Rat NKAP(NFKB Activating Protein) ELISA Kit

Rat NKAP(NFKB Activating Protein) ELISA Kit

To Order Contact us:  Mark@operatiebrp.nl

Rat NFKB Activating Protein (NKAP) ELISA Kit
RDR-NKAP-Ra-96Tests	Reddot Biotech	96 Tests	EUR 811

Rat NFKB Activating Protein (NKAP) ELISA Kit
RD-NKAP-Ra-48Tests	Reddot Biotech	48 Tests	EUR 557

Rat NFKB Activating Protein (NKAP) ELISA Kit
RD-NKAP-Ra-96Tests	Reddot Biotech	96 Tests	EUR 775

Human NFKB Activating Protein (NKAP) ELISA Kit
DLR-NKAP-Hu-48T	DL Develop	48T	EUR 517
Should the Human NFKB Activating Protein (NKAP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human NFKB Activating Protein (NKAP) in samples from tissue homogenates or other biological fluids.

Human NFKB Activating Protein (NKAP) ELISA Kit
DLR-NKAP-Hu-96T	DL Develop	96T	EUR 673
Should the Human NFKB Activating Protein (NKAP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human NFKB Activating Protein (NKAP) in samples from tissue homogenates or other biological fluids.

Mouse NFKB Activating Protein (NKAP) ELISA Kit
DLR-NKAP-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse NFKB Activating Protein (NKAP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse NFKB Activating Protein (NKAP) in samples from tissue homogenates or other biological fluids.

Mouse NFKB Activating Protein (NKAP) ELISA Kit
DLR-NKAP-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse NFKB Activating Protein (NKAP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse NFKB Activating Protein (NKAP) in samples from tissue homogenates or other biological fluids.

Human NFKB Activating Protein (NKAP) ELISA Kit
RDR-NKAP-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human NFKB Activating Protein (NKAP) ELISA Kit
RDR-NKAP-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Mouse NFKB Activating Protein (NKAP) ELISA Kit
RDR-NKAP-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse NFKB Activating Protein (NKAP) ELISA Kit
RDR-NKAP-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Human NFKB Activating Protein (NKAP) ELISA Kit
RD-NKAP-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human NFKB Activating Protein (NKAP) ELISA Kit
RD-NKAP-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Mouse NFKB Activating Protein (NKAP) ELISA Kit
RD-NKAP-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse NFKB Activating Protein (NKAP) ELISA Kit
RD-NKAP-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Rat NFKB Activating Protein (NKAP) ELISA Kit
20-abx155896	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Rat NFKB Activating Protein (NKAP) ELISA Kit
SEH538Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5124.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat NFKB Activating Protein (NKAP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat NFKB Activating Protein (NKAP) in Tissue homogenates and other biological fluids.

Rat NFKB Activating Protein (NKAP) ELISA Kit
SEH538Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 509.64
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat NFKB Activating Protein (NKAP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat NFKB Activating Protein (NKAP) in Tissue homogenates and other biological fluids.

Rat NFKB Activating Protein (NKAP) ELISA Kit
SEH538Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 685.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat NFKB Activating Protein (NKAP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat NFKB Activating Protein (NKAP) in Tissue homogenates and other biological fluids.

Rat NFKB Activating Protein (NKAP) ELISA Kit
SEH538Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2783.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat NFKB Activating Protein (NKAP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat NFKB Activating Protein (NKAP) in Tissue homogenates and other biological fluids.

Rat NFKB Activating Protein (NKAP) ELISA Kit
4-SEH538Ra	Cloud-Clone	EUR 5175.00 EUR 2734.00 EUR 686.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as NFKB Activating Protein elisa. Alternative names of the recognized antigen: NF Kappa B Activating Protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat NFKB Activating Protein (NKAP) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rat NFKB Activating Protein (NKAP) Protein
20-abx654558	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Rat NFKB Activating Protein (NKAP) CLIA Kit
20-abx495468	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Rat NKAP (NFKB Activating Protein)
ELK7219	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to NFKB Activating Protein (NKAP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to NFK Show more
Description: A sandwich ELISA kit for detection of NFKB Activating Protein from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

NFKB Activating Protein (NKAP) Antibody
20-abx177804	Abbexa	EUR 1302.00 EUR 620.00	1 mg 200 ug
Please enquire.

NFKB Activating Protein (NKAP) Antibody
20-abx173819	Abbexa	EUR 913.00 EUR 467.00	1 mg 200 ug
Please enquire.

Human NFKB Activating Protein (NKAP) ELISA Kit
SEH538Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human NFKB Activating Protein (NKAP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human NFKB Activating Protein (NKAP) in Tissue homogenates, cell lysates and other biological fluids.

Human NFKB Activating Protein (NKAP) ELISA Kit
SEH538Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human NFKB Activating Protein (NKAP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human NFKB Activating Protein (NKAP) in Tissue homogenates, cell lysates and other biological fluids.

Human NFKB Activating Protein (NKAP) ELISA Kit
SEH538Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human NFKB Activating Protein (NKAP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human NFKB Activating Protein (NKAP) in Tissue homogenates, cell lysates and other biological fluids.

