Rat NKAP(NFKB Activating Protein) ELISA Kit

Rat NKAP(NFKB Activating Protein) ELISA Kit

To Order Contact us:  Mark@operatiebrp.nl

Rat NFKB Activating Protein (NKAP) ELISA Kit

RDR-NKAP-Ra-96Tests 96 Tests
EUR 811

Rat NFKB Activating Protein (NKAP) ELISA Kit

RD-NKAP-Ra-48Tests 48 Tests
EUR 557

Rat NFKB Activating Protein (NKAP) ELISA Kit

RD-NKAP-Ra-96Tests 96 Tests
EUR 775

Human NFKB Activating Protein (NKAP) ELISA Kit

DLR-NKAP-Hu-48T 48T
EUR 517
  • Should the Human NFKB Activating Protein (NKAP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human NFKB Activating Protein (NKAP) in samples from tissue homogenates or other biological fluids.

Human NFKB Activating Protein (NKAP) ELISA Kit

DLR-NKAP-Hu-96T 96T
EUR 673
  • Should the Human NFKB Activating Protein (NKAP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human NFKB Activating Protein (NKAP) in samples from tissue homogenates or other biological fluids.

Mouse NFKB Activating Protein (NKAP) ELISA Kit

DLR-NKAP-Mu-48T 48T
EUR 527
  • Should the Mouse NFKB Activating Protein (NKAP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse NFKB Activating Protein (NKAP) in samples from tissue homogenates or other biological fluids.

Mouse NFKB Activating Protein (NKAP) ELISA Kit

DLR-NKAP-Mu-96T 96T
EUR 688
  • Should the Mouse NFKB Activating Protein (NKAP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse NFKB Activating Protein (NKAP) in samples from tissue homogenates or other biological fluids.

Human NFKB Activating Protein (NKAP) ELISA Kit

RDR-NKAP-Hu-48Tests 48 Tests
EUR 544

Human NFKB Activating Protein (NKAP) ELISA Kit

RDR-NKAP-Hu-96Tests 96 Tests
EUR 756

Mouse NFKB Activating Protein (NKAP) ELISA Kit

RDR-NKAP-Mu-48Tests 48 Tests
EUR 557

Mouse NFKB Activating Protein (NKAP) ELISA Kit

RDR-NKAP-Mu-96Tests 96 Tests
EUR 774

Human NFKB Activating Protein (NKAP) ELISA Kit

RD-NKAP-Hu-48Tests 48 Tests
EUR 521

Human NFKB Activating Protein (NKAP) ELISA Kit

RD-NKAP-Hu-96Tests 96 Tests
EUR 723

Mouse NFKB Activating Protein (NKAP) ELISA Kit

RD-NKAP-Mu-48Tests 48 Tests
EUR 533

Mouse NFKB Activating Protein (NKAP) ELISA Kit

RD-NKAP-Mu-96Tests 96 Tests
EUR 740

Rat NFKB Activating Protein (NKAP) ELISA Kit

20-abx155896
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat NFKB Activating Protein (NKAP) ELISA Kit

SEH538Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat NFKB Activating Protein (NKAP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat NFKB Activating Protein (NKAP) in Tissue homogenates and other biological fluids.

Rat NFKB Activating Protein (NKAP) ELISA Kit

SEH538Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat NFKB Activating Protein (NKAP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat NFKB Activating Protein (NKAP) in Tissue homogenates and other biological fluids.

Rat NFKB Activating Protein (NKAP) ELISA Kit

SEH538Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat NFKB Activating Protein (NKAP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat NFKB Activating Protein (NKAP) in Tissue homogenates and other biological fluids.

Rat NFKB Activating Protein (NKAP) ELISA Kit

SEH538Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat NFKB Activating Protein (NKAP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat NFKB Activating Protein (NKAP) in Tissue homogenates and other biological fluids.

Rat NFKB Activating Protein (NKAP) ELISA Kit

4-SEH538Ra
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as NFKB Activating Protein elisa. Alternative names of the recognized antigen: NF Kappa B Activating Protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat NFKB Activating Protein (NKAP) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rat NFKB Activating Protein (NKAP) Protein

20-abx654558
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Rat NFKB Activating Protein (NKAP) CLIA Kit

20-abx495468
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Rat NKAP (NFKB Activating Protein)

ELK7219 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to NFKB Activating Protein (NKAP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to NFK
  • Show more
Description: A sandwich ELISA kit for detection of NFKB Activating Protein from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

NFKB Activating Protein (NKAP) Antibody

20-abx177804
  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

NFKB Activating Protein (NKAP) Antibody

20-abx173819
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Human NFKB Activating Protein (NKAP) ELISA Kit

SEH538Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human NFKB Activating Protein (NKAP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human NFKB Activating Protein (NKAP) in Tissue homogenates, cell lysates and other biological fluids.

