Mouse KLK13(Kallikrein 13) ELISA Kit

Mouse KLK13(Kallikrein 13) ELISA Kit

To Order Contact us:  Mark@operatiebrp.nl

Mouse Kallikrein 13 (KLK13) ELISA Kit

RDR-KLK13-Mu-48Tests 48 Tests
EUR 557

Mouse Kallikrein 13 (KLK13) ELISA Kit

RDR-KLK13-Mu-96Tests 96 Tests
EUR 774

Human Kallikrein 13 (KLK13) ELISA Kit

DLR-KLK13-Hu-48T 48T
EUR 517
  • Should the Human Kallikrein 13 (KLK13) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Kallikrein 13 (KLK13) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Kallikrein 13 (KLK13) ELISA Kit

DLR-KLK13-Hu-96T 96T
EUR 673
  • Should the Human Kallikrein 13 (KLK13) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Kallikrein 13 (KLK13) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Kallikrein 13 (KLK13) ELISA Kit

RD-KLK13-Hu-48Tests 48 Tests
EUR 521

Human Kallikrein 13 (KLK13) ELISA Kit

RD-KLK13-Hu-96Tests 96 Tests
EUR 723

Human Kallikrein 13 (KLK13) ELISA Kit

RDR-KLK13-Hu-48Tests 48 Tests
EUR 544

Human Kallikrein 13 (KLK13) ELISA Kit

RDR-KLK13-Hu-96Tests 96 Tests
EUR 756

Mouse Kallikrein 13 (KLK13) ELISA Kit

20-abx154281
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Kallikrein 13 (KLK13) ELISA Kit

SED373Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Mouse Kallikrein 13 (KLK13) ELISA Kit

SED373Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Mouse Kallikrein 13 (KLK13) ELISA Kit

SED373Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Mouse Kallikrein 13 (KLK13) ELISA Kit

SED373Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Mouse Kallikrein 13 (KLK13) ELISA Kit

4-SED373Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Kallikrein 13 elisa. Alternative names of the recognized antigen: KLK-L4
  • KLKL4
  • Kallikrein-like protein 4
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Kallikrein 13 (KLK13) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Kallikrein 13 (KLK13) Protein

20-abx168449
  • EUR 718.00
  • EUR 286.00
  • EUR 2221.00
  • EUR 857.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Kallikrein 13 (KLK13) CLIA Kit

20-abx494239
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Mouse KLK13 (Kallikrein 13)

ELK7224 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Kallikrein 13 (KLK13). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Kallikrein 1
  • Show more
Description: A sandwich ELISA kit for detection of Kallikrein 13 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Kallikrein 13 (KLK13) Antibody

20-abx129211
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Kallikrein 13 (KLK13) Antibody

20-abx129912
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Kallikrein 13 (KLK13) Antibody

20-abx173224
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Kallikrein 13 (KLK13) Antibody

20-abx177245
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Kallikrein 13 (KLK13) Antibody

20-abx177246
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Kallikrein 13 (KLK13) Antibody

20-abx339236
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Kallikrein 13 (KLK13) Antibody

20-abx210856
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Recombinant Kallikrein 13 (KLK13)

4-RPD373Hu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9UKR3
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 32.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Kallikrein 13 expressed in: E.coli

Recombinant Kallikrein 13 (KLK13)

4-RPD373Mu01
  • EUR 512.16
  • EUR 240.00
  • EUR 1645.60
  • EUR 615.20
  • EUR 1130.40
  • EUR 406.00
  • EUR 3964.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P36368
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Kallikrein 13 expressed in: E.coli

Human Kallikrein- 13, KLK13 ELISA KIT

ELI-43303h 96 Tests
EUR 824

Human Kallikrein 13 (KLK13) ELISA Kit

20-abx152086
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Kallikrein 13(KLK13)ELISA Kit

QY-E02952 96T
EUR 361

Human Kallikrein 13 (KLK13) ELISA Kit

SED373Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Kallikrein 13 (KLK13) ELISA Kit

SED373Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Kallikrein 13 (KLK13) ELISA Kit

SED373Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Kallikrein 13 (KLK13) ELISA Kit

SED373Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Kallikrein 13 (KLK13) ELISA Kit

4-SED373Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Kallikrein 13 elisa. Alternative names of the recognized antigen: KLK-L4
  • KLKL4
  • Kallikrein-like protein 4
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Kallikrein 13 (KLK13) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Human KLK13 (Kallikrein 13)

ELK4917 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Kallikrein 13 (KLK13). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Kallikrein 1
  • Show more
Description: A sandwich ELISA kit for detection of Kallikrein 13 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Kallikrein-13 (KLK13)

KTE61899-48T 48T
EUR 332
  • Kallikrein-13 is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Expression of this gene is regulated by steroid hormones and may be useful as a marker for breast cancer. An additional transcript variant has bee
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Kallikrein-13 (KLK13) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Kallikrein-13 (KLK13)

