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Gamma-Crystallin D (CRYGD) Antibody
abx030580-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Gamma-Crystallin D (CRYGD) Antibody
abx030580-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Gamma-Crystallin D (CRYGD) Antibody
20-abx321764	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Crystallin Gamma N (CRYGN) Antibody
20-abx309489	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Crystallin Gamma C (CRYGC) Antibody
abx232005-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Crystallin Gamma N (CRYGN) Antibody
abx232006-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Crystallin Gamma C Blocking Peptide
33R-3422	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CRYGC antibody, catalog no. 70R-2030

Human gamma C Crystallin Antibody
33355-05111	AssayPro	150 ug	EUR 261

Rat Gamma-crystallin B (Crygb)
1-CSB-YP006018RA	Cusabio	EUR 504.00 EUR 265.00 EUR 1832.00 EUR 763.00 EUR 1216.00 EUR 334.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 23 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Gamma-crystallin B(Crygb) expressed in Yeast

Human Gamma-crystallin B (CRYGB)
1-CSB-EP006018HU	Cusabio	EUR 505.00 EUR 265.00 EUR 1827.00 EUR 766.00 EUR 1218.00 EUR 335.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 24.9 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Gamma-crystallin B(CRYGB) expressed in E.coli

Human Gamma-crystallin D (CRYGD)
1-CSB-EP006020HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 47.6 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Gamma-crystallin D(CRYGD) expressed in E.coli

Recombinant human Gamma-crystallin B
P1661	FN Test	100ug	Ask for price
Uniprot ID: P07316 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Gamma-crystallin B

Recombinant Crystallin Gamma F (CRYgF)
4-RPC989Mu01	Cloud-Clone	EUR 510.37 EUR 239.00 EUR 1638.88 EUR 612.96 EUR 1125.92 EUR 404.00 EUR 3947.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9CXV3 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 24.8KDa Isoelectric Point: Inquire
Description: Recombinant Mouse Crystallin Gamma F expressed in: E.coli

Anti-gamma C Crystallin (7C4)
YF-MA12545	Abfrontier	50 ug	EUR 363
Description: Mouse monoclonal to gamma C Crystallin

Anti-gamma C Crystallin (7C4)
YF-MA12546	Abfrontier	200 ul	EUR 363
Description: Mouse monoclonal to gamma C Crystallin

Anti-gamma C Crystallin (7C4)
YF-MA12547	Abfrontier	200 ul	EUR 363
Description: Mouse monoclonal to gamma C Crystallin

Anti-gamma C Crystallin (7C4)
YF-MA12548	Abfrontier	50 ug	EUR 363
Description: Mouse monoclonal to gamma C Crystallin

(S)-Crizotinib
A8802-S	ApexBio	Evaluation Sample	EUR 81
Description: (S)-crizotinibthe selectively inhibited MTH1 catalytic activity with IC50 of 72 nM, while clinically used (R)-enantiomer of the drug was inactive with IC50 of 1375 nM.

Mouse β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit
E03B0894-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit
E03B0894-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit
E03B0894-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Anti-Beta crystallin S Antibody BIOTIN
STJ500308	St John's Laboratory	100 µg	EUR 586

Anti-Beta crystallin S Antibody FITC
STJ500309	St John's Laboratory	100 µg	EUR 586

Anti-Beta crystallin S Antibody BIOTIN
STJ500310	St John's Laboratory	100 µg	EUR 586

Anti-Beta crystallin S Antibody FITC
STJ500311	St John's Laboratory	100 µg	EUR 586

Crystallin Gamma F (CRYgF) Polyclonal Antibody (Mouse), APC
4-PAC989Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CRYgF (Met1~Phe173) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Crystallin Gamma F (CRYgF). This antibody is labeled with APC.

Crystallin Gamma F (CRYgF) Polyclonal Antibody (Mouse), Biotinylated
4-PAC989Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CRYgF (Met1~Phe173) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Crystallin Gamma F (CRYgF). This antibody is labeled with Biotin.

Crystallin Gamma F (CRYgF) Polyclonal Antibody (Mouse), Cy3
4-PAC989Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CRYgF (Met1~Phe173) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Crystallin Gamma F (CRYgF). This antibody is labeled with Cy3.