Human NFKB Activating Protein (NKAP) ELISA Kit

SEH538Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human NFKB Activating Protein (NKAP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human NFKB Activating Protein (NKAP) in Tissue homogenates, cell lysates and other biological fluids.

Human NFKB Activating Protein (NKAP) ELISA Kit

SEH538Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human NFKB Activating Protein (NKAP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human NFKB Activating Protein (NKAP) in Tissue homogenates, cell lysates and other biological fluids.

Human NFKB Activating Protein (NKAP) ELISA Kit

SEH538Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human NFKB Activating Protein (NKAP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human NFKB Activating Protein (NKAP) in Tissue homogenates, cell lysates and other biological fluids.

Human NFKB Activating Protein (NKAP) ELISA Kit

4-SEH538Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as NFKB Activating Protein elisa. Alternative names of the recognized antigen: NF Kappa B Activating Protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human NFKB Activating Protein (NKAP) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Human NKAP (NFKB Activating Protein)

ELK5265 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to NFKB Activating Protein (NKAP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to NFK
  • Show more
Description: A sandwich ELISA kit for detection of NFKB Activating Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Nkap/ Rat Nkap ELISA Kit

ELI-22120r 96 Tests
EUR 886

Rat Nkap/ NF-kappa-B-activating protein ELISA Kit

E0672Ra 1 Kit
EUR 646

Rat NF-kappa-B-activating protein (NKAP) ELISA Kit

abx256487-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Rat Nkap(NF-kappa-B-activating protein) ELISA Kit

ER0510 96T
EUR 567.6
  • Detection range: 78-5000 pg/ml
  • Uniprot ID: Q4V7C9
  • Alias: Nkap
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 46.9pg/ml

Nkap ELISA Kit| Rat NF-kappa-B-activating protein ELISA Kit

EF017347 96 Tests
EUR 689

Rat Nuclear Factor Kappa B (NFkB) ELISA Kit

DLR-NFkB-Ra-48T 48T
EUR 528
  • Should the Rat Nuclear Factor Kappa B (NFkB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Nuclear Factor Kappa B (NFkB) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Nuclear Factor Kappa B (NFkB) ELISA Kit

DLR-NFkB-Ra-96T 96T
EUR 690
  • Should the Rat Nuclear Factor Kappa B (NFkB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Nuclear Factor Kappa B (NFkB) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Nuclear Factor Kappa B (NFkB) ELISA Kit

RDR-NFkB-Ra-48Tests 48 Tests
EUR 558

Rat Nuclear Factor Kappa B (NFkB) ELISA Kit

RDR-NFkB-Ra-96Tests 96 Tests
EUR 776

Rat Nuclear Factor Kappa B (NFkB) ELISA Kit

RD-NFkB-Ra-48Tests 48 Tests
EUR 534

Rat Nuclear Factor Kappa B (NFkB) ELISA Kit

RD-NFkB-Ra-96Tests 96 Tests
EUR 742

Human NF-kappa-B-activating protein (NKAP) ELISA Kit

20-abx156948
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human NF-kappa-B-activating protein (NKAP) ELISA Kit

abx250790-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Nkap/ NF-kappa-B-activating protein ELISA Kit

E1027Mo 1 Kit
EUR 632

Human NKAP/ NF-kappa-B-activating protein ELISA Kit

E1747Hu 1 Kit
EUR 605

Human NKAP(NF-kappa-B-activating protein) ELISA Kit

EH1507 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q8N5F7
  • Alias: NKAP(NF-kappa-B-activating protein)
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Mouse NF- kappa- B- activating protein, Nkap ELISA KIT

ELI-13129m 96 Tests
EUR 865

Human NF- kappa- B- activating protein, NKAP ELISA KIT

ELI-22119h 96 Tests
EUR 824

Mouse NF-kappa-B-activating protein (NKAP) ELISA Kit

abx516445-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Nkap ELISA Kit| Mouse NF-kappa-B-activating protein ELISA Kit

EF015681 96 Tests
EUR 689

Chicken Nuclear Factor Kappa B (NFkB) ELISA Kit

DLR-NFkB-Ch-48T 48T
EUR 528
  • Should the Chicken Nuclear Factor Kappa B (NFkB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Chicken Nuclear Factor Kappa B (NFkB) in samples from tissue homogenates, cell lysates or other biological fluids.

