Mouse KLK13(Kallikrein 13) ELISA Kit
To Order Contact us: Mark@operatiebrp.nl
Mouse Kallikrein 13 (KLK13) ELISA Kit |
RD-KLK13-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse Kallikrein 13 (KLK13) ELISA Kit |
RD-KLK13-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Human Kallikrein 13 (KLK13) ELISA Kit |
DLR-KLK13-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Kallikrein 13 (KLK13) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Kallikrein 13 (KLK13) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Human Kallikrein 13 (KLK13) ELISA Kit |
DLR-KLK13-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Kallikrein 13 (KLK13) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Kallikrein 13 (KLK13) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Human Kallikrein 13 (KLK13) ELISA Kit |
RDR-KLK13-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Kallikrein 13 (KLK13) ELISA Kit |
RDR-KLK13-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Kallikrein 13 (KLK13) ELISA Kit |
RD-KLK13-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Kallikrein 13 (KLK13) ELISA Kit |
RD-KLK13-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Mouse Kallikrein 13 (KLK13) ELISA Kit |
20-abx154281 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Kallikrein 13 (KLK13) ELISA Kit |
SED373Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4862.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Mouse Kallikrein 13 (KLK13) ELISA Kit |
SED373Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 488.08 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Mouse Kallikrein 13 (KLK13) ELISA Kit |
SED373Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 654.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Mouse Kallikrein 13 (KLK13) ELISA Kit |
SED373Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2644.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Mouse Kallikrein 13 (KLK13) ELISA Kit |
4-SED373Mu |
Cloud-Clone |
-
EUR 4913.00
-
EUR 2595.00
-
EUR 655.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Kallikrein 13 elisa. Alternative names of the recognized antigen: KLK-L4
- KLKL4
- Kallikrein-like protein 4
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Kallikrein 13 (KLK13) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Mouse Kallikrein 13 (KLK13) Protein |
20-abx168449 |
Abbexa |
-
EUR 718.00
-
EUR 286.00
-
EUR 2221.00
-
EUR 857.00
-
EUR 509.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Mouse Kallikrein 13 (KLK13) CLIA Kit |
20-abx494239 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Mouse KLK13 (Kallikrein 13) |
ELK7224 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Kallikrein 13 (KLK13). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Kallikrein 1
- Show more
|
Description: A sandwich ELISA kit for detection of Kallikrein 13 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Kallikrein 13 (KLK13) Antibody |
20-abx177245 |
Abbexa |
|
|
|
Kallikrein 13 (KLK13) Antibody |
20-abx177246 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Kallikrein 13 (KLK13) Antibody |
20-abx210856 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Kallikrein 13 (KLK13) Antibody |
20-abx129211 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Kallikrein 13 (KLK13) Antibody |
20-abx129912 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Kallikrein 13 (KLK13) Antibody |
20-abx173224 |
Abbexa |
|
|
|
Kallikrein 13 (KLK13) Antibody |
20-abx339236 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Recombinant Kallikrein 13 (KLK13) |
4-RPD373Hu01 |
Cloud-Clone |
-
EUR 494.24
-
EUR 235.00
-
EUR 1578.40
-
EUR 592.80
-
EUR 1085.60
-
EUR 394.00
-
EUR 3796.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q9UKR3
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 32.2kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Kallikrein 13 expressed in: E.coli |
Recombinant Kallikrein 13 (KLK13) |
4-RPD373Mu01 |
Cloud-Clone |
-
EUR 512.16
-
EUR 240.00
-
EUR 1645.60
-
EUR 615.20
-
EUR 1130.40
-
EUR 406.00
-
EUR 3964.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P36368
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 29.8kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Mouse Kallikrein 13 expressed in: E.coli |
Human Kallikrein 13 (KLK13) ELISA Kit |
20-abx152086 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Kallikrein 13 (KLK13) ELISA Kit |
SED373Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Kallikrein 13 (KLK13) ELISA Kit |
SED373Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Kallikrein 13 (KLK13) ELISA Kit |
SED373Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Kallikrein 13 (KLK13) ELISA Kit |
SED373Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Kallikrein 13 (KLK13) ELISA Kit |
4-SED373Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Kallikrein 13 elisa. Alternative names of the recognized antigen: KLK-L4
- KLKL4
- Kallikrein-like protein 4
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Kallikrein 13 (KLK13) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
ELISA kit for Human KLK13 (Kallikrein 13) |
ELK4917 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Kallikrein 13 (KLK13). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Kallikrein 1
- Show more
|
Description: A sandwich ELISA kit for detection of Kallikrein 13 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human Kallikrein-13 (KLK13) |
KTE61899-48T |
Abbkine |
48T |
EUR 332 |
- Kallikrein-13 is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Expression of this gene is regulated by steroid hormones and may be useful as a marker for breast cancer. An additional transcript variant has bee
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Kallikrein-13 (KLK13) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Kallikrein-13 (KLK13) |
