Mouse CRYgS(Crystallin Gamma S) ELISA Kit
To Order Contact us: Mark@operatiebrp.nl
Mouse Crystallin Gamma S (CRYgS) ELISA Kit |
4-SEF353Mu |
Cloud-Clone |
-
EUR 4913.00
-
EUR 2595.00
-
EUR 655.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Crystallin Gamma S elisa. Alternative names of the recognized antigen: CRYG8
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Crystallin Gamma S (CRYgS) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Crystallin Gamma S (CRYgS) Antibody |
20-abx129441 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Crystallin Gamma S (CRYGS) Antibody |
abx145026-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Crystallin Gamma S (CRYGS) Antibody |
20-abx006571 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Crystallin Gamma S (CRYGS) Antibody |
20-abx322535 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Recombinant Crystallin Gamma S (CRYgS) |
4-RPF353Mu01 |
Cloud-Clone |
-
EUR 494.24
-
EUR 235.00
-
EUR 1578.40
-
EUR 592.80
-
EUR 1085.60
-
EUR 394.00
-
EUR 3796.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: O35486
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 24.4kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Mouse Crystallin Gamma S expressed in: E.coli |
Mouse Crystallin Gamma S (CRYgS) Protein |
20-abx168389 |
Abbexa |
-
EUR 690.00
-
EUR 286.00
-
EUR 2124.00
-
EUR 815.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Mouse Crystallin Gamma S (CRYgS) CLIA Kit |
20-abx494875 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Crystallin Gamma S (CRYGS) ELISA Kit |
abx384739-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Rat Crystallin Gamma S (CRYGS) ELISA Kit |
abx391155-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
ELISA kit for Mouse CRYgS (Crystallin Gamma S) |
ELK7344 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Crystallin Gamma S (CRY?S). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Crystal
- Show more
|
Description: A sandwich ELISA kit for detection of Crystallin Gamma S from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Crystallin Gamma S (CRYgS) Polyclonal Antibody (Mouse, Rat) |
4-PAF353Mu01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CRYgS (Ser2~Glu178)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Crystallin Gamma S (CRYgS) |
CRYGS Crystallin, Gamma S Human Recombinant Protein |
PROTP22914 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: CRYGS Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 202 amino acids (1-178) and having a molecular mass of 23.6 kDa.;The CRYGS is fused to a 24 amino acid His-Tag at N-terminus and purified by proprietary chromatographic techniques. |
Mouse β crystallin S(CRYGS) ELISA kit |
E03B0895-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse β crystallin S(CRYGS) ELISA kit |
E03B0895-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse β crystallin S(CRYGS) ELISA kit |
E03B0895-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Crystallin Gamma S (CRYgS) Polyclonal Antibody (Mouse, Rat), APC |
4-PAF353Mu01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CRYgS (Ser2~Glu178)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Crystallin Gamma S (CRYgS). This antibody is labeled with APC. |
Crystallin Gamma S (CRYgS) Polyclonal Antibody (Mouse, Rat), Biotinylated |
4-PAF353Mu01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CRYgS (Ser2~Glu178)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Crystallin Gamma S (CRYgS). This antibody is labeled with Biotin. |
Crystallin Gamma S (CRYgS) Polyclonal Antibody (Mouse, Rat), Cy3 |
4-PAF353Mu01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CRYgS (Ser2~Glu178)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Crystallin Gamma S (CRYgS). This antibody is labeled with Cy3. |
Crystallin Gamma S (CRYgS) Polyclonal Antibody (Mouse, Rat), FITC |
4-PAF353Mu01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CRYgS (Ser2~Glu178)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Crystallin Gamma S (CRYgS). This antibody is labeled with FITC. |
Crystallin Gamma S (CRYgS) Polyclonal Antibody (Mouse, Rat), HRP |