Human NFKB Activating Protein (NKAP) ELISA Kit
SEH538Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human NFKB Activating Protein (NKAP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human NFKB Activating Protein (NKAP) in Tissue homogenates, cell lysates and other biological fluids.

Human NFKB Activating Protein (NKAP) ELISA Kit
4-SEH538Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as NFKB Activating Protein elisa. Alternative names of the recognized antigen: NF Kappa B Activating Protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human NFKB Activating Protein (NKAP) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Human NKAP (NFKB Activating Protein)
ELK5265	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to NFKB Activating Protein (NKAP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to NFK Show more
Description: A sandwich ELISA kit for detection of NFKB Activating Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Nkap/ Rat Nkap ELISA Kit
ELI-22120r	Lifescience Market	96 Tests	EUR 886

Rat Nkap/ NF-kappa-B-activating protein ELISA Kit
E0672Ra	Sunlong	1 Kit	EUR 646

Rat NF-kappa-B-activating protein (NKAP) ELISA Kit
abx256487-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Rat Nkap(NF-kappa-B-activating protein) ELISA Kit
ER0510	FN Test	96T	EUR 567.6
Detection range: 78-5000 pg/ml Uniprot ID: Q4V7C9 Alias: Nkap
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 46.9pg/ml

Nkap ELISA Kit| Rat NF-kappa-B-activating protein ELISA Kit
EF017347	Lifescience Market	96 Tests	EUR 689

Rat Nuclear Factor Kappa B (NFkB) ELISA Kit
DLR-NFkB-Ra-48T	DL Develop	48T	EUR 528
Should the Rat Nuclear Factor Kappa B (NFkB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Nuclear Factor Kappa B (NFkB) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Nuclear Factor Kappa B (NFkB) ELISA Kit
DLR-NFkB-Ra-96T	DL Develop	96T	EUR 690
Should the Rat Nuclear Factor Kappa B (NFkB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Nuclear Factor Kappa B (NFkB) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Nuclear Factor Kappa B (NFkB) ELISA Kit
RDR-NFkB-Ra-48Tests	Reddot Biotech	48 Tests	EUR 558

Rat Nuclear Factor Kappa B (NFkB) ELISA Kit
RDR-NFkB-Ra-96Tests	Reddot Biotech	96 Tests	EUR 776

Rat Nuclear Factor Kappa B (NFkB) ELISA Kit
RD-NFkB-Ra-48Tests	Reddot Biotech	48 Tests	EUR 534

Rat Nuclear Factor Kappa B (NFkB) ELISA Kit
RD-NFkB-Ra-96Tests	Reddot Biotech	96 Tests	EUR 742

Human NF-kappa-B-activating protein (NKAP) ELISA Kit
20-abx156948	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human NF-kappa-B-activating protein (NKAP) ELISA Kit
abx250790-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Mouse Nkap/ NF-kappa-B-activating protein ELISA Kit
E1027Mo	Sunlong	1 Kit	EUR 632

Human NKAP/ NF-kappa-B-activating protein ELISA Kit
E1747Hu	Sunlong	1 Kit	EUR 605

Human NKAP(NF-kappa-B-activating protein) ELISA Kit
EH1507	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: Q8N5F7 Alias: NKAP(NF-kappa-B-activating protein)
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Mouse NF- kappa- B- activating protein, Nkap ELISA KIT
ELI-13129m	Lifescience Market	96 Tests	EUR 865

Human NF- kappa- B- activating protein, NKAP ELISA KIT
ELI-22119h	Lifescience Market	96 Tests	EUR 824

Mouse NF-kappa-B-activating protein (NKAP) ELISA Kit
abx516445-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Nkap ELISA Kit| Mouse NF-kappa-B-activating protein ELISA Kit
EF015681	Lifescience Market	96 Tests	EUR 689

Chicken Nuclear Factor Kappa B (NFkB) ELISA Kit
DLR-NFkB-Ch-48T	DL Develop	48T	EUR 528
Should the Chicken Nuclear Factor Kappa B (NFkB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Chicken Nuclear Factor Kappa B (NFkB) in samples from tissue homogenates, cell lysates or other biological fluids.

Chicken Nuclear Factor Kappa B (NFkB) ELISA Kit
DLR-NFkB-Ch-96T	DL Develop	96T	EUR 690
Should the Chicken Nuclear Factor Kappa B (NFkB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Chicken Nuclear Factor Kappa B (NFkB) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Nuclear Factor Kappa B (NFkB) ELISA Kit
DLR-NFkB-Hu-48T	DL Develop	48T	EUR 498
Should the Human Nuclear Factor Kappa B (NFkB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Nuclear Factor Kappa B (NFkB) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Nuclear Factor Kappa B (NFkB) ELISA Kit
DLR-NFkB-Hu-96T	DL Develop	96T	EUR 647
Should the Human Nuclear Factor Kappa B (NFkB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Nuclear Factor Kappa B (NFkB) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Nuclear Factor Kappa B (NFkB) ELISA Kit
DLR-NFkB-Mu-48T	DL Develop	48T	EUR 450
Should the Mouse Nuclear Factor Kappa B (NFkB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Nuclear Factor Kappa B (NFkB) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Nuclear Factor Kappa B (NFkB) ELISA Kit
DLR-NFkB-Mu-96T	DL Develop	96T	EUR 582
Should the Mouse Nuclear Factor Kappa B (NFkB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Nuclear Factor Kappa B (NFkB) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Chicken Nuclear Factor Kappa B (NFkB) ELISA Kit
RDR-NFkB-Ch-48Tests	Reddot Biotech	48 Tests	EUR 558