Crystallin Gamma F (CRYgF) Polyclonal Antibody (Mouse), FITC
4-PAC989Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CRYgF (Met1~Phe173) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Crystallin Gamma F (CRYgF). This antibody is labeled with FITC.

Crystallin Gamma F (CRYgF) Polyclonal Antibody (Mouse), HRP
4-PAC989Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CRYgF (Met1~Phe173) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Crystallin Gamma F (CRYgF). This antibody is labeled with HRP.

Crystallin Gamma F (CRYgF) Polyclonal Antibody (Mouse), PE
4-PAC989Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CRYgF (Met1~Phe173) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Crystallin Gamma F (CRYgF). This antibody is labeled with PE.

Mouse CRYGS shRNA Plasmid
20-abx969838	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

CRYGS Recombinant Protein (Mouse)
RP126197	ABM	100 ug	Ask for price

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Crystallin Gamma N (CRYGN) Antibody (HRP)
20-abx309490	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Crystallin Gamma N (CRYGN) Antibody (FITC)
20-abx309491	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Crystallin Gamma N (CRYGN) Antibody (Biotin)
20-abx309492	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

CRYGS siRNA
20-abx901283	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CRYGS siRNA
20-abx912893	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CRYGS siRNA
20-abx912894	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CRYGS Antibody
46546-100ul	SAB	100ul	EUR 252

CRYGS Antibody
1-CSB-PA006025ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CRYGS. Recognizes CRYGS from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

Rabbit Anti-Mouse Synuclein-gamma antiserum # 1
SYN14-S	Alpha Diagnostics	100 ul	EUR 457

Mouse Alpha B Crystallin ELISA kit
E03C0343-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Alpha B Crystallin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Alpha B Crystallin ELISA kit
E03C0343-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Alpha B Crystallin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Alpha B Crystallin ELISA kit
E03C0343-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Alpha B Crystallin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Crystallin Gamma F (CRYgF) Polyclonal Antibody (Mouse), APC-Cy7
4-PAC989Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CRYgF (Met1~Phe173) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Crystallin Gamma F (CRYgF). This antibody is labeled with APC-Cy7.

Rabbit Anti-Mouse Neprilysin-beta (NEPL-gamma) antiserum
NEPLG31-S	Alpha Diagnostics	100 ul	EUR 457

Mouse Cystatin S(Cys-S)ELISA Kit
QY-E20430	Qayee Biotechnology	96T	EUR 361

Goat β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit
E06B0894-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit
E06B0894-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit
E06B0894-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit
E02B0894-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit
E02B0894-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit
E02B0894-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit
E01B0894-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit
E01B0894-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit
E01B0894-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit
E04B0894-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit
E04B0894-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit
E04B0894-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit
E07B0894-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit
E07B0894-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit
E07B0894-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit
E09B0894-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit
E09B0894-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit
E09B0894-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit
E08B0894-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit
E08B0894-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit
E08B0894-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Crygs ORF Vector (Mouse) (pORF)
ORF042067	ABM	1.0 ug DNA	EUR 506

Human gamma C Crystallin Antibody (Biotin Conjugate)
33355-05121	AssayPro	150 ug	EUR 369

CRYGC Crystallin, Gamma C Human Recombinant Protein
PROTP07315	BosterBio	Regular: 20ug	EUR 317
Description: CRYGC Human Recombinant produced in E. coli is a single polypeptide chain containing 198 amino acids (1-174) and having a molecular mass of 23.5kDa.;CRYGC is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

CRYGD Crystallin, Gamma D Human Recombinant Protein
PROTP07320	BosterBio	Regular: 20ug	EUR 317
Description: CRYGD Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 194 amino acids (1-174 a.a.) and having a molecular mass of 22.9kDa.;CRYGD is fused to a 20 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

CRYGN Crystallin, Gamma N Human Recombinant Protein
PROTQ8WXF5	BosterBio	Regular: 20ug	EUR 317
Description: CRYGN Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 206 amino acids (1-182 a.a) and having a molecular mass of 23.1kDa.;CRYGN is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

(S)-3-Hydroxy-Gamma-Butyrolactone
abx188035-1000g	Abbexa	1000 g	EUR 871
Shipped within 1-2 weeks.