KTE61899-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Kallikrein-13 is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Expression of this gene is regulated by steroid hormones and may be useful as a marker for breast cancer. An additional transcript variant has bee
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Kallikrein-13 (KLK13) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Kallikrein-13 (KLK13) |
KTE61899-96T |
Abbkine |
96T |
EUR 539 |
- Kallikrein-13 is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Expression of this gene is regulated by steroid hormones and may be useful as a marker for breast cancer. An additional transcript variant has bee
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Kallikrein-13 (KLK13) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Human Kallikrein 13 (KLK13) CLIA Kit |
20-abx494238 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Kallikrein 13 (KLK13) Protein |
20-abx167044 |
Abbexa |
-
EUR 690.00
-
EUR 286.00
-
EUR 2124.00
-
EUR 815.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
OVA conjugated Kallikrein 13 (KLK13) |
4-CPD373Hu21 |
Cloud-Clone |
-
EUR 413.60
-
EUR 214.00
-
EUR 1276.00
-
EUR 492.00
-
EUR 884.00
-
EUR 340.00
-
EUR 3040.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q9UKR3
- Buffer composition: PBS, pH 7.4.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): Inquire
- Isoelectric Point: Inquire
|
Description: Recombinant Human Kallikrein 13 expressed in: chemical synthesis |
Kallikrein 13 (KLK13) polyclonal antibody |
ABP-PAB-10239 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Miscellaneous
- Brand:
|
Kallikrein 13 (KLK13) Polyclonal Antibody (Human) |
4-PAD373Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KLK13 (Glu22~Gln277)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13) |
KLK13 Kallikrein-13 Human Recombinant Protein |
PROTQ9UKR3 |
BosterBio |
Regular: 5ug |
EUR 317 |
Description: KLK13 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 284 amino acids (17-277 a.a) and having a molecular mass of 31.3kDa.;KLK13 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat) |
4-PAD373Mu01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KLK13 (Val25~Ala261)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13) |
Polyclonal KLK13 / Kallikrein 13 Antibody (aa262-277) |
APR02667G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KLK13 / Kallikrein 13 (aa262-277). This antibody is tested and proven to work in the following applications: |
Recombinant Human Kallikrein 13/KLK13 (C-6His) |
C362-10ug |
Novoprotein |
10ug |
EUR 202 |
Description: Supplied as a 0.2 μm filtered solution of 20mM MES, 150mM NaCl, 10% Glycerol, pH 5.5. |
Recombinant Human Kallikrein 13/KLK13 (C-6His) |
C362-1mg |
Novoprotein |
1mg |
EUR 2283 |
Description: Supplied as a 0.2 μm filtered solution of 20mM MES, 150mM NaCl, 10% Glycerol, pH 5.5. |
Recombinant Human Kallikrein 13/KLK13 (C-6His) |
C362-500ug |
Novoprotein |
500ug |
EUR 1613 |
Description: Supplied as a 0.2 μm filtered solution of 20mM MES, 150mM NaCl, 10% Glycerol, pH 5.5. |
Recombinant Human Kallikrein 13/KLK13 (C-6His) |
C362-50ug |
Novoprotein |
50ug |
EUR 496 |
Description: Supplied as a 0.2 μm filtered solution of 20mM MES, 150mM NaCl, 10% Glycerol, pH 5.5. |
Kallikrein 13 (KLK13) Polyclonal Antibody (Human), APC |
4-PAD373Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KLK13 (Glu22~Gln277)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13). This antibody is labeled with APC. |
Kallikrein 13 (KLK13) Polyclonal Antibody (Human), Biotinylated |
4-PAD373Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KLK13 (Glu22~Gln277)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13). This antibody is labeled with Biotin. |
Kallikrein 13 (KLK13) Polyclonal Antibody (Human), Cy3 |
4-PAD373Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KLK13 (Glu22~Gln277)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13). This antibody is labeled with Cy3. |
Kallikrein 13 (KLK13) Polyclonal Antibody (Human), FITC |
4-PAD373Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KLK13 (Glu22~Gln277)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13). This antibody is labeled with FITC. |
Kallikrein 13 (KLK13) Polyclonal Antibody (Human), HRP |
4-PAD373Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KLK13 (Glu22~Gln277)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13). This antibody is labeled with HRP. |
Kallikrein 13 (KLK13) Polyclonal Antibody (Human), PE |
4-PAD373Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KLK13 (Glu22~Gln277)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13). This antibody is labeled with PE. |
Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat), APC |
4-PAD373Mu01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KLK13 (Val25~Ala261)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13). This antibody is labeled with APC. |
Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat), Biotinylated |
4-PAD373Mu01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KLK13 (Val25~Ala261)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13). This antibody is labeled with Biotin. |
Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat), Cy3 |
4-PAD373Mu01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KLK13 (Val25~Ala261)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13). This antibody is labeled with Cy3. |
Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat), FITC |
4-PAD373Mu01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KLK13 (Val25~Ala261)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13). This antibody is labeled with FITC. |
Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat), HRP |
4-PAD373Mu01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KLK13 (Val25~Ala261)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13). This antibody is labeled with HRP. |
Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat), PE |