4-PAF353Mu01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CRYgS (Ser2~Glu178)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Crystallin Gamma S (CRYgS). This antibody is labeled with HRP. |
Crystallin Gamma S (CRYgS) Polyclonal Antibody (Mouse, Rat), PE |
4-PAF353Mu01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CRYgS (Ser2~Glu178)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Crystallin Gamma S (CRYgS). This antibody is labeled with PE. |
Crygs ELISA Kit| Mouse Beta-crystallin S ELISA Kit |
EF014554 |
Lifescience Market |
96 Tests |
EUR 689 |
Goat β crystallin S(CRYGS) ELISA kit |
E06B0895-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat β crystallin S(CRYGS) ELISA kit |
E06B0895-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat β crystallin S(CRYGS) ELISA kit |
E06B0895-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat β crystallin S(CRYGS) ELISA kit |
E02B0895-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat β crystallin S(CRYGS) ELISA kit |
E02B0895-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat β crystallin S(CRYGS) ELISA kit |
E02B0895-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human β crystallin S(CRYGS) ELISA kit |
E01B0895-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human β crystallin S(CRYGS) ELISA kit |
E01B0895-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human β crystallin S(CRYGS) ELISA kit |
E01B0895-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit β crystallin S(CRYGS) ELISA kit |
E04B0895-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit β crystallin S(CRYGS) ELISA kit |
E04B0895-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit β crystallin S(CRYGS) ELISA kit |
E04B0895-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig β crystallin S(CRYGS) ELISA kit |
E07B0895-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig β crystallin S(CRYGS) ELISA kit |
E07B0895-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig β crystallin S(CRYGS) ELISA kit |
E07B0895-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey β crystallin S(CRYGS) ELISA kit |
E09B0895-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey β crystallin S(CRYGS) ELISA kit |
E09B0895-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey β crystallin S(CRYGS) ELISA kit |
E09B0895-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog β crystallin S(CRYGS) ELISA kit |
E08B0895-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog β crystallin S(CRYGS) ELISA kit |
E08B0895-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog β crystallin S(CRYGS) ELISA kit |
E08B0895-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Beta- crystallin S, CRYGS ELISA KIT |
ELI-09077Ra |
Lifescience Market |
96 Tests |
EUR 928 |
Human Beta-crystallin S (CRYGS |
1-CSB-EP006025HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 47.9 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Beta-crystallin S(CRYGS expressed in E.coli |
Crystallin Gamma S (CRYgS) Polyclonal Antibody (Mouse, Rat), APC-Cy7 |
4-PAF353Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CRYgS (Ser2~Glu178)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Crystallin Gamma S (CRYgS). This antibody is labeled with APC-Cy7. |
Guinea pig β crystallin S(CRYGS) ELISA kit |
E05B0895-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig β crystallin S(CRYGS) ELISA kit |
E05B0895-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig β crystallin S(CRYGS) ELISA kit |
E05B0895-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Crygs ELISA Kit| Rat Beta-crystallin S ELISA Kit |
EF018509 |
Lifescience Market |
96 Tests |
EUR 689 |
CRYGS ELISA Kit| Bovine Beta-crystallin S ELISA Kit |
EF011257 |
Lifescience Market |
96 Tests |
EUR 689 |
Gamma-S-crystallin Antibody |
20-abx141438 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 300.00
|
|
- Shipped within 5-10 working days.
|
Crystallin, gamma S Protein |
20-abx261512 |
Abbexa |
-
EUR 3418.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Mouse Gamma-crystallin D (Crygd) ELISA Kit |
abx556044-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 1-3 weeks.