Mouse Lambda crystallin homolog(CRYL1) ELISA kit
E03L0316-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Lambda crystallin homolog(CRYL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Lambda crystallin homolog(CRYL1) ELISA kit
E03L0316-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Lambda crystallin homolog(CRYL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Lambda crystallin homolog(CRYL1) ELISA kit
E03L0316-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Lambda crystallin homolog(CRYL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β crystallin A2(CRYBA2) ELISA kit
E03B0889-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin A2(CRYBA2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β crystallin A2(CRYBA2) ELISA kit
E03B0889-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin A2(CRYBA2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β crystallin A2(CRYBA2) ELISA kit
E03B0889-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin A2(CRYBA2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β crystallin A4(CRYBA4) ELISA kit
E03B0890-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin A4(CRYBA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β crystallin A4(CRYBA4) ELISA kit
E03B0890-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin A4(CRYBA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β crystallin A4(CRYBA4) ELISA kit
E03B0890-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin A4(CRYBA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β crystallin B1(CRYBB1) ELISA kit
E03B0891-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin B1(CRYBB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β crystallin B1(CRYBB1) ELISA kit
E03B0891-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin B1(CRYBB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β crystallin B1(CRYBB1) ELISA kit
E03B0891-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin B1(CRYBB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β crystallin B2(CRYBB2) ELISA kit
E03B0892-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin B2(CRYBB2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β crystallin B2(CRYBB2) ELISA kit
E03B0892-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin B2(CRYBB2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β crystallin B2(CRYBB2) ELISA kit
E03B0892-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin B2(CRYBB2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β crystallin B3(CRYBB3) ELISA kit
E03B0893-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin B3(CRYBB3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β crystallin B3(CRYBB3) ELISA kit
E03B0893-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin B3(CRYBB3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β crystallin B3(CRYBB3) ELISA kit
E03B0893-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin B3(CRYBB3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse crystallin, β A1 (CRYBA1) ELISA kit
E03C2086-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse crystallin, β A1 (CRYBA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse crystallin, β A1 (CRYBA1) ELISA kit
E03C2086-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse crystallin, β A1 (CRYBA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse crystallin, β A1 (CRYBA1) ELISA kit
E03C2086-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse crystallin, β A1 (CRYBA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Beta- crystallin A1, Cryba1 ELISA KIT
ELI-10489m	Lifescience Market	96 Tests	EUR 865

Mouse Beta- crystallin A4, Cryba4 ELISA KIT
ELI-10490m	Lifescience Market	96 Tests	EUR 865

Mouse Beta- crystallin B2, Crybb2 ELISA KIT
ELI-26113m	Lifescience Market	96 Tests	EUR 865

Mouse Beta- crystallin B3, Crybb3 ELISA KIT
ELI-26438m	Lifescience Market	96 Tests	EUR 865

Mouse Lambda- crystallin homolog, Cryl1 ELISA KIT
ELI-26469m	Lifescience Market	96 Tests	EUR 865

Mouse Beta- crystallin B1, Crybb1 ELISA KIT
ELI-33761m	Lifescience Market	96 Tests	EUR 865

Mouse Beta- crystallin A2, Cryba2 ELISA KIT
ELI-31972m	Lifescience Market	96 Tests	EUR 865

Mouse Crystallin Beta A1 (CRYBA1) ELISA Kit
20-abx156974	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Crystallin Beta B1 (CRYBB1) ELISA Kit
20-abx156975	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Crystallin Beta B2 (CRYBB2) ELISA Kit
20-abx156976	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Crystallin alpha B (CRYaB) ELISA Kit
20-abx153876	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Crystallin Alpha B (CRYaB) ELISA Kit
DLR-CRYaB-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Crystallin Alpha B (CRYaB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Crystallin Alpha B (CRYaB) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Crystallin Alpha B (CRYaB) ELISA Kit
DLR-CRYaB-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Crystallin Alpha B (CRYaB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Crystallin Alpha B (CRYaB) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Crystallin Alpha B (CRYaB) ELISA Kit
SEC944Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Alpha B (CRYaB) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Alpha B (CRYaB) in tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Alpha B (CRYaB) ELISA Kit
SEC944Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Alpha B (CRYaB) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Alpha B (CRYaB) in tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Alpha B (CRYaB) ELISA Kit
SEC944Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Alpha B (CRYaB) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Alpha B (CRYaB) in tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Alpha B (CRYaB) ELISA Kit
SEC944Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Alpha B (CRYaB) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Alpha B (CRYaB) in tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Alpha B (CRYaB) ELISA Kit
4-SEC944Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Crystallin Alpha B elisa. Alternative names of the recognized antigen: CRY-AB CRYA-B CRYA2 CTPP2 HSPB5 Heat shock protein beta-5 Renal carcinoma antigen NY-REN-27 Rosenthal fiber component
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Crystallin Alpha B (CRYaB) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Crystallin Beta B2 ELISA Kit (CRYbB2)
RK02713	Abclonal	96 Tests	EUR 521