KTE61899-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Kallikrein-13 is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Expression of this gene is regulated by steroid hormones and may be useful as a marker for breast cancer. An additional transcript variant has bee
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Kallikrein-13 (KLK13) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Kallikrein-13 (KLK13)

KTE61899-96T 96T
EUR 539
  • Kallikrein-13 is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Expression of this gene is regulated by steroid hormones and may be useful as a marker for breast cancer. An additional transcript variant has bee
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Kallikrein-13 (KLK13) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Kallikrein 13 (KLK13) CLIA Kit

20-abx494238
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Kallikrein 13 (KLK13) polyclonal antibody

ABP-PAB-10239 100 ug Ask for price
    • Product line: Miscellaneous
    • Brand:

Human Kallikrein 13 (KLK13) Protein

20-abx167044
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

OVA conjugated Kallikrein 13 (KLK13)

4-CPD373Hu21
  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9UKR3
  • Buffer composition: PBS, pH 7.4.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): Inquire
  • Isoelectric Point: Inquire
Description: Recombinant Human Kallikrein 13 expressed in: chemical synthesis

KLK13 Kallikrein-13 Human Recombinant Protein

PROTQ9UKR3 Regular: 5ug
EUR 317
Description: KLK13 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 284 amino acids (17-277 a.a) and having a molecular mass of 31.3kDa.;KLK13 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human)

4-PAD373Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK13 (Glu22~Gln277)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13)

Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat)

4-PAD373Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK13 (Val25~Ala261)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13)

Polyclonal KLK13 / Kallikrein 13 Antibody (aa262-277)

APR02667G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KLK13 / Kallikrein 13 (aa262-277). This antibody is tested and proven to work in the following applications:

Recombinant Human Kallikrein 13/KLK13 (C-6His)

C362-10ug 10ug
EUR 202
Description: Supplied as a 0.2 μm filtered solution of 20mM MES, 150mM NaCl, 10% Glycerol, pH 5.5.

Recombinant Human Kallikrein 13/KLK13 (C-6His)

C362-1mg 1mg
EUR 2283
Description: Supplied as a 0.2 μm filtered solution of 20mM MES, 150mM NaCl, 10% Glycerol, pH 5.5.

Recombinant Human Kallikrein 13/KLK13 (C-6His)

C362-500ug 500ug
EUR 1613
Description: Supplied as a 0.2 μm filtered solution of 20mM MES, 150mM NaCl, 10% Glycerol, pH 5.5.

Recombinant Human Kallikrein 13/KLK13 (C-6His)

C362-50ug 50ug
EUR 496
Description: Supplied as a 0.2 μm filtered solution of 20mM MES, 150mM NaCl, 10% Glycerol, pH 5.5.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human), APC

4-PAD373Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK13 (Glu22~Gln277)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13). This antibody is labeled with APC.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human), Biotinylated

4-PAD373Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK13 (Glu22~Gln277)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13). This antibody is labeled with Biotin.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human), Cy3

4-PAD373Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK13 (Glu22~Gln277)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13). This antibody is labeled with Cy3.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human), FITC

4-PAD373Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK13 (Glu22~Gln277)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13). This antibody is labeled with FITC.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human), HRP

4-PAD373Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK13 (Glu22~Gln277)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13). This antibody is labeled with HRP.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human), PE

4-PAD373Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK13 (Glu22~Gln277)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13). This antibody is labeled with PE.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat), APC

4-PAD373Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK13 (Val25~Ala261)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13). This antibody is labeled with APC.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat), Biotinylated

4-PAD373Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK13 (Val25~Ala261)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13). This antibody is labeled with Biotin.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat), Cy3

4-PAD373Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK13 (Val25~Ala261)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13). This antibody is labeled with Cy3.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat), FITC

4-PAD373Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK13 (Val25~Ala261)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13). This antibody is labeled with FITC.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat), HRP

4-PAD373Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK13 (Val25~Ala261)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13). This antibody is labeled with HRP.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat), PE

4-PAD373Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK13 (Val25~Ala261)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13). This antibody is labeled with PE.

KLK13 Human, Kallikrein-13 Human Recombinant Protein, sf9

PROTQ9UKR3-1 Regular: 5ug
EUR 317
Description: KLK13 produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 267 amino acids (17-277a.a.) and having a molecular mass of 29.7kDa. (Molecular size on SDS-PAGE will appear at approximately 28-40kDa). KLK13 is expressed with a 6 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human), APC-Cy7

4-PAD373Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK13 (Glu22~Gln277)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13). This antibody is labeled with APC-Cy7.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat), APC-Cy7

4-PAD373Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK13 (Val25~Ala261)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13). This antibody is labeled with APC-Cy7.