4-PAD373Mu01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KLK13 (Val25~Ala261)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13). This antibody is labeled with PE. |
Kallikrein 13 (KLK13) Polyclonal Antibody (Human), APC-Cy7 |
4-PAD373Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KLK13 (Glu22~Gln277)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13). This antibody is labeled with APC-Cy7. |
KLK13 Human, Kallikrein-13 Human Recombinant Protein, sf9 |
PROTQ9UKR3-1 |
BosterBio |
Regular: 5ug |
EUR 317 |
Description: KLK13 produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 267 amino acids (17-277a.a.) and having a molecular mass of 29.7kDa. (Molecular size on SDS-PAGE will appear at approximately 28-40kDa). KLK13 is expressed with a 6 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques. |
Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat), APC-Cy7 |
4-PAD373Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KLK13 (Val25~Ala261)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13). This antibody is labeled with APC-Cy7. |
99445-13 DCT 13 X 100MM |
99445-13 |
CORNING |
250/pk |
EUR 76 |
Description: Disposable Culture Tubes; DCT's, CGW |
anti-Kallikrein 13 |
YF-PA18203 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to Kallikrein 13 |
99999 CAP 13-415 |
99999-13 |
CORNING |
1000/pk |
EUR 219 |
Description: Disposable Screw Cap Culture Tubes; DSCCT's, Caps |
Kallikrein 13 Protein (OVA) |
20-abx165562 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Anti-Kallikrein 13 (1G9) |
YF-MA18049 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to Kallikrein 13 |
9998 SCREW CAP 415/13 |
9998-13 |
CORNING |
288/pk |
EUR 198 |
Description: General Apparatus; Stoppers |
99447 DSSCT 13 X 100MM W/ MARING SPOT |
99447-13 |
CORNING |
250/pk |
EUR 332 |
Description: Disposable Screw Cap Culture Tubes; DSCCT's, Lab Stock |
99449 DSSCT 13 X 100MM W/O MARKING SPOT |
99449-13 |
CORNING |
250/pk |
EUR 281 |
Description: Disposable Screw Cap Culture Tubes; DSCCT's, Lab Stock |
ELISA kit for Human KLK13 |
EK5504 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human KLK13 in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human KLK13 PicoKine ELISA Kit |
EK1168 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of human KLK13 in cell culture supernates, cell lysates, serum and plasma(heparin, EDTA). |
KLK13 ELISA Kit (Human) (OKCD00765) |
OKCD00765 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 12.6 pg/mL |
KLK13 ELISA Kit (Human) (OKBB00909) |
OKBB00909 |
Aviva Systems Biology |
96 Wells |
EUR 505 |
Description: Description of target: Kallikrein-13 is a protein that in humans is encoded by the KLK13 gene. It belongs to the kallikrein subgroup of serine proteases, which have diverse physiologic functions in many tissues. By genomic sequence analysis, KLK13 gene is mapped in a 300-kb region on chromosome 19q13.3-q13.4. It has been shown that recombinant hK13 produced in yeast can cleave synthetic peptides after the arginine residue and some extracellular matrix components. However, its exact physiological substrates and functions remain obscure. Despite the lack of knowledge on the physiological function of hK13, several studies have demonstrated that hK13 is implicated with cancer of the breast and ovary and it can serve as a favorable prognostic biomarker for these malignancies.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml |
Human CellExp? Kallikrein-13, human recombinant |
7413-10 |
Biovision |
|
EUR 278 |
Mouse KalliKrein 1 ELISA kit |
E03K0026-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse KalliKrein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse KalliKrein 1 ELISA kit |
E03K0026-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse KalliKrein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse KalliKrein 1 ELISA kit |
E03K0026-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse KalliKrein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Kallikrein 10 ELISA kit |
E03K0070-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Kallikrein 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Kallikrein 10 ELISA kit |
E03K0070-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Kallikrein 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Kallikrein 10 ELISA kit |
E03K0070-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Kallikrein 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Kallikrein 11 ELISA kit |
E03K0072-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Kallikrein 11 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Kallikrein 11 ELISA kit |
E03K0072-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Kallikrein 11 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Kallikrein 11 ELISA kit |
E03K0072-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Kallikrein 11 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Kallikrein 6 ELISA kit |
E03K0073-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Kallikrein 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Kallikrein 6 ELISA kit |
E03K0073-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Kallikrein 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Kallikrein 6 ELISA kit |
E03K0073-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Kallikrein 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Kallikrein 7 ELISA kit |
E03K0074-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Kallikrein 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Kallikrein 7 ELISA kit |
E03K0074-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Kallikrein 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Kallikrein 7 ELISA kit |
E03K0074-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Kallikrein 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Kallikrein 8 ELISA kit |
E03K0075-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Kallikrein 8 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Kallikrein 8 ELISA kit |