Mouse Crystallin Alpha B (CRYaB) ELISA Kit
RDR-CRYaB-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Crystallin Alpha B (CRYaB) ELISA Kit
RDR-CRYaB-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Mouse Crystallin Alpha B (CRYaB) ELISA Kit
RD-CRYaB-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Crystallin Alpha B (CRYaB) ELISA Kit
RD-CRYaB-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Mouse Crystallin Beta A1 (CRYbA1) ELISA Kit
SEF342Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta A1 (CRYbA1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta A1 (CRYbA1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Beta A1 (CRYbA1) ELISA Kit
SEF342Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta A1 (CRYbA1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta A1 (CRYbA1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Beta A1 (CRYbA1) ELISA Kit
SEF342Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta A1 (CRYbA1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta A1 (CRYbA1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Beta A1 (CRYbA1) ELISA Kit
SEF342Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta A1 (CRYbA1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta A1 (CRYbA1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Beta A1 (CRYbA1) ELISA Kit
4-SEF342Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Crystallin Beta A1 elisa. Alternative names of the recognized antigen: CRYB1 Eye Lens Structural Protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Crystallin Beta A1 (CRYbA1) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Crystallin Beta B1 (CRYbB1) ELISA Kit
SEF345Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta B1 (CRYbB1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta B1 (CRYbB1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Beta B1 (CRYbB1) ELISA Kit
SEF345Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta B1 (CRYbB1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta B1 (CRYbB1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Beta B1 (CRYbB1) ELISA Kit
SEF345Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta B1 (CRYbB1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta B1 (CRYbB1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Beta B1 (CRYbB1) ELISA Kit
SEF345Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta B1 (CRYbB1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta B1 (CRYbB1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Beta B1 (CRYbB1) ELISA Kit
4-SEF345Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Crystallin Beta B1 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Crystallin Beta B1 (CRYbB1) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Crystallin Beta B2 (CRYbB2) ELISA Kit
SEF346Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta B2 (CRYbB2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta B2 (CRYbB2) in tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Beta B2 (CRYbB2) ELISA Kit
SEF346Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta B2 (CRYbB2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta B2 (CRYbB2) in tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Beta B2 (CRYbB2) ELISA Kit
SEF346Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta B2 (CRYbB2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta B2 (CRYbB2) in tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Beta B2 (CRYbB2) ELISA Kit
SEF346Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta B2 (CRYbB2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta B2 (CRYbB2) in tissue homogenates, cell lysates and other biological fluids.

Mouse Crystallin Beta B2 (CRYbB2) ELISA Kit
4-SEF346Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Crystallin Beta B2 elisa. Alternative names of the recognized antigen: CCA2 CRYB2 CRYB2A Beta-crystallin Bp
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Crystallin Beta B2 (CRYbB2) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

CRYGS Conjugated Antibody
C46546	SAB	100ul	EUR 397

CRYGS cloning plasmid
CSB-CL006025HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 537 Sequence: atgtctaaaactggaaccaagattactttctatgaagacaaaaattttcaaggccgtcgctatgactgtgattgcgactgtgcagatttccacacatacctaagtcgctgcaactccattaaagtggaaggaggcacctgggctgtttatgaaaggcccaactttgctgggtacat Show more
Description: A cloning plasmid for the CRYGS gene.

CRYGS Rabbit pAb
A7888-100ul	Abclonal	100 ul	EUR 308

CRYGS Rabbit pAb
A7888-200ul	Abclonal	200 ul	EUR 459

CRYGS Rabbit pAb
A7888-20ul	Abclonal	20 ul	EUR 183

CRYGS Rabbit pAb
A7888-50ul	Abclonal	50 ul	EUR 223

Human CRYGS Antibody
32845-05111	AssayPro	150 ug