99445-13 DCT 13 X 100MM

99445-13 250/pk
EUR 76
Description: Disposable Culture Tubes; DCT's, CGW

anti-Kallikrein 13

YF-PA18203 50 ul
EUR 363
Description: Mouse polyclonal to Kallikrein 13

99999 CAP 13-415

99999-13 1000/pk
EUR 219
Description: Disposable Screw Cap Culture Tubes; DSCCT's, Caps

9998 SCREW CAP 415/13

9998-13 288/pk
EUR 198
Description: General Apparatus; Stoppers

Kallikrein 13 Protein (OVA)

20-abx165562
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Anti-Kallikrein 13 (1G9)

YF-MA18049 100 ug
EUR 363
Description: Mouse monoclonal to Kallikrein 13

99447 DSSCT 13 X 100MM W/ MARING SPOT

99447-13 250/pk
EUR 332
Description: Disposable Screw Cap Culture Tubes; DSCCT's, Lab Stock

99449 DSSCT 13 X 100MM W/O MARKING SPOT

99449-13 250/pk
EUR 281
Description: Disposable Screw Cap Culture Tubes; DSCCT's, Lab Stock

ELISA kit for Human KLK13

EK5504 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human KLK13 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human KLK13 PicoKine ELISA Kit

EK1168 96 wells
EUR 425
Description: For quantitative detection of human KLK13 in cell culture supernates, cell lysates, serum and plasma(heparin, EDTA).

CA199 (Cancer antigen) ELISA test

13 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of CA199 (Cancer antigen)

Human CellExp? Kallikrein-13, human recombinant

7413-10
EUR 278

Mouse KalliKrein 1 ELISA kit

E03K0026-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse KalliKrein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse KalliKrein 1 ELISA kit

E03K0026-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse KalliKrein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse KalliKrein 1 ELISA kit

E03K0026-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse KalliKrein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Kallikrein 10 ELISA kit

E03K0070-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Kallikrein 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Kallikrein 10 ELISA kit

E03K0070-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Kallikrein 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Kallikrein 10 ELISA kit

E03K0070-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Kallikrein 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Kallikrein 11 ELISA kit

E03K0072-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Kallikrein 11 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Kallikrein 11 ELISA kit

E03K0072-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Kallikrein 11 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Kallikrein 11 ELISA kit

E03K0072-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Kallikrein 11 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Kallikrein 6 ELISA kit

E03K0073-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Kallikrein 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Kallikrein 6 ELISA kit

E03K0073-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Kallikrein 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Kallikrein 6 ELISA kit

E03K0073-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Kallikrein 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Kallikrein 7 ELISA kit

E03K0074-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Kallikrein 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Kallikrein 7 ELISA kit

E03K0074-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Kallikrein 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Kallikrein 7 ELISA kit

E03K0074-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Kallikrein 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Kallikrein 8 ELISA kit

E03K0075-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Kallikrein 8 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Kallikrein 8 ELISA kit

E03K0075-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Kallikrein 8 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Kallikrein 8 ELISA kit

E03K0075-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Kallikrein 8 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Kallikrein 2 ELISA kit

E03K0077-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Kallikrein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Kallikrein 2 ELISA kit

E03K0077-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Kallikrein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Kallikrein 2 ELISA kit

E03K0077-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Kallikrein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Kallikrein 3 ELISA kit

E03K0078-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Kallikrein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Kallikrein 3 ELISA kit

E03K0078-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Kallikrein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Kallikrein 3 ELISA kit

E03K0078-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Kallikrein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Kallikrein 5 ELISA kit

E03K0079-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Kallikrein 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Kallikrein 5 ELISA kit

E03K0079-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Kallikrein 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Kallikrein 5 ELISA kit

E03K0079-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Kallikrein 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Kallikrein 2 ELISA Kit

ELA-E0278m 96 Tests
EUR 865

Mouse Kallikrein 1 ELISA Kit

ELA-E0967m 96 Tests
EUR 865

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

KLK13 Recombinant Protein (Mouse)

RP146090 100 ug Ask for price

IL-13 ELISA Kit| Mouse Interleukin 13 ELISA Kit

EF012875 96 Tests
EUR 689

KLK13 siRNA

20-abx921819
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

KLK13 protein

80R-4293 20 ug
EUR 327
Description: Purified Recombinant KLK13 protein (His tagged)

KLK13 antibody

70R-3265 50 ug
EUR 467
Description: Rabbit polyclonal KLK13 antibody raised against the middle region of KLK13

KLK13 Antibody

36578-100ul 100ul
EUR 252

KLK13 Antibody

1-CSB-PA374084
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KLK13. Recognizes KLK13 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

KLK13 Antibody

1-CSB-PA185718
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KLK13. Recognizes KLK13 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

Mouse Interleukin 13(IL-13)ELISA Kit    

GA-E0041MS-48T 48T
EUR 336

Mouse Interleukin 13(IL-13)ELISA Kit    

GA-E0041MS-96T 96T
EUR 534

Mouse IL-13(Interleukin 13) ELISA Kit

EM0103 96T
EUR 476.25
  • Detection range: 31.25-2000 pg/ml
  • Uniprot ID: P20109
  • Alias: Interleukin-13,T-cell activation protein P600,Il-13
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 18.75pg/ml