Chicken Nuclear Factor Kappa B (NFkB) ELISA Kit
RDR-NFkB-Ch-96Tests	Reddot Biotech	96 Tests	EUR 776

Human Nuclear Factor Kappa B (NFkB) ELISA Kit
RDR-NFkB-Hu-48Tests	Reddot Biotech	48 Tests	EUR 522

Human Nuclear Factor Kappa B (NFkB) ELISA Kit
RDR-NFkB-Hu-96Tests	Reddot Biotech	96 Tests	EUR 724

Mouse Nuclear Factor Kappa B (NFkB) ELISA Kit
RDR-NFkB-Mu-48Tests	Reddot Biotech	48 Tests	EUR 465

Mouse Nuclear Factor Kappa B (NFkB) ELISA Kit
RDR-NFkB-Mu-96Tests	Reddot Biotech	96 Tests	EUR 643

Chicken Nuclear Factor Kappa B (NFkB) ELISA Kit
RD-NFkB-Ch-48Tests	Reddot Biotech	48 Tests	EUR 534

Chicken Nuclear Factor Kappa B (NFkB) ELISA Kit
RD-NFkB-Ch-96Tests	Reddot Biotech	96 Tests	EUR 742

Human Nuclear Factor Kappa B (NFkB) ELISA Kit
RD-NFkB-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Nuclear Factor Kappa B (NFkB) ELISA Kit
RD-NFkB-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Mouse Nuclear Factor Kappa B (NFkB) ELISA Kit
RD-NFkB-Mu-48Tests	Reddot Biotech	48 Tests	EUR 446

Mouse Nuclear Factor Kappa B (NFkB) ELISA Kit
RD-NFkB-Mu-96Tests	Reddot Biotech	96 Tests	EUR 615

NF-Kappa-B-Activating Protein (NKAP) Antibody
abx026787-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

NF-Kappa-B-Activating Protein (NKAP) Antibody
abx026787-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

NF-Kappa-B-Activating Protein (NKAP) Antibody
20-abx217178	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Human NF-kappa-B-activating protein (NKAP) CLIA Kit
20-abx495467	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Rat NFkB ELISA Kit
ERN0018	Abclonal	96Tests	EUR 521

NKAP Recombinant Protein (Rat)
RP213986	ABM	100 ug	Ask for price

Human NKAP ELISA Kit
ELA-E13391h	Lifescience Market	96 Tests	EUR 824

NKAP ELISA KIT|Human
EF005403	Lifescience Market	96 Tests	EUR 689

Rat NFkB p65 ELISA Kit
ERN0028	Abclonal	96Tests	EUR 521

Human NKAP- like protein, NKAPL ELISA KIT
ELI-13657h	Lifescience Market	96 Tests	EUR 824

Rat NKAP shRNA Plasmid
20-abx988918	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

NKAP Antibody
45687-100ul	SAB	100ul	EUR 252

NKAP Antibody
45687-50ul	SAB	50ul	EUR 187

NKAP Antibody
DF9069	Affbiotech	200ul	EUR 304
Description: NKAP Antibody detects endogenous levels of total NKAP.

NKAP siRNA
20-abx903568	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NKAP siRNA
20-abx925951	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NKAP siRNA
20-abx925952	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NKAP Antibody
ABD9069	Lifescience Market	100 ug	EUR 438