|
Mouse Crystallin Gamma F (CRYGF) ELISA Kit |
20-abx156978 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Crystallin Gamma F (CRYgF) ELISA Kit |
SEC989Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4862.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Gamma F (CRYgF) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Gamma F (CRYgF) in tissue homogenates, cell lysates and other biological fluids. |
Mouse Crystallin Gamma F (CRYgF) ELISA Kit |
SEC989Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 488.08 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Gamma F (CRYgF) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Gamma F (CRYgF) in tissue homogenates, cell lysates and other biological fluids. |
Mouse Crystallin Gamma F (CRYgF) ELISA Kit |
SEC989Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 654.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Gamma F (CRYgF) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Gamma F (CRYgF) in tissue homogenates, cell lysates and other biological fluids. |
Mouse Crystallin Gamma F (CRYgF) ELISA Kit |
SEC989Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2644.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Gamma F (CRYgF) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Gamma F (CRYgF) in tissue homogenates, cell lysates and other biological fluids. |
Mouse Crystallin Gamma F (CRYgF) ELISA Kit |
4-SEC989Mu |
Cloud-Clone |
-
EUR 4913.00
-
EUR 2595.00
-
EUR 655.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Crystallin Gamma F elisa. Alternative names of the recognized antigen: n/a
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Crystallin Gamma F (CRYgF) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
ELISA kit for Mouse CRYgF (Crystallin Gamma F) |
ELK7345 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Crystallin Gamma F (CRY?F). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Crystal
- Show more
|
Description: A sandwich ELISA kit for detection of Crystallin Gamma F from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
CRYGS ELISA Kit (Mouse) (OKCD00461) |
OKCD00461 |
Aviva Systems Biology |
96 Wells |
EUR 857 |
Description: Description of target: Crystallins are the dominant structural components of the vertebrate eye lens. ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.063 ng/mL |
Mouse Crystallin Gamma F (CRYgF) CLIA Kit |
20-abx494033 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
anti-Beta crystallin S |
YF-PA11110 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to Beta crystallin S |
anti-Beta crystallin S |
YF-PA11111 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to Beta crystallin S |
Cow Gamma-crystallin D (CRYGD) ELISA Kit |
abx555742-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 1-3 weeks.
|
Human Gamma-crystallin D (CRYGD) ELISA Kit |
abx555998-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 1-3 weeks.
|
Rat Gamma-crystallin D (Crygd) ELISA Kit |
abx556196-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 1-3 weeks.
|
Human CRYGD/ Gamma-crystallin D ELISA Kit |
E0566Hu |
Sunlong |
1 Kit |
EUR 605 |
ELISA kit for Human Gamma-crystallin D |
EK2890 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Gamma-crystallin D in samples from serum, plasma, tissue homogenates and other biological fluids. |
Bovine Gamma- crystallin C, CRYGC ELISA KIT |
ELI-25518b |
Lifescience Market |
96 Tests |
EUR 928 |
Bovine Gamma- crystallin B, CRYGB ELISA KIT |
ELI-25693b |
Lifescience Market |
96 Tests |
EUR 928 |
Bovine Gamma- crystallin F, CRYGF ELISA KIT |
ELI-09008b |
Lifescience Market |
96 Tests |
EUR 928 |
Bovine Gamma- crystallin A, CRYGA ELISA KIT |
ELI-09329b |
Lifescience Market |
96 Tests |
EUR 928 |
Bovine Gamma- crystallin D, CRYGD ELISA KIT |
ELI-47522b |
Lifescience Market |
96 Tests |
EUR 928 |
Cow Crystallin Gamma D (CRYGD) ELISA Kit |
20-abx380207 |
Abbexa |
-
EUR 7911.00
-
EUR 4215.00
-
EUR 973.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-12 working days.
|
Human Crystallin Gamma D (CRYGD) ELISA Kit |
20-abx384740 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-12 working days.
|
Human Crystallin Gamma C (CRYGC) ELISA Kit |
abx386689-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Crystallin Gamma N (CRYGN) ELISA Kit |
abx386690-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Rat Crystallin Gamma D (CRYGD) ELISA Kit |
20-abx391156 |
Abbexa |
-
EUR 7237.00
-
EUR 3855.00
-
EUR 895.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-12 working days.