Mouse Interleukin 13, IL-13 ELISA Kit

CSB-E04602m-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Interleukin 13, IL-13 in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Interleukin 13, IL-13 ELISA Kit

1-CSB-E04602m
  • EUR 603.00
  • EUR 4247.00
  • EUR 2260.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Interleukin 13, IL-13 in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Interleukin 13,IL-13 ELISA Kit

CN-02456M1 96T
EUR 447

Mouse Interleukin 13,IL-13 ELISA Kit

CN-02456M2 48T
EUR 296

Mouse Interleukin 13(IL-13)ELISA Kit

QY-E20834 96T
EUR 361

MMP-13 ELISA Kit| Mouse Matrix Metalloproteinase 13 ELISA Kit

EF012983 96 Tests
EUR 689

Mouse Kallikrein 1 (KLK1) ELISA Kit

CEA967Mu-10x96wellstestplate 10x96-wells test plate
EUR 4391.16
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 1 (KLK1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 1 (KLK1) in serum, plasma and other biological fluids.

Mouse Kallikrein 1 (KLK1) ELISA Kit

CEA967Mu-1x48wellstestplate 1x48-wells test plate
EUR 449.27
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 1 (KLK1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 1 (KLK1) in serum, plasma and other biological fluids.

Mouse Kallikrein 1 (KLK1) ELISA Kit

CEA967Mu-1x96wellstestplate 1x96-wells test plate
EUR 598.96
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 1 (KLK1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 1 (KLK1) in serum, plasma and other biological fluids.

Mouse Kallikrein 1 (KLK1) ELISA Kit

CEA967Mu-5x96wellstestplate 5x96-wells test plate
EUR 2395.32
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 1 (KLK1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 1 (KLK1) in serum, plasma and other biological fluids.

Mouse Kallikrein 1 (KLK1) ELISA Kit

4-CEA967Mu
  • EUR 4442.00
  • EUR 2346.00
  • EUR 599.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Kallikrein 1 elisa. Alternative names of the recognized antigen: KLKR
  • Klk6
  • HK1
  • Kallikrein 1, Renal/Pancreas/Salivary
  • Kidney/pancreas/salivary gland kallikrein
  • Tissue kallikrein
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Mouse Kallikrein 1 (KLK1) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Kallikrein 11 (KLK11) ELISA Kit

abx513661-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Kallikrein 8 (KLK8) ELISA Kit

abx513720-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Kallikrein 7 (KLK7) ELISA Kit

abx571173-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Kallikrein 4 (KLK4) ELISA Kit

abx572102-96tests 96 tests
EUR 801
  • Shipped within 5-12 working days.

Mouse Kallikrein 1 (KLK1) ELISA Kit

abx575068-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse plasma kallikrein(KLKB1) ELISA kit

E03P0813-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse plasma kallikrein(KLKB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse plasma kallikrein(KLKB1) ELISA kit

E03P0813-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse plasma kallikrein(KLKB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse plasma kallikrein(KLKB1) ELISA kit

E03P0813-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse plasma kallikrein(KLKB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Mouse Kallikrein-1

EK2485 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Kallikrein-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Mouse Klk1/ Kallikrein-1 ELISA Kit

E0835Mo 1 Kit
EUR 571

Mouse Klk7/ Kallikrein-7 ELISA Kit

E0837Mo 1 Kit
EUR 571

Mouse Klk8/ Kallikrein-8 ELISA Kit

E0838Mo 1 Kit
EUR 571

Mouse Plasma kallikrein, Klkb1 ELISA KIT

ELI-21316m 96 Tests
EUR 865

Mouse Kallikrein- 11, Klk11 ELISA KIT

ELI-02338m 96 Tests
EUR 865

Mouse Kallikrein- 8, Klk8 ELISA KIT

ELI-02398m 96 Tests
EUR 865

Mouse Kallikrein- 1, Klk1 ELISA KIT

ELI-03135m 96 Tests
EUR 865

Mouse Kallikrein- 7, Klk7 ELISA KIT

ELI-06138m 96 Tests
EUR 865

Mouse Kallikrein- 14, Klk14 ELISA KIT

ELI-37244m 96 Tests
EUR 865

Mouse Klk1(Kallikrein-1) ELISA Kit

EM0483 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P15947
  • Alias: Klk1/Kallikrein-1/Kidney/pancreas/salivary gland kallikrein/Tissue kallikrein
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml

Mouse Kallikrein 1 (KLK1) ELISA Kit

20-abx154280
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Kallikrein 3 (KLK3) ELISA Kit

20-abx154282
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Kallikrein 5 (KLK5) ELISA Kit

20-abx154283
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Kallikrein 6 (KLK6) ELISA Kit

20-abx154284
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Kallikrein 7 (KLK7) ELISA Kit

20-abx154285
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Kallikrein 1 (KLK1) ELISA Kit

abx254835-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.