Human NFkB ELISA Kit
EHN0018	Abclonal	96Tests	EUR 521

Bovine NFkB ELISA Kit
EBN0018	Abclonal	96Tests	EUR 521

Anserini NFkB ELISA Kit
EAN0018	Abclonal	96Tests	EUR 521

Chicken NFkB ELISA Kit
ECKN0018	Abclonal	96Tests	EUR 521

Canine NFkB ELISA Kit
ECN0018	Abclonal	96Tests	EUR 521

Goat NFkB ELISA Kit
EGTN0018	Abclonal	96Tests	EUR 521

Porcine NFkB ELISA Kit
EPN0018	Abclonal	96Tests	EUR 521

Sheep NFkB ELISA Kit
ESN0018	Abclonal	96Tests	EUR 521

Rabbit NFkB ELISA Kit
ERTN0018	Abclonal	96Tests	EUR 521

Monkey NFkB ELISA Kit
EMKN0018	Abclonal	96Tests	EUR 521

Mouse NFkB ELISA Kit
EMN0018	Abclonal	96Tests	EUR 521

NKAP Recombinant Protein (Human)
RP021271	ABM	100 ug	Ask for price

NKAP Recombinant Protein (Human)
RP021274	ABM	100 ug	Ask for price

NKAP Recombinant Protein (Mouse)
RP154202	ABM	100 ug	Ask for price

Nkap ORF Vector (Rat) (pORF)
ORF071330	ABM	1.0 ug DNA	EUR 506

Rat NFKB 65
QY-E11918	Qayee Biotechnology	96T	EUR 374

NKAP Protein Vector (Rat) (pPB-C-His)
PV285318	ABM	500 ng	EUR 603

NKAP Protein Vector (Rat) (pPB-N-His)
PV285319	ABM	500 ng	EUR 603

NKAP Protein Vector (Rat) (pPM-C-HA)
PV285320	ABM	500 ng	EUR 603

NKAP Protein Vector (Rat) (pPM-C-His)
PV285321	ABM	500 ng	EUR 603

Rat Neutrophil activating protein 2 ELISA kit
E02N0072-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Neutrophil activating protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Neutrophil activating protein 2 ELISA kit
E02N0072-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Neutrophil activating protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Neutrophil activating protein 2 ELISA kit
E02N0072-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Neutrophil activating protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Phospholipase A1 Activating Protein ELISA kit
E02P0125-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Phospholipase A1 Activating Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Phospholipase A1 Activating Protein ELISA kit
E02P0125-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Phospholipase A1 Activating Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Phospholipase A1 Activating Protein ELISA kit
E02P0125-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Phospholipase A1 Activating Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ras GTPase Activating Protein ELISA kit
E02R0029-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Ras GTPase Activating Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ras GTPase Activating Protein ELISA kit
E02R0029-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Ras GTPase Activating Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ras GTPase Activating Protein ELISA kit
E02R0029-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Ras GTPase Activating Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea Pig NFkB ELISA Kit
EGN0018	Abclonal	96Tests	EUR 521

Human NFkB p65 ELISA Kit
EHN0028	Abclonal	96Tests	EUR 521

Bovine NFkB p65 ELISA Kit
EBN0028	Abclonal	96Tests	EUR 521

Anserini NFkB p65 ELISA Kit
EAN0028	Abclonal	96Tests	EUR 521

Chicken NFkB p65 ELISA Kit
ECKN0028	Abclonal	96Tests	EUR 521

Canine NFkB p65 ELISA Kit
ECN0028	Abclonal	96Tests	EUR 521

Goat NFkB p65 ELISA Kit
EGTN0028	Abclonal	96Tests	EUR 521

Porcine NFkB p65 ELISA Kit
EPN0028	Abclonal	96Tests	EUR 521

Sheep NFkB p65 ELISA Kit
ESN0028	Abclonal	96Tests	EUR 521

Rabbit NFkB p65 ELISA Kit
ERTN0028	Abclonal	96Tests	EUR 521

Monkey NFkB p65 ELISA Kit
EMKN0028	Abclonal	96Tests	EUR 521

Mouse NFkB p65 ELISA Kit
EMN0028	Abclonal	96Tests	EUR 521

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

NKAP Rabbit pAb
A13748-100ul	Abclonal	100 ul	EUR 308

NKAP Rabbit pAb
A13748-200ul	Abclonal	200 ul	EUR 459

NKAP Rabbit pAb
A13748-20ul	Abclonal	20 ul	EUR 183

NKAP Rabbit pAb
A13748-50ul	Abclonal	50 ul	EUR 223

NKAP Blocking Peptide
DF9069-BP	Affbiotech	1mg	EUR 195

NKAP Conjugated Antibody
C45687	SAB	100ul	EUR 397

NKAP cloning plasmid
CSB-CL847637HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1248 Sequence: atggctccggtgtccggctcacgcagcccggatagggaggcctcgggctcggggggaagacgtcgcagttcgtcgaagagtccgaagcccagcaaatctgcccgctccccgcggggccgccgctctcgctcgcactcttgctctcggtccggggaccggaatggactcacccatc Show more
Description: A cloning plasmid for the NKAP gene.

NKAP cloning plasmid
CSB-CL847637HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1248 Sequence: atggctccggtgtccggctcacgcagcccggatagggaggcctcgggctcggggggaagacgtcgcagttcgtcgaagagtccgaagcccagcaaatctgcccgctccccgcggggccgccgctctcgctcgcactcttgctctcggtccggggaccggaatggactcacccatc Show more
Description: A cloning plasmid for the NKAP gene.