|
Crystallin, gamma C Protein |
20-abx260888 |
Abbexa |
-
EUR 3418.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Crystallin, gamma N Protein |
20-abx260916 |
Abbexa |
-
EUR 3418.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Crystallin, gamma D Protein |
20-abx261483 |
Abbexa |
-
EUR 3418.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Crystallin Gamma C antibody |
70R-2030 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal Crystallin Gamma C antibody raised against the middle region of CRYGC |
Mouse Crystallin Gamma F (CRYgF) Protein |
20-abx168437 |
Abbexa |
-
EUR 718.00
-
EUR 286.00
-
EUR 2207.00
-
EUR 843.00
-
EUR 509.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Crygd ELISA Kit| Rat Gamma-crystallin D ELISA Kit |
EF018510 |
Lifescience Market |
96 Tests |
EUR 689 |
CRYGD ELISA Kit| Bovine Gamma-crystallin D ELISA Kit |
EF011258 |
Lifescience Market |
96 Tests |
EUR 689 |
CRYGD Crystallin, Gamma D Mouse Recombinant Protein |
PROTP04342 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: CRYGD Mouse Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 197 amino acids (1-174 a.a.) and having a molecular mass of 23.5kDa.;CRYGD is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
Crystallin Gamma F (CRYgF) Polyclonal Antibody (Mouse) |
4-PAC989Mu01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CRYgF (Met1~Phe173)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Crystallin Gamma F (CRYgF) |
Crystallin Gamma C (CRYGC) Antibody |
20-abx123514 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Crystallin Gamma C (CRYGC) Antibody |
20-abx111825 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Crystallin Gamma F (CRYgF) Antibody |
20-abx129483 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Gamma-Crystallin D (CRYGD) Antibody |
abx145056-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Crystallin Gamma N (CRYGN) Antibody |
abx145327-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Gamma-Crystallin D (CRYGD) Antibody |
20-abx004390 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Gamma-Crystallin D (CRYGD) Antibody |
abx030580-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Gamma-Crystallin D (CRYGD) Antibody |
abx030580-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Gamma-Crystallin D (CRYGD) Antibody |
20-abx321764 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Crystallin Gamma N (CRYGN) Antibody |
20-abx309489 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Crystallin Gamma C (CRYGC) Antibody |
abx232005-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Crystallin Gamma N (CRYGN) Antibody |
abx232006-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Crystallin Gamma C Blocking Peptide |
33R-3422 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CRYGC antibody, catalog no. 70R-2030 |
Human gamma C Crystallin Antibody |
33355-05111 |
AssayPro |
150 ug |
EUR 261 |
Rat Gamma-crystallin B (Crygb) |
1-CSB-YP006018RA |
Cusabio |
-
EUR 504.00
-
EUR 265.00
-
EUR 1832.00
-
EUR 763.00
-
EUR 1216.00
-
EUR 334.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 23 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Rat Gamma-crystallin B(Crygb) expressed in Yeast |
Human Gamma-crystallin B (CRYGB) |
1-CSB-EP006018HU |
Cusabio |
-
EUR 505.00
-
EUR 265.00
-
EUR 1827.00
-
EUR 766.00
-
EUR 1218.00
-
EUR 335.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 24.9 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Gamma-crystallin B(CRYGB) expressed in E.coli |
Human Gamma-crystallin D (CRYGD) |
1-CSB-EP006020HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 47.6 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Gamma-crystallin D(CRYGD) expressed in E.coli |
Recombinant human Gamma-crystallin B |
P1661 |
FN Test |
100ug |
Ask for price |
- Uniprot ID: P07316
- Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
|
Description: Recombinant protein for human Gamma-crystallin B |
Recombinant Crystallin Gamma F (CRYgF) |
4-RPC989Mu01 |
Cloud-Clone |
-
EUR 510.37
-
EUR 239.00
-
EUR 1638.88
-
EUR 612.96
-
EUR 1125.92
-
EUR 404.00
-
EUR 3947.20
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q9CXV3
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 24.8KDa
- Isoelectric Point: Inquire
|
Description: Recombinant Mouse Crystallin Gamma F expressed in: E.coli |
Anti-gamma C Crystallin (7C4) |
YF-MA12545 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse monoclonal to gamma C Crystallin |
Anti-gamma C Crystallin (7C4) |
YF-MA12546 |
Abfrontier |
200 ul |
EUR 363 |
Description: Mouse monoclonal to gamma C Crystallin |
Anti-gamma C Crystallin (7C4) |
YF-MA12547 |
Abfrontier |
200 ul |
EUR 363 |
Description: Mouse monoclonal to gamma C Crystallin |
Anti-gamma C Crystallin (7C4) |
YF-MA12548 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse monoclonal to gamma C Crystallin |
(S)-Crizotinib |
A8802-S |
ApexBio |
Evaluation Sample |
EUR 81 |
Description: (S)-crizotinibthe selectively inhibited MTH1 catalytic activity with IC50 of 72 nM, while clinically used (R)-enantiomer of the drug was inactive with IC50 of 1375 nM. |
Mouse β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit |
E03B0894-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit |
E03B0894-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit |
E03B0894-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Crystallin Gamma F (CRYgF) Polyclonal Antibody (Mouse), APC |
4-PAC989Mu01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CRYgF (Met1~Phe173)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Crystallin Gamma F (CRYgF). This antibody is labeled with APC. |
Crystallin Gamma F (CRYgF) Polyclonal Antibody (Mouse), Biotinylated |
4-PAC989Mu01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CRYgF (Met1~Phe173)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Crystallin Gamma F (CRYgF). This antibody is labeled with Biotin. |