E03K0075-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Kallikrein 8 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Kallikrein 8 ELISA kit |
E03K0075-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Kallikrein 8 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Kallikrein 2 ELISA kit |
E03K0077-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Kallikrein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Kallikrein 2 ELISA kit |
E03K0077-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Kallikrein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Kallikrein 2 ELISA kit |
E03K0077-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Kallikrein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Kallikrein 3 ELISA kit |
E03K0078-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Kallikrein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Kallikrein 3 ELISA kit |
E03K0078-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Kallikrein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Kallikrein 3 ELISA kit |
E03K0078-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Kallikrein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Kallikrein 5 ELISA kit |
E03K0079-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Kallikrein 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Kallikrein 5 ELISA kit |
E03K0079-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Kallikrein 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Kallikrein 5 ELISA kit |
E03K0079-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Kallikrein 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
KLK13 Recombinant Protein (Mouse) |
RP146090 |
ABM |
100 ug |
Ask for price |
CA199 (Cancer antigen) ELISA test |
13 |
Biobase |
96T/Box |
Ask for price |
- Area of application: Hormone testing
|
Description: ELISA based test for quantitative detection of CA199 (Cancer antigen) |
KLK13 Antibody |
36578-100ul |
SAB |
100ul |
EUR 252 |
KLK13 Antibody |
1-CSB-PA374084 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against KLK13. Recognizes KLK13 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200 |
KLK13 Antibody |
1-CSB-PA185718 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against KLK13. Recognizes KLK13 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100 |
KLK13 protein |
80R-4293 |
Fitzgerald |
20 ug |
EUR 327 |
Description: Purified Recombinant KLK13 protein (His tagged) |
KLK13 antibody |
70R-3265 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal KLK13 antibody raised against the middle region of KLK13 |
KLK13 siRNA |
20-abx921819 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
IL-13 ELISA Kit| Mouse Interleukin 13 ELISA Kit |
EF012875 |
Lifescience Market |
96 Tests |
EUR 689 |
Mouse Interleukin 13, IL-13 ELISA Kit |
CSB-E04602m-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Interleukin 13, IL-13 in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Mouse Interleukin 13, IL-13 ELISA Kit |
1-CSB-E04602m |
Cusabio |
-
EUR 603.00
-
EUR 4247.00
-
EUR 2260.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Interleukin 13, IL-13 in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Mouse Interleukin 13,IL-13 ELISA Kit |
CN-02456M1 |
ChemNorm |
96T |
EUR 447 |
Mouse Interleukin 13,IL-13 ELISA Kit |
CN-02456M2 |
ChemNorm |
48T |
EUR 296 |
Mouse IL-13(Interleukin 13) ELISA Kit |
EM0103 |
FN Test |
96T |
EUR 476.25 |
- Detection range: 31.25-2000 pg/ml
- Uniprot ID: P20109
- Alias: Interleukin-13,T-cell activation protein P600,Il-13
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 18.75pg/ml |
Mouse Interleukin 13(IL-13)ELISA Kit |
GA-E0041MS-48T |
GenAsia Biotech |
48T |
EUR 336 |
Mouse Interleukin 13(IL-13)ELISA Kit |
GA-E0041MS-96T |
GenAsia Biotech |
96T |
EUR 534 |
MMP-13 ELISA Kit| Mouse Matrix Metalloproteinase 13 ELISA Kit |
EF012983 |
Lifescience Market |
96 Tests |
EUR 689 |
Mouse Kallikrein 1 (KLK1) ELISA Kit |
DLR-KLK1-Mu-48T |
DL Develop |
48T |
EUR 450 |
- Should the Mouse Kallikrein 1 (KLK1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Kallikrein 1 (KLK1) in samples from serum, plasma or other biological fluids. |
Mouse Kallikrein 1 (KLK1) ELISA Kit |
DLR-KLK1-Mu-96T |
DL Develop |
96T |
EUR 582 |
- Should the Mouse Kallikrein 1 (KLK1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Kallikrein 1 (KLK1) in samples from serum, plasma or other biological fluids. |
Mouse Kallikrein 3 (KLK3) ELISA Kit |
DLR-KLK3-Mu-48T |
DL Develop |
48T |
EUR 489 |
- Should the Mouse Kallikrein 3 (KLK3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Kallikrein 3 (KLK3) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Mouse Kallikrein 3 (KLK3) ELISA Kit |
DLR-KLK3-Mu-96T |
DL Develop |
96T |
EUR 635 |
- Should the Mouse Kallikrein 3 (KLK3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Kallikrein 3 (KLK3) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Mouse Kallikrein 4 (KLK4) ELISA Kit |
DLR-KLK4-Mu-48T |
DL Develop |
48T |
EUR 489 |
- Should the Mouse Kallikrein 4 (KLK4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Kallikrein 4 (KLK4) in samples from serum, plasma or other biological fluids. |
Mouse Kallikrein 4 (KLK4) ELISA Kit |
DLR-KLK4-Mu-96T |
DL Develop |
96T |
EUR 635 |
- Should the Mouse Kallikrein 4 (KLK4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Kallikrein 4 (KLK4) in samples from serum, plasma or other biological fluids. |
Mouse Kallikrein 5 (KLK5) ELISA Kit |
DLR-KLK5-Mu-48T |
DL Develop |
48T |
EUR 489 |
- Should the Mouse Kallikrein 5 (KLK5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Kallikrein 5 (KLK5) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Mouse Kallikrein 5 (KLK5) ELISA Kit |
DLR-KLK5-Mu-96T |
DL Develop |
96T |
EUR 635 |