Mouse Kallikrein 1 (KLK1) ELISA Kit

DLR-KLK1-Mu-48T 48T
EUR 450
  • Should the Mouse Kallikrein 1 (KLK1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Kallikrein 1 (KLK1) in samples from serum, plasma or other biological fluids.

Mouse Kallikrein 1 (KLK1) ELISA Kit

DLR-KLK1-Mu-96T 96T
EUR 582
  • Should the Mouse Kallikrein 1 (KLK1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Kallikrein 1 (KLK1) in samples from serum, plasma or other biological fluids.

Mouse Kallikrein 3 (KLK3) ELISA Kit

DLR-KLK3-Mu-48T 48T
EUR 489
  • Should the Mouse Kallikrein 3 (KLK3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Kallikrein 3 (KLK3) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Kallikrein 3 (KLK3) ELISA Kit

DLR-KLK3-Mu-96T 96T
EUR 635
  • Should the Mouse Kallikrein 3 (KLK3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Kallikrein 3 (KLK3) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Kallikrein 4 (KLK4) ELISA Kit

DLR-KLK4-Mu-48T 48T
EUR 489
  • Should the Mouse Kallikrein 4 (KLK4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Kallikrein 4 (KLK4) in samples from serum, plasma or other biological fluids.

Mouse Kallikrein 4 (KLK4) ELISA Kit

DLR-KLK4-Mu-96T 96T
EUR 635
  • Should the Mouse Kallikrein 4 (KLK4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Kallikrein 4 (KLK4) in samples from serum, plasma or other biological fluids.

Mouse Kallikrein 5 (KLK5) ELISA Kit

DLR-KLK5-Mu-48T 48T
EUR 489
  • Should the Mouse Kallikrein 5 (KLK5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Kallikrein 5 (KLK5) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Kallikrein 5 (KLK5) ELISA Kit

DLR-KLK5-Mu-96T 96T
EUR 635
  • Should the Mouse Kallikrein 5 (KLK5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Kallikrein 5 (KLK5) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Kallikrein 6 (KLK6) ELISA Kit

DLR-KLK6-Mu-48T 48T
EUR 489
  • Should the Mouse Kallikrein 6 (KLK6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Kallikrein 6 (KLK6) in samples from serum, plasma, cerebrospinal fluid, breast milk or other biological fluids.

Mouse Kallikrein 6 (KLK6) ELISA Kit

DLR-KLK6-Mu-96T 96T
EUR 635
  • Should the Mouse Kallikrein 6 (KLK6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Kallikrein 6 (KLK6) in samples from serum, plasma, cerebrospinal fluid, breast milk or other biological fluids.

Mouse Kallikrein 7 (KLK7) ELISA Kit

DLR-KLK7-Mu-48T 48T
EUR 508
  • Should the Mouse Kallikrein 7 (KLK7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Kallikrein 7 (KLK7) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Kallikrein 7 (KLK7) ELISA Kit

DLR-KLK7-Mu-96T 96T
EUR 661
  • Should the Mouse Kallikrein 7 (KLK7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Kallikrein 7 (KLK7) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse plasma kallikrein(KLKB1) ELISA Kit

CSB-E16637m-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse plasma kallikrein (KLKB1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse plasma kallikrein(KLKB1) ELISA Kit

1-CSB-E16637m
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse plasma kallikrein(KLKB1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Kallikrein-1(KLK1) ELISA kit

CSB-EL012446MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Kallikrein-1 (KLK1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Kallikrein-1(KLK1) ELISA kit

1-CSB-EL012446MO
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Kallikrein-1(KLK1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Kallikrein-14(KLK14) ELISA kit

CSB-EL012451MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Kallikrein-14 (KLK14) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Kallikrein-14(KLK14) ELISA kit

1-CSB-EL012451MO
  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Kallikrein-14(KLK14) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Kallikrein 7 (KLK7) ELISA Kit

SEB910Mu-10x96wellstestplate 10x96-wells test plate
EUR 4626.78
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 7 (KLK7) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 7 (KLK7) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Kallikrein 7 (KLK7) ELISA Kit

SEB910Mu-1x48wellstestplate 1x48-wells test plate
EUR 468.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 7 (KLK7) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 7 (KLK7) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Kallikrein 7 (KLK7) ELISA Kit

SEB910Mu-1x96wellstestplate 1x96-wells test plate
EUR 626.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 7 (KLK7) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 7 (KLK7) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Kallikrein 7 (KLK7) ELISA Kit

SEB910Mu-5x96wellstestplate 5x96-wells test plate
EUR 2520.06
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 7 (KLK7) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 7 (KLK7) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Kallikrein 7 (KLK7) ELISA Kit

4-SEB910Mu
  • EUR 4677.00
  • EUR 2471.00
  • EUR 627.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Kallikrein 7 elisa. Alternative names of the recognized antigen: PRSS6
  • SCCE
  • hK7
  • Kallikrein-Related Peptidase 7
  • Serine protease 6
  • Stratum corneum chymotryptic enzyme
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Kallikrein 7 (KLK7) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Kallikrein 6 (KLK6) ELISA Kit

SEA691Mu-10x96wellstestplate 10x96-wells test plate
EUR 4391.16
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 6 (KLK6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 6 (KLK6) in serum, plasma, cerebrospinal fluid, breast milk and other biological fluids.