Crystallin Gamma F (CRYgF) Polyclonal Antibody (Mouse), Cy3 |
4-PAC989Mu01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CRYgF (Met1~Phe173)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Crystallin Gamma F (CRYgF). This antibody is labeled with Cy3. |
Crystallin Gamma F (CRYgF) Polyclonal Antibody (Mouse), FITC |
4-PAC989Mu01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CRYgF (Met1~Phe173)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Crystallin Gamma F (CRYgF). This antibody is labeled with FITC. |
Crystallin Gamma F (CRYgF) Polyclonal Antibody (Mouse), HRP |
4-PAC989Mu01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CRYgF (Met1~Phe173)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Crystallin Gamma F (CRYgF). This antibody is labeled with HRP. |
Crystallin Gamma F (CRYgF) Polyclonal Antibody (Mouse), PE |
4-PAC989Mu01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CRYgF (Met1~Phe173)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Crystallin Gamma F (CRYgF). This antibody is labeled with PE. |
Mouse CRYGS shRNA Plasmid |
20-abx969838 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
CRYGS Recombinant Protein (Mouse) |
RP126197 |
ABM |
100 ug |
Ask for price |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Crystallin Gamma N (CRYGN) Antibody (HRP) |
20-abx309490 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Crystallin Gamma N (CRYGN) Antibody (FITC) |
20-abx309491 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Crystallin Gamma N (CRYGN) Antibody (Biotin) |
20-abx309492 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
CRYGS siRNA |
20-abx901283 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CRYGS siRNA |
20-abx912893 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CRYGS siRNA |
20-abx912894 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CRYGS Antibody |
46546-100ul |
SAB |
100ul |
EUR 252 |
CRYGS Antibody |
1-CSB-PA006025ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against CRYGS. Recognizes CRYGS from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
Rabbit Anti-Mouse Synuclein-gamma antiserum # 1 |
SYN14-S |
Alpha Diagnostics |
100 ul |
EUR 457 |
Mouse Alpha B Crystallin ELISA kit |
E03C0343-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Alpha B Crystallin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Alpha B Crystallin ELISA kit |
E03C0343-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Alpha B Crystallin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Alpha B Crystallin ELISA kit |
E03C0343-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Alpha B Crystallin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Crystallin Gamma F (CRYgF) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAC989Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CRYgF (Met1~Phe173)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Crystallin Gamma F (CRYgF). This antibody is labeled with APC-Cy7. |
Rabbit Anti-Mouse Neprilysin-beta (NEPL-gamma) antiserum |
NEPLG31-S |
Alpha Diagnostics |
100 ul |
EUR 457 |
Goat β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit |
E06B0894-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit |
E06B0894-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit |
E06B0894-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit |
E02B0894-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit |
E02B0894-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit |
E02B0894-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit |
E01B0894-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit |
E01B0894-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit |
E01B0894-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit |
E04B0894-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit |
E04B0894-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit |
E04B0894-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit |
E07B0894-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit |
E07B0894-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit |
E07B0894-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit |
E09B0894-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit |
E09B0894-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit |
E09B0894-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit |
E08B0894-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit |
E08B0894-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog β/gamma crystallin domain containing protein 3(CRYBG3) ELISA kit |
E08B0894-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine β/gamma crystallin domain containing protein 3(CRYBG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Crygs ORF Vector (Mouse) (pORF) |
ORF042067 |
ABM |
1.0 ug DNA |
EUR 506 |
Human gamma C Crystallin Antibody (Biotin Conjugate) |
33355-05121 |
AssayPro |
150 ug |
EUR 369 |
CRYGC Crystallin, Gamma C Human Recombinant Protein |
PROTP07315 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: CRYGC Human Recombinant produced in E. coli is a single polypeptide chain containing 198 amino acids (1-174) and having a molecular mass of 23.5kDa.;CRYGC is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
CRYGD Crystallin, Gamma D Human Recombinant Protein |
PROTP07320 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: CRYGD Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 194 amino acids (1-174 a.a.) and having a molecular mass of 22.9kDa.;CRYGD is fused to a 20 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
CRYGN Crystallin, Gamma N Human Recombinant Protein |
PROTQ8WXF5 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: CRYGN Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 206 amino acids (1-182 a.a) and having a molecular mass of 23.1kDa.;CRYGN is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
(S)-3-Hydroxy-Gamma-Butyrolactone |
abx188035-1000g |
Abbexa |
1000 g |
EUR 871 |
- Shipped within 1-2 weeks.