Chicken Nuclear Factor Kappa B (NFkB) ELISA Kit

DLR-NFkB-Ch-96T 96T
EUR 690
  • Should the Chicken Nuclear Factor Kappa B (NFkB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Chicken Nuclear Factor Kappa B (NFkB) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Nuclear Factor Kappa B (NFkB) ELISA Kit

DLR-NFkB-Hu-48T 48T
EUR 498
  • Should the Human Nuclear Factor Kappa B (NFkB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Nuclear Factor Kappa B (NFkB) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Nuclear Factor Kappa B (NFkB) ELISA Kit

DLR-NFkB-Hu-96T 96T
EUR 647
  • Should the Human Nuclear Factor Kappa B (NFkB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Nuclear Factor Kappa B (NFkB) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Nuclear Factor Kappa B (NFkB) ELISA Kit

DLR-NFkB-Mu-48T 48T
EUR 450
  • Should the Mouse Nuclear Factor Kappa B (NFkB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Nuclear Factor Kappa B (NFkB) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Nuclear Factor Kappa B (NFkB) ELISA Kit

DLR-NFkB-Mu-96T 96T
EUR 582
  • Should the Mouse Nuclear Factor Kappa B (NFkB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Nuclear Factor Kappa B (NFkB) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Chicken Nuclear Factor Kappa B (NFkB) ELISA Kit

RDR-NFkB-Ch-48Tests 48 Tests
EUR 558

Chicken Nuclear Factor Kappa B (NFkB) ELISA Kit

RDR-NFkB-Ch-96Tests 96 Tests
EUR 776

Human Nuclear Factor Kappa B (NFkB) ELISA Kit

RDR-NFkB-Hu-48Tests 48 Tests
EUR 522

Human Nuclear Factor Kappa B (NFkB) ELISA Kit

RDR-NFkB-Hu-96Tests 96 Tests
EUR 724

Mouse Nuclear Factor Kappa B (NFkB) ELISA Kit

RDR-NFkB-Mu-48Tests 48 Tests
EUR 465

Mouse Nuclear Factor Kappa B (NFkB) ELISA Kit

RDR-NFkB-Mu-96Tests 96 Tests
EUR 643

Chicken Nuclear Factor Kappa B (NFkB) ELISA Kit

RD-NFkB-Ch-48Tests 48 Tests
EUR 534

Chicken Nuclear Factor Kappa B (NFkB) ELISA Kit

RD-NFkB-Ch-96Tests 96 Tests
EUR 742

Human Nuclear Factor Kappa B (NFkB) ELISA Kit

RD-NFkB-Hu-48Tests 48 Tests
EUR 500

Human Nuclear Factor Kappa B (NFkB) ELISA Kit

RD-NFkB-Hu-96Tests 96 Tests
EUR 692

Mouse Nuclear Factor Kappa B (NFkB) ELISA Kit

RD-NFkB-Mu-48Tests 48 Tests
EUR 446

Mouse Nuclear Factor Kappa B (NFkB) ELISA Kit

RD-NFkB-Mu-96Tests 96 Tests
EUR 615

NF-Kappa-B-Activating Protein (NKAP) Antibody

abx026787-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

NF-Kappa-B-Activating Protein (NKAP) Antibody

abx026787-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

NF-Kappa-B-Activating Protein (NKAP) Antibody

20-abx217178
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human NF-kappa-B-activating protein (NKAP) CLIA Kit

20-abx495467
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat NFkB ELISA Kit

ERN0018 96Tests
EUR 521

NKAP Recombinant Protein (Rat)

RP213986 100 ug Ask for price

Human NKAP ELISA Kit

ELA-E13391h 96 Tests
EUR 824

NKAP ELISA KIT|Human

EF005403 96 Tests
EUR 689

Rat NFkB p65 ELISA Kit

ERN0028 96Tests
EUR 521

Human NKAP- like protein, NKAPL ELISA KIT

ELI-13657h 96 Tests
EUR 824

Rat NKAP shRNA Plasmid

20-abx988918
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

NKAP Antibody

45687-100ul 100ul
EUR 252

NKAP Antibody

45687-50ul 50ul
EUR 187

NKAP Antibody

DF9069 200ul
EUR 304
Description: NKAP Antibody detects endogenous levels of total NKAP.