NKAP Polyclonal Antibody
ABP59470-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human NKAP protein at amino acid sequence of 10-90 Applications tips:
Description: A polyclonal antibody for detection of NKAP from Human. This NKAP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NKAP protein at amino acid sequence of 10-90

NKAP Polyclonal Antibody
ABP59470-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human NKAP protein at amino acid sequence of 10-90 Applications tips:
Description: A polyclonal antibody for detection of NKAP from Human. This NKAP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NKAP protein at amino acid sequence of 10-90

NKAP Polyclonal Antibody
ABP59470-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human NKAP protein at amino acid sequence of 10-90 Applications tips:
Description: A polyclonal antibody for detection of NKAP from Human. This NKAP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NKAP protein at amino acid sequence of 10-90

NKAP Polyclonal Antibody
ES9264-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NKAP from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

NKAP Polyclonal Antibody
ES9264-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NKAP from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

pENTR223-NKAP vector
PVT12090	Lifescience Market	2 ug	EUR 308

pCMV-SPORT6-NKAP
PVT13487	Lifescience Market	2 ug	EUR 391

Anti-NKAP antibody
STJ115697	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a protein that is involved in the activation of the ubiquitous transcription factor NF-kappaB. This protein is associated with the the histone deacetylase HDAC3 and with the Notch corepressor complex, and it thereby acts as a transcriptional repressor of Notch target genes. It is also required for alphabeta T cell development. A related pseudogene has been identified on chromosome X, while a related and intronless retrocopy, which has an intact CDS and may be functional, is located on chromosome 6.

Anti-NKAP antibody
STJ190422	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to NKAP

Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol)
RAT-5	Alpha Diagnostics	1	EUR 1138

Recombinant human NKAP-like protein
P1309	FN Test	100ug	Ask for price
Uniprot ID: Q5M9Q1 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human NKAP-like protein

Rat Nuclear Factor kappa B (NFkB) ELISA Kit
20-abx155891	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Rat Nuclear Factor Kappa B (NFkB) ELISA Kit
SEB824Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4875.49
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Nuclear Factor Kappa B (NFkB) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Nuclear Factor Kappa B (NFkB) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Nuclear Factor Kappa B (NFkB) ELISA Kit
SEB824Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 489.16
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Nuclear Factor Kappa B (NFkB) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Nuclear Factor Kappa B (NFkB) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Nuclear Factor Kappa B (NFkB) ELISA Kit
SEB824Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 655.94
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Nuclear Factor Kappa B (NFkB) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Nuclear Factor Kappa B (NFkB) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Nuclear Factor Kappa B (NFkB) ELISA Kit
SEB824Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2651.73
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Nuclear Factor Kappa B (NFkB) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Nuclear Factor Kappa B (NFkB) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Nuclear Factor Kappa B (NFkB) ELISA Kit
4-SEB824Ra	Cloud-Clone	EUR 4926.00 EUR 2602.00 EUR 656.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Nuclear Factor Kappa B elisa. Alternative names of the recognized antigen: NF-KB1 EBP-1 KBF1 NF-Kappa-B NFKB-P105 NFKB-P50 Nuclear Factor Of Kappa Light Polypeptide Gene Enhancer In B-Cells 1 Nuclear factor NF-kappa-B p105 subuni Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Nuclear Factor Kappa B (NFkB) in samples from tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Nuclear Factor Kappa B ELISA Kit (NFkB)
RK03838	Abclonal	96 Tests	EUR 521

Nkap sgRNA CRISPR Lentivector set (Rat)
K6259601	ABM	3 x 1.0 ug	EUR 339

Rat Platelet activating factor ELISA kit
E02P0589-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Platelet activating factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Platelet activating factor ELISA kit
E02P0589-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Platelet activating factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Platelet activating factor ELISA kit
E02P0589-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Platelet activating factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

FLAP ELISA Kit| Rat 5-Lipoxygenase Activating Protein ELISA Kit
EF017730	Lifescience Market	96 Tests	EUR 689

GAP ELISA Kit| Rat Ras Gtpase Activating Protein ELISA Kit
EF017749	Lifescience Market	96 Tests	EUR 689

Rat Neutrophil Activating Protein 3 (NAP3) ELISA Kit
DLR-NAP3-Ra-48T	DL Develop	48T	EUR 376
Should the Rat Neutrophil Activating Protein 3 (NAP3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Neutrophil Activating Protein 3 (NAP3) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Neutrophil Activating Protein 3 (NAP3) ELISA Kit
DLR-NAP3-Ra-96T	DL Develop	96T	EUR 479
Should the Rat Neutrophil Activating Protein 3 (NAP3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Neutrophil Activating Protein 3 (NAP3) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Gamma-Secretase Activating Protein (gSAP) ELISA Kit
DLR-gSAP-Ra-48T	DL Develop	48T	EUR 590
Should the Rat Gamma-Secretase Activating Protein (gSAP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Gamma-Secretase Activating Protein (gSAP) in samples from tissue homogenates or other biological fluids.

Rat Gamma-Secretase Activating Protein (gSAP) ELISA Kit
DLR-gSAP-Ra-96T	DL Develop	96T	EUR 774
Should the Rat Gamma-Secretase Activating Protein (gSAP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Gamma-Secretase Activating Protein (gSAP) in samples from tissue homogenates or other biological fluids.