|
CRYGS Conjugated Antibody |
C46546 |
SAB |
100ul |
EUR 397 |
CRYGS cloning plasmid |
CSB-CL006025HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 537
- Sequence: atgtctaaaactggaaccaagattactttctatgaagacaaaaattttcaaggccgtcgctatgactgtgattgcgactgtgcagatttccacacatacctaagtcgctgcaactccattaaagtggaaggaggcacctgggctgtttatgaaaggcccaactttgctgggtacat
- Show more
|
Description: A cloning plasmid for the CRYGS gene. |
CRYGS Rabbit pAb |
A7888-100ul |
Abclonal |
100 ul |
EUR 308 |
CRYGS Rabbit pAb |
A7888-200ul |
Abclonal |
200 ul |
EUR 459 |
CRYGS Rabbit pAb |
A7888-20ul |
Abclonal |
20 ul |
EUR 183 |
CRYGS Rabbit pAb |
A7888-50ul |
Abclonal |
50 ul |
EUR 223 |
Human CRYGS Antibody |
32845-05111 |
AssayPro |
150 ug |
EUR 261 |
Anti-CRYGS antibody |
STJ110198 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Crystallins are separated into two classes: taxon-specific, or enzyme, and ubiquitous. The latter class constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. Since lens central fiber cells lose their nuclei during development, these crystallins are made and then retained throughout life, making them extremely stable proteins. Mammalian lens crystallins are divided into alpha, beta, and gamma families; beta and gamma crystallins are also considered as a superfamily. Alpha and beta families are further divided into acidic and basic groups. Seven protein regions exist in crystallins: four homologous motifs, a connecting peptide, and N- and C-terminal extensions. Gamma-crystallins are a homogeneous group of highly symmetrical, monomeric proteins typically lacking connecting peptides and terminal extensions. They are differentially regulated after early development. This gene encodes a protein initially considered to be a beta-crystallin but the encoded protein is monomeric and has greater sequence similarity to other gamma-crystallins. This gene encodes the most significant gamma-crystallin in adult eye lens tissue. Whether due to aging or mutations in specific genes, gamma-crystallins have been involved in cataract formation. |
Mouse Lambda crystallin homolog(CRYL1) ELISA kit |
E03L0316-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Lambda crystallin homolog(CRYL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Lambda crystallin homolog(CRYL1) ELISA kit |
E03L0316-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Lambda crystallin homolog(CRYL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Lambda crystallin homolog(CRYL1) ELISA kit |
E03L0316-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Lambda crystallin homolog(CRYL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse β crystallin A2(CRYBA2) ELISA kit |
E03B0889-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin A2(CRYBA2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse β crystallin A2(CRYBA2) ELISA kit |
E03B0889-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin A2(CRYBA2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse β crystallin A2(CRYBA2) ELISA kit |
E03B0889-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin A2(CRYBA2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse β crystallin A4(CRYBA4) ELISA kit |
E03B0890-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin A4(CRYBA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse β crystallin A4(CRYBA4) ELISA kit |
E03B0890-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin A4(CRYBA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse β crystallin A4(CRYBA4) ELISA kit |
E03B0890-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin A4(CRYBA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse β crystallin B1(CRYBB1) ELISA kit |
E03B0891-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin B1(CRYBB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse β crystallin B1(CRYBB1) ELISA kit |
E03B0891-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin B1(CRYBB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse β crystallin B1(CRYBB1) ELISA kit |
E03B0891-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin B1(CRYBB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse β crystallin B2(CRYBB2) ELISA kit |
E03B0892-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin B2(CRYBB2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse β crystallin B2(CRYBB2) ELISA kit |
E03B0892-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin B2(CRYBB2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse β crystallin B2(CRYBB2) ELISA kit |
E03B0892-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin B2(CRYBB2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse β crystallin B3(CRYBB3) ELISA kit |