Mouse Kallikrein 6 (KLK6) ELISA Kit

SEA691Mu-1x48wellstestplate 1x48-wells test plate
EUR 449.27
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 6 (KLK6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 6 (KLK6) in serum, plasma, cerebrospinal fluid, breast milk and other biological fluids.

Mouse Kallikrein 6 (KLK6) ELISA Kit

SEA691Mu-1x96wellstestplate 1x96-wells test plate
EUR 598.96
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 6 (KLK6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 6 (KLK6) in serum, plasma, cerebrospinal fluid, breast milk and other biological fluids.

Mouse Kallikrein 6 (KLK6) ELISA Kit

SEA691Mu-5x96wellstestplate 5x96-wells test plate
EUR 2395.32
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 6 (KLK6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 6 (KLK6) in serum, plasma, cerebrospinal fluid, breast milk and other biological fluids.

Mouse Kallikrein 6 (KLK6) ELISA Kit

4-SEA691Mu
  • EUR 4442.00
  • EUR 2346.00
  • EUR 599.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Kallikrein 6 elisa. Alternative names of the recognized antigen: ZYME
  • Bssp
  • Klk7
  • Neurosin, Zyme
  • PRSS18
  • PRSS9
  • SP59
  • HK6
  • Protease M
  • Serine protease 18
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Kallikrein 6 (KLK6) in samples from serum, plasma, cerebrospinal fluid, breast milk and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Kallikrein 5 (KLK5) ELISA Kit

SEA451Mu-10x96wellstestplate 10x96-wells test plate
EUR 4391.16
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 5 (KLK5) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 5 (KLK5) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Kallikrein 5 (KLK5) ELISA Kit

SEA451Mu-1x48wellstestplate 1x48-wells test plate
EUR 449.27
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 5 (KLK5) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 5 (KLK5) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Kallikrein 5 (KLK5) ELISA Kit

SEA451Mu-1x96wellstestplate 1x96-wells test plate
EUR 598.96
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 5 (KLK5) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 5 (KLK5) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Kallikrein 5 (KLK5) ELISA Kit

SEA451Mu-5x96wellstestplate 5x96-wells test plate
EUR 2395.32
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 5 (KLK5) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 5 (KLK5) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Kallikrein 5 (KLK5) ELISA Kit

4-SEA451Mu
  • EUR 4442.00
  • EUR 2346.00
  • EUR 599.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Kallikrein 5 elisa. Alternative names of the recognized antigen: KLK-L2
  • KLKL2
  • SCTE
  • Kallikrein-Related Peptidase 5
  • Kallikrein-like protein 2
  • Stratum corneum tryptic enzyme
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Kallikrein 5 (KLK5) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Kallikrein 3 (KLK3) ELISA Kit

SEA151Mu-10x96wellstestplate 10x96-wells test plate
EUR 4391.16
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 3 (KLK3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 3 (KLK3) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Kallikrein 3 (KLK3) ELISA Kit

SEA151Mu-1x48wellstestplate 1x48-wells test plate
EUR 449.27
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 3 (KLK3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 3 (KLK3) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Kallikrein 3 (KLK3) ELISA Kit

SEA151Mu-1x96wellstestplate 1x96-wells test plate
EUR 598.96
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 3 (KLK3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 3 (KLK3) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Kallikrein 3 (KLK3) ELISA Kit

SEA151Mu-5x96wellstestplate 5x96-wells test plate
EUR 2395.32
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 3 (KLK3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 3 (KLK3) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Kallikrein 3 (KLK3) ELISA Kit

4-SEA151Mu
  • EUR 4442.00
  • EUR 2346.00
  • EUR 599.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Kallikrein 3 elisa. Alternative names of the recognized antigen: APS
  • KLK2A1
  • PSA
  • HK3
  • KLKB1
  • Seminin
  • Prostate Specific Antigen
  • Kallikrein-Related Peptidase 3
  • Semenogelase, g-Seminoprotein
  • P-30 Antigen
  • Plasma kallikrein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Kallikrein 3 (KLK3) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Kallikrein 1 ELISA Kit (KLK1)

RK02972 96 Tests
EUR 521

Mouse Kallikrein 5 ELISA Kit (KLK5)