- Should the Mouse Kallikrein 5 (KLK5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Kallikrein 5 (KLK5) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Mouse Kallikrein 6 (KLK6) ELISA Kit |
DLR-KLK6-Mu-48T |
DL Develop |
48T |
EUR 489 |
- Should the Mouse Kallikrein 6 (KLK6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Kallikrein 6 (KLK6) in samples from serum, plasma, cerebrospinal fluid, breast milk or other biological fluids. |
Mouse Kallikrein 6 (KLK6) ELISA Kit |
DLR-KLK6-Mu-96T |
DL Develop |
96T |
EUR 635 |
- Should the Mouse Kallikrein 6 (KLK6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Kallikrein 6 (KLK6) in samples from serum, plasma, cerebrospinal fluid, breast milk or other biological fluids. |
Mouse Kallikrein 7 (KLK7) ELISA Kit |
DLR-KLK7-Mu-48T |
DL Develop |
48T |
EUR 508 |
- Should the Mouse Kallikrein 7 (KLK7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Kallikrein 7 (KLK7) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Mouse Kallikrein 7 (KLK7) ELISA Kit |
DLR-KLK7-Mu-96T |
DL Develop |
96T |
EUR 661 |
- Should the Mouse Kallikrein 7 (KLK7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Kallikrein 7 (KLK7) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Mouse plasma kallikrein(KLKB1) ELISA kit |
E03P0813-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse plasma kallikrein(KLKB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse plasma kallikrein(KLKB1) ELISA kit |
E03P0813-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse plasma kallikrein(KLKB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse plasma kallikrein(KLKB1) ELISA kit |
E03P0813-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse plasma kallikrein(KLKB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Kallikrein 1 (KLK1) ELISA Kit |
20-abx154280 |
Abbexa |
-
EUR 6642.00
-
EUR 3542.00
-
EUR 825.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Kallikrein 3 (KLK3) ELISA Kit |
20-abx154282 |
Abbexa |
-
EUR 6642.00
-
EUR 3542.00
-
EUR 825.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Kallikrein 5 (KLK5) ELISA Kit |
20-abx154283 |
Abbexa |
-
EUR 6642.00
-
EUR 3542.00
-
EUR 825.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Kallikrein 6 (KLK6) ELISA Kit |
20-abx154284 |
Abbexa |
-
EUR 6642.00
-
EUR 3542.00
-
EUR 825.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Kallikrein 7 (KLK7) ELISA Kit |
20-abx154285 |
Abbexa |
-
EUR 7237.00
-
EUR 3855.00
-
EUR 895.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Kallikrein 1 (KLK1) ELISA Kit |
abx254835-96tests |
Abbexa |
96 tests |
EUR 746 |
- Shipped within 5-12 working days.
|
ELISA kit for Mouse Kallikrein-1 |
EK2485 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Kallikrein-1 in samples from serum, plasma, tissue homogenates and other biological fluids. |
Mouse Klk1/ Kallikrein-1 ELISA Kit |
E0835Mo |
Sunlong |
1 Kit |
EUR 571 |
Mouse Klk7/ Kallikrein-7 ELISA Kit |
E0837Mo |
Sunlong |
1 Kit |
EUR 571 |
Mouse Klk8/ Kallikrein-8 ELISA Kit |
E0838Mo |
Sunlong |
1 Kit |
EUR 571 |
Mouse Kallikrein 1 (KLK1) ELISA Kit |
CEA967Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4391.16 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 1 (KLK1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 1 (KLK1) in serum, plasma and other biological fluids. |
Mouse Kallikrein 1 (KLK1) ELISA Kit |
CEA967Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 449.27 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 1 (KLK1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 1 (KLK1) in serum, plasma and other biological fluids. |
Mouse Kallikrein 1 (KLK1) ELISA Kit |
CEA967Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 598.96 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 1 (KLK1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 1 (KLK1) in serum, plasma and other biological fluids. |
Mouse Kallikrein 1 (KLK1) ELISA Kit |
CEA967Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2395.32 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 1 (KLK1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 1 (KLK1) in serum, plasma and other biological fluids. |
Mouse Kallikrein 1 (KLK1) ELISA Kit |
4-CEA967Mu |
Cloud-Clone |
-
EUR 4442.00
-
EUR 2346.00
-
EUR 599.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Kallikrein 1 elisa. Alternative names of the recognized antigen: KLKR
- Klk6
- HK1
- Kallikrein 1, Renal/Pancreas/Salivary
- Kidney/pancreas/salivary gland kallikrein
- Tissue kallikrein
|
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Mouse Kallikrein 1 (KLK1) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species. |
Mouse Kallikrein-1(KLK1) ELISA kit |
CSB-EL012446MO-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Kallikrein-1 (KLK1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Mouse Kallikrein-1(KLK1) ELISA kit |
1-CSB-EL012446MO |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Kallikrein-1(KLK1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Mouse Kallikrein-14(KLK14) ELISA kit |
CSB-EL012451MO-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Kallikrein-14 (KLK14) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Mouse Kallikrein-14(KLK14) ELISA kit |
1-CSB-EL012451MO |
Cusabio |
-
EUR 703.00
-
EUR 4843.00
-
EUR 2570.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Kallikrein-14(KLK14) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Mouse plasma kallikrein(KLKB1) ELISA Kit |
CSB-E16637m-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse plasma kallikrein (KLKB1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Mouse plasma kallikrein(KLKB1) ELISA Kit |
1-CSB-E16637m |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse plasma kallikrein(KLKB1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Mouse Kallikrein 7 (KLK7) ELISA Kit |
abx571173-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Mouse Kallikrein 4 (KLK4) ELISA Kit |
abx572102-96tests |
Abbexa |
96 tests |
EUR 801 |
- Shipped within 5-12 working days.