E03B0893-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin B3(CRYBB3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse β crystallin B3(CRYBB3) ELISA kit |
E03B0893-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin B3(CRYBB3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse β crystallin B3(CRYBB3) ELISA kit |
E03B0893-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin B3(CRYBB3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse crystallin, β A1 (CRYBA1) ELISA kit |
E03C2086-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse crystallin, β A1 (CRYBA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse crystallin, β A1 (CRYBA1) ELISA kit |
E03C2086-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse crystallin, β A1 (CRYBA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse crystallin, β A1 (CRYBA1) ELISA kit |
E03C2086-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse crystallin, β A1 (CRYBA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Beta- crystallin A1, Cryba1 ELISA KIT |
ELI-10489m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Beta- crystallin A4, Cryba4 ELISA KIT |
ELI-10490m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Beta- crystallin B2, Crybb2 ELISA KIT |
ELI-26113m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Beta- crystallin B3, Crybb3 ELISA KIT |
ELI-26438m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Lambda- crystallin homolog, Cryl1 ELISA KIT |
ELI-26469m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Beta- crystallin B1, Crybb1 ELISA KIT |
ELI-33761m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Beta- crystallin A2, Cryba2 ELISA KIT |
ELI-31972m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Crystallin Beta A1 (CRYBA1) ELISA Kit |
20-abx156974 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Crystallin Beta B1 (CRYBB1) ELISA Kit |
20-abx156975 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Crystallin Beta B2 (CRYBB2) ELISA Kit |
20-abx156976 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Crystallin alpha B (CRYaB) ELISA Kit |
20-abx153876 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Crystallin Alpha B (CRYaB) ELISA Kit |
DLR-CRYaB-Mu-48T |
DL Develop |
48T |
EUR 527 |
- Should the Mouse Crystallin Alpha B (CRYaB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Crystallin Alpha B (CRYaB) in samples from tissue homogenates, cell lysates or other biological fluids. |
Mouse Crystallin Alpha B (CRYaB) ELISA Kit |
DLR-CRYaB-Mu-96T |
DL Develop |
96T |
EUR 688 |
- Should the Mouse Crystallin Alpha B (CRYaB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Crystallin Alpha B (CRYaB) in samples from tissue homogenates, cell lysates or other biological fluids. |
Mouse Crystallin Alpha B (CRYaB) ELISA Kit |
SEC944Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4862.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Alpha B (CRYaB) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Alpha B (CRYaB) in tissue homogenates, cell lysates and other biological fluids. |
Mouse Crystallin Alpha B (CRYaB) ELISA Kit |
SEC944Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 488.08 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Alpha B (CRYaB) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Alpha B (CRYaB) in tissue homogenates, cell lysates and other biological fluids. |
Mouse Crystallin Alpha B (CRYaB) ELISA Kit |
SEC944Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 654.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Alpha B (CRYaB) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Alpha B (CRYaB) in tissue homogenates, cell lysates and other biological fluids. |
Mouse Crystallin Alpha B (CRYaB) ELISA Kit |
SEC944Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2644.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Alpha B (CRYaB) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Alpha B (CRYaB) in tissue homogenates, cell lysates and other biological fluids. |
Mouse Crystallin Alpha B (CRYaB) ELISA Kit |
4-SEC944Mu |
Cloud-Clone |
-
EUR 4913.00
-
EUR 2595.00
-
EUR 655.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Crystallin Alpha B elisa. Alternative names of the recognized antigen: CRY-AB
- CRYA-B
- CRYA2
- CTPP2
- HSPB5
- Heat shock protein beta-5
- Renal carcinoma antigen NY-REN-27
- Rosenthal fiber component
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Crystallin Alpha B (CRYaB) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Mouse Crystallin Beta B2 ELISA Kit (CRYbB2) |
RK02713 |
Abclonal |
96 Tests |
EUR 521 |
Mouse Crystallin Alpha B (CRYaB) ELISA Kit |