RK02973 96 Tests
EUR 521

Mouse Kallikrein 6 ELISA Kit (KLK6)

RK02974 96 Tests
EUR 521

Mouse Kallikrein 7 ELISA Kit (KLK7)

RK02975 96 Tests
EUR 521

Mouse Kallikrein 1 (KLK1) ELISA Kit

RD-KLK1-Mu-48Tests 48 Tests
EUR 446

Mouse Kallikrein 1 (KLK1) ELISA Kit

RD-KLK1-Mu-96Tests 96 Tests
EUR 615

Mouse Kallikrein 3 (KLK3) ELISA Kit

RD-KLK3-Mu-48Tests 48 Tests
EUR 489

Mouse Kallikrein 3 (KLK3) ELISA Kit

RD-KLK3-Mu-96Tests 96 Tests
EUR 677

Mouse Kallikrein 4 (KLK4) ELISA Kit

RD-KLK4-Mu-48Tests 48 Tests
EUR 489

Mouse Kallikrein 4 (KLK4) ELISA Kit

RD-KLK4-Mu-96Tests 96 Tests
EUR 677

Mouse Kallikrein 5 (KLK5) ELISA Kit

RD-KLK5-Mu-48Tests 48 Tests
EUR 489

Mouse Kallikrein 5 (KLK5) ELISA Kit

RD-KLK5-Mu-96Tests 96 Tests
EUR 677

Mouse Kallikrein 6 (KLK6) ELISA Kit

RD-KLK6-Mu-48Tests 48 Tests
EUR 489

Mouse Kallikrein 6 (KLK6) ELISA Kit

RD-KLK6-Mu-96Tests 96 Tests
EUR 677

Mouse Kallikrein 7 (KLK7) ELISA Kit

RD-KLK7-Mu-48Tests 48 Tests
EUR 511

Mouse Kallikrein 7 (KLK7) ELISA Kit

RD-KLK7-Mu-96Tests 96 Tests
EUR 709

Mouse Kallikrein 1 (KLK1) ELISA Kit

RDR-KLK1-Mu-48Tests 48 Tests
EUR 465

Mouse Kallikrein 1 (KLK1) ELISA Kit

RDR-KLK1-Mu-96Tests 96 Tests
EUR 643

Mouse Kallikrein 3 (KLK3) ELISA Kit

RDR-KLK3-Mu-48Tests 48 Tests
EUR 511

Mouse Kallikrein 3 (KLK3) ELISA Kit

RDR-KLK3-Mu-96Tests 96 Tests
EUR 709

Mouse Kallikrein 4 (KLK4) ELISA Kit

RDR-KLK4-Mu-48Tests 48 Tests
EUR 511

Mouse Kallikrein 4 (KLK4) ELISA Kit

RDR-KLK4-Mu-96Tests 96 Tests
EUR 709

Mouse Kallikrein 5 (KLK5) ELISA Kit

RDR-KLK5-Mu-48Tests 48 Tests
EUR 511

Mouse Kallikrein 5 (KLK5) ELISA Kit

RDR-KLK5-Mu-96Tests 96 Tests
EUR 709

Mouse Kallikrein 6 (KLK6) ELISA Kit

RDR-KLK6-Mu-48Tests 48 Tests
EUR 511

Mouse Kallikrein 6 (KLK6) ELISA Kit

RDR-KLK6-Mu-96Tests 96 Tests
EUR 709

Mouse Kallikrein 7 (KLK7) ELISA Kit

RDR-KLK7-Mu-48Tests 48 Tests
EUR 534

Mouse Kallikrein 7 (KLK7) ELISA Kit

RDR-KLK7-Mu-96Tests 96 Tests
EUR 742

Mouse Kallikrein-5(KLK5) ELISA kit

QY-E21646 96T
EUR 361

ELISA kit for Mouse IL-13 (Interleukin 13)

E-EL-M0727 1 plate of 96 wells
EUR 534
  • Gentaur's IL-13 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse IL-13. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse IL-13 (Interleukin 13) in samples from Serum, Plasma, Cell supernatant

Mouse matrix metalloproteinase 13(MMP-13)ELISA Kit

GA-E0081MS-48T 48T
EUR 336

Mouse matrix metalloproteinase 13(MMP-13)ELISA Kit

GA-E0081MS-96T 96T
EUR 534

Mouse MMP-13(Matrix Metalloproteinase 13) ELISA Kit

EM0303 96T
EUR 524.1
  • Detection range: 78.125-5000 pg/ml
  • Uniprot ID: P33435
  • Alias: MMP-13/MMP-13
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 46.875pg/ml

Mouse matrix metalloproteinase 13, MMP-13 ELISA kit

CSB-E07413m-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse matrix metalloproteinase 13, MMP-13 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse matrix metalloproteinase 13, MMP-13 ELISA kit