Rat gamma Secretase Activating Protein (gSAP) ELISA Kit
20-abx155611	Abbexa	EUR 7911.00 EUR 4215.00 EUR 973.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Rat Ras Gtpase Activating Protein (GAP) ELISA Kit
abx256943-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Rat Phospholipase A2 Activating Protein (PLAA) ELISA Kit
abx391806-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rat FLAP(5-Lipoxygenase Activating Protein) ELISA Kit
ER0955	FN Test	96T	EUR 524.1
Detection range: 15.625-1000 pg/ml Uniprot ID: P20291 Alias: FLAP
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 9.375pg/ml

Rat GAP(Ras Gtpase Activating Protein) ELISA Kit
ER0977	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Uniprot ID: P50904 Alias: GAP
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.094 ng/ml

Rat Neutrophil Activating Protein 3(NAP3)ELISA kit
QY-E10212	Qayee Biotechnology	96T	EUR 361

Rat Phospholipase A2 Activating Protein(PLAA)ELISA kit
QY-E10546	Qayee Biotechnology	96T	EUR 413

Rat Neutrophil Activating Protein 3 (NAP3) ELISA Kit
SEA041Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 3016.71
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neutrophil Activating Protein 3 (NAP3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Neutrophil Activating Protein 3 (NAP3) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Neutrophil Activating Protein 3 (NAP3) ELISA Kit
SEA041Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 336.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neutrophil Activating Protein 3 (NAP3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Neutrophil Activating Protein 3 (NAP3) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Neutrophil Activating Protein 3 (NAP3) ELISA Kit
SEA041Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 437.26
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neutrophil Activating Protein 3 (NAP3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Neutrophil Activating Protein 3 (NAP3) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Neutrophil Activating Protein 3 (NAP3) ELISA Kit
SEA041Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 1667.67
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neutrophil Activating Protein 3 (NAP3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Neutrophil Activating Protein 3 (NAP3) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Neutrophil Activating Protein 3 (NAP3) ELISA Kit
4-SEA041Ra	Cloud-Clone	EUR 3067.00 EUR 1618.00 EUR 438.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Neutrophil Activating Protein 3 elisa. Alternative names of the recognized antigen: CXCL1 GRO1 GROa GRO-A MGSA-A NAP3 SCYB1 Chemokine C-X-C-Motif Ligand 1 Melanoma Growth Stimulating Activity Alpha Fibroblast Secretory Protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Neutrophil Activating Protein 3 (NAP3) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Gamma-Secretase Activating Protein (gSAP) ELISA Kit
RDR-gSAP-Ra-48Tests	Reddot Biotech	48 Tests	EUR 631

Rat Gamma-Secretase Activating Protein (gSAP) ELISA Kit
RDR-gSAP-Ra-96Tests	Reddot Biotech	96 Tests	EUR 880

Rat Neutrophil Activating Protein 3 (NAP3) ELISA Kit
RDR-NAP3-Ra-48Tests	Reddot Biotech	48 Tests	EUR 377

Rat Neutrophil Activating Protein 3 (NAP3) ELISA Kit
RDR-NAP3-Ra-96Tests	Reddot Biotech	96 Tests	EUR 518

Rat Neutrophil Activating Protein 3 ELISA Kit (NAP3)
RK04051	Abclonal	96 Tests	EUR 521

Rat Gamma-Secretase Activating Protein (gSAP) ELISA Kit
RD-gSAP-Ra-48Tests	Reddot Biotech	48 Tests	EUR 603

Rat Gamma-Secretase Activating Protein (gSAP) ELISA Kit
RD-gSAP-Ra-96Tests	Reddot Biotech	96 Tests	EUR 840

Rat Neutrophil Activating Protein 3 (NAP3) ELISA Kit
RD-NAP3-Ra-48Tests	Reddot Biotech	48 Tests	EUR 362

Rat Neutrophil Activating Protein 3 (NAP3) ELISA Kit
RD-NAP3-Ra-96Tests	Reddot Biotech	96 Tests	EUR 495

Rat Gamma-Secretase Activating Protein (gSAP) ELISA Kit
SER761Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5621.62
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Gamma-Secretase Activating Protein (gSAP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Ass Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Gamma-Secretase Activating Protein (gSAP) in Tissue homogenates and other biological fluids.

Rat Gamma-Secretase Activating Protein (gSAP) ELISA Kit
SER761Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 550.6
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Gamma-Secretase Activating Protein (gSAP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Ass Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Gamma-Secretase Activating Protein (gSAP) in Tissue homogenates and other biological fluids.

Rat Gamma-Secretase Activating Protein (gSAP) ELISA Kit
SER761Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 743.72
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Gamma-Secretase Activating Protein (gSAP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Ass Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Gamma-Secretase Activating Protein (gSAP) in Tissue homogenates and other biological fluids.

Rat Gamma-Secretase Activating Protein (gSAP) ELISA Kit
SER761Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 3046.74
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Gamma-Secretase Activating Protein (gSAP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Ass Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Gamma-Secretase Activating Protein (gSAP) in Tissue homogenates and other biological fluids.