RDR-CRYaB-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse Crystallin Alpha B (CRYaB) ELISA Kit |
RDR-CRYaB-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
Mouse Crystallin Alpha B (CRYaB) ELISA Kit |
RD-CRYaB-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse Crystallin Alpha B (CRYaB) ELISA Kit |
RD-CRYaB-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Mouse Crystallin Beta A1 (CRYbA1) ELISA Kit |
SEF342Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4862.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta A1 (CRYbA1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta A1 (CRYbA1) in Tissue homogenates, cell lysates and other biological fluids. |
Mouse Crystallin Beta A1 (CRYbA1) ELISA Kit |
SEF342Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 488.08 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta A1 (CRYbA1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta A1 (CRYbA1) in Tissue homogenates, cell lysates and other biological fluids. |
Mouse Crystallin Beta A1 (CRYbA1) ELISA Kit |
SEF342Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 654.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta A1 (CRYbA1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta A1 (CRYbA1) in Tissue homogenates, cell lysates and other biological fluids. |
Mouse Crystallin Beta A1 (CRYbA1) ELISA Kit |
SEF342Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2644.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta A1 (CRYbA1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta A1 (CRYbA1) in Tissue homogenates, cell lysates and other biological fluids. |
Mouse Crystallin Beta A1 (CRYbA1) ELISA Kit |
4-SEF342Mu |
Cloud-Clone |
-
EUR 4913.00
-
EUR 2595.00
-
EUR 655.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Crystallin Beta A1 elisa. Alternative names of the recognized antigen: CRYB1
- Eye Lens Structural Protein
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Crystallin Beta A1 (CRYbA1) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Mouse Crystallin Beta B1 (CRYbB1) ELISA Kit |
SEF345Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4862.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta B1 (CRYbB1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta B1 (CRYbB1) in Tissue homogenates, cell lysates and other biological fluids. |
Mouse Crystallin Beta B1 (CRYbB1) ELISA Kit |
SEF345Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 488.08 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta B1 (CRYbB1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta B1 (CRYbB1) in Tissue homogenates, cell lysates and other biological fluids. |
Mouse Crystallin Beta B1 (CRYbB1) ELISA Kit |
SEF345Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 654.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta B1 (CRYbB1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta B1 (CRYbB1) in Tissue homogenates, cell lysates and other biological fluids. |
Mouse Crystallin Beta B1 (CRYbB1) ELISA Kit |
SEF345Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2644.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta B1 (CRYbB1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta B1 (CRYbB1) in Tissue homogenates, cell lysates and other biological fluids. |
Mouse Crystallin Beta B1 (CRYbB1) ELISA Kit |
4-SEF345Mu |
Cloud-Clone |
-
EUR 4913.00
-
EUR 2595.00
-
EUR 655.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Crystallin Beta B1 elisa. Alternative names of the recognized antigen: n/a
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Crystallin Beta B1 (CRYbB1) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Mouse Crystallin Beta B2 (CRYbB2) ELISA Kit |
SEF346Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4862.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta B2 (CRYbB2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta B2 (CRYbB2) in tissue homogenates, cell lysates and other biological fluids. |
Mouse Crystallin Beta B2 (CRYbB2) ELISA Kit |
SEF346Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 488.08 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta B2 (CRYbB2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta B2 (CRYbB2) in tissue homogenates, cell lysates and other biological fluids. |
Mouse Crystallin Beta B2 (CRYbB2) ELISA Kit |
SEF346Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 654.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta B2 (CRYbB2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta B2 (CRYbB2) in tissue homogenates, cell lysates and other biological fluids. |
Mouse Crystallin Beta B2 (CRYbB2) ELISA Kit |
SEF346Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
|