|
Mouse Kallikrein 1 (KLK1) ELISA Kit |
abx575068-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Mouse Kallikrein 11 (KLK11) ELISA Kit |
abx513661-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Mouse Kallikrein 8 (KLK8) ELISA Kit |
abx513720-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Mouse Klk1(Kallikrein-1) ELISA Kit |
EM0483 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: P15947
- Alias: Klk1/Kallikrein-1/Kidney/pancreas/salivary gland kallikrein/Tissue kallikrein
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml |
Mouse Kallikrein 7 (KLK7) ELISA Kit |
SEB910Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4626.78 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 7 (KLK7) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 7 (KLK7) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse Kallikrein 7 (KLK7) ELISA Kit |
SEB910Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 468.68 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 7 (KLK7) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 7 (KLK7) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse Kallikrein 7 (KLK7) ELISA Kit |
SEB910Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 626.68 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 7 (KLK7) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 7 (KLK7) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse Kallikrein 7 (KLK7) ELISA Kit |
SEB910Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2520.06 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 7 (KLK7) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 7 (KLK7) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse Kallikrein 7 (KLK7) ELISA Kit |
4-SEB910Mu |
Cloud-Clone |
-
EUR 4677.00
-
EUR 2471.00
-
EUR 627.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Kallikrein 7 elisa. Alternative names of the recognized antigen: PRSS6
- SCCE
- hK7
- Kallikrein-Related Peptidase 7
- Serine protease 6
- Stratum corneum chymotryptic enzyme
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Kallikrein 7 (KLK7) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Mouse Kallikrein 6 (KLK6) ELISA Kit |
SEA691Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4391.16 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 6 (KLK6) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 6 (KLK6) in serum, plasma, cerebrospinal fluid, breast milk and other biological fluids. |
Mouse Kallikrein 6 (KLK6) ELISA Kit |
SEA691Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 449.27 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 6 (KLK6) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 6 (KLK6) in serum, plasma, cerebrospinal fluid, breast milk and other biological fluids. |
Mouse Kallikrein 6 (KLK6) ELISA Kit |
SEA691Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 598.96 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 6 (KLK6) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 6 (KLK6) in serum, plasma, cerebrospinal fluid, breast milk and other biological fluids. |
Mouse Kallikrein 6 (KLK6) ELISA Kit |
SEA691Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2395.32 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 6 (KLK6) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 6 (KLK6) in serum, plasma, cerebrospinal fluid, breast milk and other biological fluids. |
Mouse Kallikrein 6 (KLK6) ELISA Kit |
4-SEA691Mu |
Cloud-Clone |
-
EUR 4442.00
-
EUR 2346.00
-
EUR 599.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Kallikrein 6 elisa. Alternative names of the recognized antigen: ZYME
- Bssp
- Klk7
- Neurosin, Zyme
- PRSS18
- PRSS9
- SP59
- HK6
- Protease M
- Serine protease 18
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Kallikrein 6 (KLK6) in samples from serum, plasma, cerebrospinal fluid, breast milk and other biological fluids with no significant corss-reactivity with analogues from other species. |
Mouse Kallikrein 5 (KLK5) ELISA Kit |
SEA451Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4391.16 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 5 (KLK5) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 5 (KLK5) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse Kallikrein 5 (KLK5) ELISA Kit |
SEA451Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 449.27 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 5 (KLK5) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 5 (KLK5) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse Kallikrein 5 (KLK5) ELISA Kit |
SEA451Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 598.96 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 5 (KLK5) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 5 (KLK5) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse Kallikrein 5 (KLK5) ELISA Kit |
SEA451Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2395.32 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 5 (KLK5) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 5 (KLK5) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse Kallikrein 5 (KLK5) ELISA Kit |
4-SEA451Mu |
Cloud-Clone |
-
EUR 4442.00
-
EUR 2346.00
-
EUR 599.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Kallikrein 5 elisa. Alternative names of the recognized antigen: KLK-L2
- KLKL2
- SCTE
- Kallikrein-Related Peptidase 5
- Kallikrein-like protein 2