Rat Gamma-Secretase Activating Protein (gSAP) ELISA Kit
4-SER761Ra	Cloud-Clone	EUR 5672.00 EUR 2997.00 EUR 744.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Gamma-Secretase Activating Protein elisa. Alternative names of the recognized antigen: PION Pigeon Homolog
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Gamma-Secretase Activating Protein (gSAP) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Guinea Pig NFkB p65 ELISA Kit
EGN0028	Abclonal	96Tests	EUR 521

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

ELISA kit for Rat NFkB (Nuclear Factor Kappa B)
ELK5691	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Nuclear Factor Kappa B (NF?B). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Nucl Show more
Description: A sandwich ELISA kit for detection of Nuclear Factor Kappa B from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Mouse NKAP shRNA Plasmid
20-abx975944	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human NKAP shRNA Plasmid
20-abx962402	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

NAP-2 ELISA Kit| Rat Neutrophil Activating Protein-2 ELISA Kit
EF017906	Lifescience Market	96 Tests	EUR 689

NAP-3 ELISA Kit| Rat Neutrophil Activating Protein -3 ELISA Kit
EF017907	Lifescience Market	96 Tests	EUR 689

Abra ELISA Kit| Rat Actin-binding Rho-activating protein ELISA
EF018276	Lifescience Market	96 Tests	EUR 689

Arhgap35 ELISA Kit| Rat Rho GTPase-activating protein 35 ELISA
EF018738	Lifescience Market	96 Tests	EUR 689

Plaa ELISA Kit| Rat Phospholipase A-2-activating protein ELISA
EF019166	Lifescience Market	96 Tests	EUR 689

ELISA kit for Rat PLA2P (Phospholipase A2 Activating Protein)
E-EL-R0732	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's PLA2P ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat PLA2P. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat PLA2P (Phospholipase A2 Activating Protein) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Rat GAP (Ras Gtpase Activating Protein)
E-EL-R0839	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's GAP ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat GAP. Standards or samples are added to the micro ELISA plate wells and combined with the sp Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat GAP (Ras Gtpase Activating Protein) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Rat FLAP (5-Lipoxygenase Activating Protein)
E-EL-R1099	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's FLAP ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat FLAP. Standards or samples are added to the micro ELISA plate wells and combined with the Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat FLAP (5-Lipoxygenase Activating Protein) in samples from Serum, Plasma, Cell supernatant

Rat Actin binding Rho activating protein(ABRA) ELISA kit
E02A1164-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Actin binding Rho activating protein(ABRA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Actin binding Rho activating protein(ABRA) ELISA kit
E02A1164-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Actin binding Rho activating protein(ABRA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Actin binding Rho activating protein(ABRA) ELISA kit
E02A1164-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Actin binding Rho activating protein(ABRA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Arachidonate 5 lipoxygenase activating protein(ALOX5AP) ELISA kit
E02A1402-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Arachidonate 5 lipoxygenase activating protein(ALOX5AP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Arachidonate 5 lipoxygenase activating protein(ALOX5AP) ELISA kit
E02A1402-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Arachidonate 5 lipoxygenase activating protein(ALOX5AP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Arachidonate 5 lipoxygenase activating protein(ALOX5AP) ELISA kit
E02A1402-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Arachidonate 5 lipoxygenase activating protein(ALOX5AP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat ARF GTPase activating protein GIT1(GIT1) ELISA kit
E02A1874-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat ARF GTPase activating protein GIT1(GIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat ARF GTPase activating protein GIT1(GIT1) ELISA kit
E02A1874-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat ARF GTPase activating protein GIT1(GIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat ARF GTPase activating protein GIT1(GIT1) ELISA kit
E02A1874-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat ARF GTPase activating protein GIT1(GIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat ARF GTPase activating protein GIT2(GIT2) ELISA kit
E02A1875-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat ARF GTPase activating protein GIT2(GIT2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat ARF GTPase activating protein GIT2(GIT2) ELISA kit
E02A1875-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat ARF GTPase activating protein GIT2(GIT2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat ARF GTPase activating protein GIT2(GIT2) ELISA kit
E02A1875-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat ARF GTPase activating protein GIT2(GIT2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Rho GTPase activating protein 15(ARHGAP15) ELISA kit
E02R0367-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Rho GTPase activating protein 15(ARHGAP15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Rho GTPase activating protein 15(ARHGAP15) ELISA kit
E02R0367-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Rho GTPase activating protein 15(ARHGAP15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Rho GTPase activating protein 15(ARHGAP15) ELISA kit
E02R0367-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Rho GTPase activating protein 15(ARHGAP15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Rho GTPase activating protein 19(ARHGAP19) ELISA kit
E02R0368-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Rho GTPase activating protein 19(ARHGAP19) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Rho GTPase activating protein 19(ARHGAP19) ELISA kit
E02R0368-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Rho GTPase activating protein 19(ARHGAP19) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Rho GTPase activating protein 19(ARHGAP19) ELISA kit
E02R0368-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Rho GTPase activating protein 19(ARHGAP19) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Rho GTPase activating protein 26(ARHGAP26) ELISA kit
E02R0369-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Rho GTPase activating protein 26(ARHGAP26) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Rho GTPase activating protein 26(ARHGAP26) ELISA kit
E02R0369-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Rho GTPase activating protein 26(ARHGAP26) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Rho GTPase activating protein 26(ARHGAP26) ELISA kit
E02R0369-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Rho GTPase activating protein 26(ARHGAP26) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Arachidonate 5-Lipoxygenase Activating Protein (ALOX5AP) ELISA Kit
abx256923-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