1-CSB-E07413m
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse matrix metalloproteinase 13, MMP-13 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse matrix metalloproteinase 13,MMP-13 ELISA kit

CN-02370M1 96T
EUR 451

Mouse matrix metalloproteinase 13,MMP-13 ELISA kit

CN-02370M2 48T
EUR 300

Mouse matrix metalloproteinase 13(MMP-13)ELISA Kit

QY-E20974 96T
EUR 361

Klk13 ORF Vector (Mouse) (pORF)

ORF048698 1.0 ug DNA
EUR 506

Klkb1 ELISA Kit| Mouse Plasma kallikrein ELISA Kit

EF015313 96 Tests
EUR 689

Klk1 ELISA Kit| Mouse Kallikrein-1 ELISA Kit

EF013119 96 Tests
EUR 689

Mouse CytoKeratin 13 ELISA kit

E03C0759-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse CytoKeratin 13 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse CytoKeratin 13 ELISA kit

E03C0759-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse CytoKeratin 13 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse CytoKeratin 13 ELISA kit

E03C0759-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse CytoKeratin 13 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Interleukin 13 ELISA kit

E03I0036-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Interleukin 13 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Interleukin 13 ELISA kit

E03I0036-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Interleukin 13 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Interleukin 13 ELISA kit

E03I0036-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Interleukin 13 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Apelin 13 ELISA kit

E03A0036-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Apelin 13 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Apelin 13 ELISA kit

E03A0036-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Apelin 13 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Apelin 13 ELISA kit

E03A0036-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Apelin 13 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse cytokeratin 13 ELISA Kit

ELA-E1875m 96 Tests
EUR 865

Mouse CK 13 ELISA Kit

EMC0766 96Tests
EUR 521

Mouse IL-13 ELISA Kit

EMI0043 96Tests
EUR 521

Mouse MMP-13 ELISA Kit

EMM0309 96Tests
EUR 521

Mouse Apelin -13 ELISA Kit

EMA0043 96Tests
EUR 521

Mouse IL-13 ELISA kit

LF-EK50193 1×96T
EUR 659

Mouse IL-13 ELISA Kit

RK00107 96 Tests
EUR 521

KLK13 Conjugated Antibody

C36578 100ul
EUR 397

KLK13 Polyclonal Antibody

ES11092-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against KLK13 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

KLK13 Polyclonal Antibody

ES11092-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against KLK13 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

KLK13 Polyclonal Antibody

ABP59062-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human KLK13 protein
  • Applications tips:
Description: A polyclonal antibody for detection of KLK13 from Human. This KLK13 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KLK13 protein

KLK13 Polyclonal Antibody

ABP59062-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human KLK13 protein
  • Applications tips:
Description: A polyclonal antibody for detection of KLK13 from Human. This KLK13 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KLK13 protein

KLK13 Polyclonal Antibody

ABP59062-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human KLK13 protein
  • Applications tips:
Description: A polyclonal antibody for detection of KLK13 from Human. This KLK13 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KLK13 protein

KLK13 Rabbit pAb

A14274-100ul 100 ul
EUR 308

KLK13 Rabbit pAb

A14274-200ul 200 ul
EUR 459

KLK13 Rabbit pAb

A14274-20ul 20 ul
EUR 183

KLK13 Rabbit pAb

A14274-50ul 50 ul
EUR 223

KLK13 Blocking Peptide

33R-9689 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KLK13 antibody, catalog no. 70R-3265

KLK13 cloning plasmid

CSB-CL891952HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 834
  • Sequence: atgtggcccctggccctagtgatcgcctccctgaccttggccttgtcaggaggtgtctcccaggagtcttccaaggttctcaacaccaatgggaccagtgggtttctcccaggtggctacacctgcttcccccactctcagccctggcaggctgccctactagtgcaagggcggct
  • Show more
Description: A cloning plasmid for the KLK13 gene.

Anti-KLK13 antibody

STJ116486 100 µl
EUR 277
Description: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Expression of this gene is regulated by steroid hormones and may be useful as a marker for breast cancer. An additional transcript variant has been identified, but its full length sequence has not been determined.

Anti-KLK13 antibody

STJ192250 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to KLK13

ELISA kit for Mouse MMP-13 (Matrix Metalloproteinase 13)

E-EL-M0076 1 plate of 96 wells
EUR 534
  • Gentaur's MMP-13 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse MMP-13. Standards or samples are added to the micro ELISA plate wells and combined wit
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse MMP-13 (Matrix Metalloproteinase 13) in samples from Serum, Plasma, Cell supernatant

Mouse fibroblast growth factor-13, FGF-13 ELISA Kit

CSB-E13851m-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse fibroblast growth factor-13, FGF-13 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse fibroblast growth factor-13, FGF-13 ELISA Kit

1-CSB-E13851m
  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse fibroblast growth factor-13, FGF-13 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.