- Stratum corneum tryptic enzyme
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Kallikrein 5 (KLK5) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Mouse Kallikrein 3 (KLK3) ELISA Kit |
SEA151Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4391.16 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 3 (KLK3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 3 (KLK3) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse Kallikrein 3 (KLK3) ELISA Kit |
SEA151Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 449.27 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 3 (KLK3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 3 (KLK3) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse Kallikrein 3 (KLK3) ELISA Kit |
SEA151Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 598.96 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 3 (KLK3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 3 (KLK3) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse Kallikrein 3 (KLK3) ELISA Kit |
SEA151Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2395.32 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 3 (KLK3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 3 (KLK3) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse Kallikrein 3 (KLK3) ELISA Kit |
4-SEA151Mu |
Cloud-Clone |
-
EUR 4442.00
-
EUR 2346.00
-
EUR 599.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Kallikrein 3 elisa. Alternative names of the recognized antigen: APS
- KLK2A1
- PSA
- HK3
- KLKB1
- Seminin
- Prostate Specific Antigen
- Kallikrein-Related Peptidase 3
- Semenogelase, g-Seminoprotein
- P-30 Antigen
- Plasma kallikrein
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Kallikrein 3 (KLK3) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Mouse Kallikrein 1 (KLK1) ELISA Kit |
RDR-KLK1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 465 |
Mouse Kallikrein 1 (KLK1) ELISA Kit |
RDR-KLK1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 643 |
Mouse Kallikrein 3 (KLK3) ELISA Kit |
RDR-KLK3-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Mouse Kallikrein 3 (KLK3) ELISA Kit |
RDR-KLK3-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Mouse Kallikrein 4 (KLK4) ELISA Kit |
RDR-KLK4-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Mouse Kallikrein 4 (KLK4) ELISA Kit |
RDR-KLK4-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Mouse Kallikrein 5 (KLK5) ELISA Kit |
RDR-KLK5-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Mouse Kallikrein 5 (KLK5) ELISA Kit |
RDR-KLK5-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Mouse Kallikrein 6 (KLK6) ELISA Kit |
RDR-KLK6-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Mouse Kallikrein 6 (KLK6) ELISA Kit |
RDR-KLK6-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Mouse Kallikrein 7 (KLK7) ELISA Kit |
RDR-KLK7-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 534 |
Mouse Kallikrein 7 (KLK7) ELISA Kit |
RDR-KLK7-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 742 |
Mouse Kallikrein 1 ELISA Kit (KLK1) |
RK02972 |
Abclonal |
96 Tests |
EUR 521 |
Mouse Kallikrein 5 ELISA Kit (KLK5) |
RK02973 |
Abclonal |
96 Tests |
EUR 521 |
Mouse Kallikrein 6 ELISA Kit (KLK6) |
RK02974 |
Abclonal |
96 Tests |
EUR 521 |
Mouse Kallikrein 7 ELISA Kit (KLK7) |
RK02975 |
Abclonal |
96 Tests |
EUR 521 |
Mouse Kallikrein 1 (KLK1) ELISA Kit |
RD-KLK1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 446 |
Mouse Kallikrein 1 (KLK1) ELISA Kit |
RD-KLK1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 615 |
Mouse Kallikrein 3 (KLK3) ELISA Kit |
RD-KLK3-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 489 |
Mouse Kallikrein 3 (KLK3) ELISA Kit |
RD-KLK3-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 677 |
Mouse Kallikrein 4 (KLK4) ELISA Kit |
RD-KLK4-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 489 |
Mouse Kallikrein 4 (KLK4) ELISA Kit |
RD-KLK4-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 677 |
Mouse Kallikrein 5 (KLK5) ELISA Kit |
RD-KLK5-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 489 |
Mouse Kallikrein 5 (KLK5) ELISA Kit |
RD-KLK5-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 677 |
Mouse Kallikrein 6 (KLK6) ELISA Kit |
RD-KLK6-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 489 |
Mouse Kallikrein 6 (KLK6) ELISA Kit |
RD-KLK6-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 677 |
Mouse Kallikrein 7 (KLK7) ELISA Kit |
RD-KLK7-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Mouse Kallikrein 7 (KLK7) ELISA Kit |
RD-KLK7-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
ELISA kit for Mouse IL-13 (Interleukin 13) |
E-EL-M0727 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's IL-13 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse IL-13. Standards or samples are added to the micro ELISA plate wells and combined with
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Mouse IL-13 (Interleukin 13) in samples from Serum, Plasma, Cell supernatant |
Mouse matrix metalloproteinase 13, MMP-13 ELISA kit |
CSB-E07413m-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse matrix metalloproteinase 13, MMP-13 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Mouse matrix metalloproteinase 13, MMP-13 ELISA kit |
1-CSB-E07413m |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse matrix metalloproteinase 13, MMP-13 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Mouse matrix metalloproteinase 13,MMP-13 ELISA kit |