ELISA kit for Rat NF-kappa-B-activating protein
EK3216	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat NF-kappa-B-activating protein in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Rat NAP3 (Neutrophil Activating Protein 3)
ELK1237	ELK Biotech	1 plate of 96 wells	EUR 372
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Neutrophil Activating Protein 3 (NAP3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specifi Show more
Description: A sandwich ELISA kit for detection of Neutrophil Activating Protein 3 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Rat neutrophil activating protein-2,NAP-2 ELISA Kit
CN-01949R1	ChemNorm	96T	EUR 471

Rat neutrophil activating protein-2,NAP-2 ELISA Kit
CN-01949R2	ChemNorm	48T	EUR 322

Rat ARF GTPase Activating Protein GIT1 (GIT1) ELISA Kit
abx391381-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rat Rho GTPase Activating Protein 35 (ARHGAP35) ELISA Kit
abx391382-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rat Phospholipase A2 Activating Protein / PLA2P (PLAA) ELISA Kit
abx353835-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Rat Actin Binding Rho Activating Protein (ABRA) ELISA Kit
abx390923-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

ELISA kit for Rat gSAP (Gamma-Secretase Activating Protein)
ELK8025	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Gamma-Secretase Activating Protein (?SAP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody spec Show more
Description: A sandwich ELISA kit for detection of Gamma-Secretase Activating Protein from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Rat NAP-2(Neutrophil Activating Protein-2) ELISA Kit
ER1178	FN Test	96T	EUR 524.1
Detection range: 156.25-10000 pg/ml Alias: NAP-2/CXCL7/CTAP III/PPBP/connective tissue-activating peptide III/CTAP3CTAP-III/CXC chemokine ligand 7/C-X-C motif chemokine 7/CXCL7b-TG1/LA-PF4/LDGFTC1/Leukocyte-derived growth factor/low-affinity platelet Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 93.75pg/ml

Rat neutrophil activating protein-2(NAP-2)ELISA Kit
GA-E0771RT-48T	GenAsia Biotech	48T	EUR 317

Rat neutrophil activating protein-2(NAP-2)ELISA Kit
GA-E0771RT-96T	GenAsia Biotech	96T	EUR 496

ELISA kit for Rat Gamma-Secretase Activating Protein (GSAP)
KTE100915-48T	Abbkine	48T	EUR 354
Formation of amyloid-beta is catalyzed by gamma-secretase, a protease with numerous substrates. PION, or GSAP, selectively increases amyloid-beta production through a mechanism involving its interaction with both gamma-secretase and its substrate, th Show more
Description: Quantitative sandwich ELISA for measuring Rat Gamma-Secretase Activating Protein (GSAP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Gamma-Secretase Activating Protein (GSAP)
KTE100915-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Formation of amyloid-beta is catalyzed by gamma-secretase, a protease with numerous substrates. PION, or GSAP, selectively increases amyloid-beta production through a mechanism involving its interaction with both gamma-secretase and its substrate, th Show more
Description: Quantitative sandwich ELISA for measuring Rat Gamma-Secretase Activating Protein (GSAP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Gamma-Secretase Activating Protein (GSAP)
KTE100915-96T	Abbkine	96T	EUR 572
Formation of amyloid-beta is catalyzed by gamma-secretase, a protease with numerous substrates. PION, or GSAP, selectively increases amyloid-beta production through a mechanism involving its interaction with both gamma-secretase and its substrate, th Show more
Description: Quantitative sandwich ELISA for measuring Rat Gamma-Secretase Activating Protein (GSAP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Rat neutrophil activating protein-2(NAP-2)ELISA Kit
QY-E10881	Qayee Biotechnology	96T	EUR 361

PAF ELISA Kit| Rat Platelet Activating Factor ELISA Kit
EF017941	Lifescience Market	96 Tests	EUR 689

Nkap sgRNA CRISPR Lentivector (Rat) (Target 1)
K6259602	ABM	1.0 ug DNA	EUR 154

Nkap sgRNA CRISPR Lentivector (Rat) (Target 2)
K6259603	ABM	1.0 ug DNA	EUR 154

Nkap sgRNA CRISPR Lentivector (Rat) (Target 3)
K6259604	ABM	1.0 ug DNA	EUR 154

Rat Glia-activating factor(FGF9) ELISA kit
E02G0407-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Glia-activating factor(FGF9) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Glia-activating factor(FGF9) ELISA kit
E02G0407-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Glia-activating factor(FGF9) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Glia-activating factor(FGF9) ELISA kit
E02G0407-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Glia-activating factor(FGF9) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Platelet activating factor receptor ELISA kit
E02P0037-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Platelet activating factor receptor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Platelet activating factor receptor ELISA kit
E02P0037-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Platelet activating factor receptor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Platelet activating factor receptor ELISA kit
E02P0037-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Platelet activating factor receptor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.