CN-02370M1 |
ChemNorm |
96T |
EUR 451 |
Mouse matrix metalloproteinase 13,MMP-13 ELISA kit |
CN-02370M2 |
ChemNorm |
48T |
EUR 300 |
Mouse MMP-13(Matrix Metalloproteinase 13) ELISA Kit |
EM0303 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 78.125-5000 pg/ml
- Uniprot ID: P33435
- Alias: MMP-13/MMP-13
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 46.875pg/ml |
Mouse matrix metalloproteinase 13(MMP-13)ELISA Kit |
GA-E0081MS-48T |
GenAsia Biotech |
48T |
EUR 336 |
Mouse matrix metalloproteinase 13(MMP-13)ELISA Kit |
GA-E0081MS-96T |
GenAsia Biotech |
96T |
EUR 534 |
Klk13 ORF Vector (Mouse) (pORF) |
ORF048698 |
ABM |
1.0 ug DNA |
EUR 506 |
Klkb1 ELISA Kit| Mouse Plasma kallikrein ELISA Kit |
EF015313 |
Lifescience Market |
96 Tests |
EUR 689 |
Mouse Apelin 13 ELISA kit |
E03A0036-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Apelin 13 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Apelin 13 ELISA kit |
E03A0036-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Apelin 13 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Apelin 13 ELISA kit |
E03A0036-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Apelin 13 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Interleukin 13 ELISA kit |
E03I0036-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Interleukin 13 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Interleukin 13 ELISA kit |
E03I0036-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Interleukin 13 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Interleukin 13 ELISA kit |
E03I0036-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Interleukin 13 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse CytoKeratin 13 ELISA kit |
E03C0759-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse CytoKeratin 13 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse CytoKeratin 13 ELISA kit |
E03C0759-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse CytoKeratin 13 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse CytoKeratin 13 ELISA kit |
E03C0759-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse CytoKeratin 13 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Apelin -13 ELISA Kit |
EMA0043 |
Abclonal |
96Tests |
EUR 521 |
Mouse CK 13 ELISA Kit |
EMC0766 |
Abclonal |
96Tests |
EUR 521 |
Mouse IL-13 ELISA Kit |
EMI0043 |
Abclonal |
96Tests |
EUR 521 |
Mouse MMP-13 ELISA Kit |
EMM0309 |
Abclonal |
96Tests |
EUR 521 |
Mouse IL-13 ELISA kit |
LF-EK50193 |
Abfrontier |
1×96T |
EUR 659 |
Mouse IL-13 ELISA Kit |
RK00107 |
Abclonal |
96 Tests |
EUR 521 |
KLK13 Rabbit pAb |
A14274-100ul |
Abclonal |
100 ul |
EUR 308 |
KLK13 Rabbit pAb |
A14274-200ul |
Abclonal |
200 ul |
EUR 459 |
KLK13 Rabbit pAb |
A14274-20ul |
Abclonal |
20 ul |
EUR 183 |
KLK13 Rabbit pAb |
A14274-50ul |
Abclonal |
50 ul |
EUR 223 |
KLK13 Blocking Peptide |
33R-9689 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KLK13 antibody, catalog no. 70R-3265 |
KLK13 cloning plasmid |
CSB-CL891952HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 834
- Sequence: atgtggcccctggccctagtgatcgcctccctgaccttggccttgtcaggaggtgtctcccaggagtcttccaaggttctcaacaccaatgggaccagtgggtttctcccaggtggctacacctgcttcccccactctcagccctggcaggctgccctactagtgcaagggcggct
- Show more
|
Description: A cloning plasmid for the KLK13 gene. |
KLK13 Conjugated Antibody |
C36578 |
SAB |
100ul |
EUR 397 |
KLK13 Polyclonal Antibody |
ABP59062-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human KLK13 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of KLK13 from Human. This KLK13 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KLK13 protein |
KLK13 Polyclonal Antibody |
ABP59062-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human KLK13 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of KLK13 from Human. This KLK13 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KLK13 protein |
KLK13 Polyclonal Antibody |
ABP59062-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human KLK13 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of KLK13 from Human. This KLK13 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KLK13 protein |
KLK13 Polyclonal Antibody |
ES11092-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against KLK13 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
KLK13 Polyclonal Antibody |
ES11092-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against KLK13 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Anti-KLK13 antibody |
STJ116486 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Expression of this gene is regulated by steroid hormones and may be useful as a marker for breast cancer. An additional transcript variant has been identified, but its full length sequence has not been determined. |
Anti-KLK13 antibody |
STJ192250 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to KLK13 |
ELISA kit for Mouse MMP-13 (Matrix Metalloproteinase 13) |
E-EL-M0076 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's MMP-13 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse MMP-13. Standards or samples are added to the micro ELISA plate wells and combined wit
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Mouse MMP-13 (Matrix Metalloproteinase 13) in samples from Serum, Plasma, Cell supernatant |