NKAP siRNA

20-abx903568
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NKAP siRNA

20-abx925951
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NKAP siRNA

20-abx925952
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NKAP Antibody

ABD9069 100 ug
EUR 438

Human NFkB ELISA Kit

EHN0018 96Tests
EUR 521

Bovine NFkB ELISA Kit

EBN0018 96Tests
EUR 521

Anserini NFkB ELISA Kit

EAN0018 96Tests
EUR 521

Chicken NFkB ELISA Kit

ECKN0018 96Tests
EUR 521

Canine NFkB ELISA Kit

ECN0018 96Tests
EUR 521

Goat NFkB ELISA Kit

EGTN0018 96Tests
EUR 521

Porcine NFkB ELISA Kit

EPN0018 96Tests
EUR 521

Sheep NFkB ELISA Kit

ESN0018 96Tests
EUR 521

Rabbit NFkB ELISA Kit

ERTN0018 96Tests
EUR 521

Monkey NFkB ELISA Kit

EMKN0018 96Tests
EUR 521

Mouse NFkB ELISA Kit

EMN0018 96Tests
EUR 521

NKAP Recombinant Protein (Human)

RP021271 100 ug Ask for price

NKAP Recombinant Protein (Human)

RP021274 100 ug Ask for price

NKAP Recombinant Protein (Mouse)

RP154202 100 ug Ask for price

Nkap ORF Vector (Rat) (pORF)

ORF071330 1.0 ug DNA
EUR 506

Rat NFKB 65

QY-E11918 96T
EUR 374

NKAP Protein Vector (Rat) (pPB-C-His)

PV285318 500 ng
EUR 603

NKAP Protein Vector (Rat) (pPB-N-His)

PV285319 500 ng
EUR 603

NKAP Protein Vector (Rat) (pPM-C-HA)

PV285320 500 ng
EUR 603

NKAP Protein Vector (Rat) (pPM-C-His)

PV285321 500 ng
EUR 603

Rat Neutrophil activating protein 2 ELISA kit

E02N0072-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Neutrophil activating protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Neutrophil activating protein 2 ELISA kit

E02N0072-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Neutrophil activating protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Neutrophil activating protein 2 ELISA kit

E02N0072-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Neutrophil activating protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Phospholipase A1 Activating Protein ELISA kit

E02P0125-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Phospholipase A1 Activating Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Phospholipase A1 Activating Protein ELISA kit

E02P0125-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Phospholipase A1 Activating Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Phospholipase A1 Activating Protein ELISA kit

E02P0125-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Phospholipase A1 Activating Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ras GTPase Activating Protein ELISA kit

E02R0029-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Ras GTPase Activating Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ras GTPase Activating Protein ELISA kit

E02R0029-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Ras GTPase Activating Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ras GTPase Activating Protein ELISA kit

E02R0029-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Ras GTPase Activating Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea Pig NFkB ELISA Kit

EGN0018 96Tests
EUR 521

Human NFkB p65 ELISA Kit

EHN0028 96Tests
EUR 521

Bovine NFkB p65 ELISA Kit

EBN0028 96Tests
EUR 521

Anserini NFkB p65 ELISA Kit

EAN0028 96Tests
EUR 521

Chicken NFkB p65 ELISA Kit

ECKN0028 96Tests
EUR 521

Canine NFkB p65 ELISA Kit

ECN0028 96Tests
EUR 521

Goat NFkB p65 ELISA Kit

EGTN0028 96Tests
EUR 521

Porcine NFkB p65 ELISA Kit

EPN0028 96Tests
EUR 521

Sheep NFkB p65 ELISA Kit

ESN0028 96Tests
EUR 521

Rabbit NFkB p65 ELISA Kit

ERTN0028 96Tests
EUR 521

Monkey NFkB p65 ELISA Kit

EMKN0028 96Tests
EUR 521

Mouse NFkB p65 ELISA Kit

EMN0028 96Tests
EUR 521

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

NKAP Rabbit pAb

A13748-100ul 100 ul
EUR 308

NKAP Rabbit pAb

A13748-200ul 200 ul
EUR 459

NKAP Rabbit pAb

A13748-20ul 20 ul
EUR 183

NKAP Rabbit pAb

A13748-50ul 50 ul
EUR 223

NKAP Blocking Peptide

DF9069-BP 1mg
EUR 195

NKAP Conjugated Antibody

C45687 100ul
EUR 397

NKAP cloning plasmid

CSB-CL847637HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1248
  • Sequence: atggctccggtgtccggctcacgcagcccggatagggaggcctcgggctcggggggaagacgtcgcagttcgtcgaagagtccgaagcccagcaaatctgcccgctccccgcggggccgccgctctcgctcgcactcttgctctcggtccggggaccggaatggactcacccatc
  • Show more
Description: A cloning plasmid for the NKAP gene.

NKAP cloning plasmid

CSB-CL847637HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1248
  • Sequence: atggctccggtgtccggctcacgcagcccggatagggaggcctcgggctcggggggaagacgtcgcagttcgtcgaagagtccgaagcccagcaaatctgcccgctccccgcggggccgccgctctcgctcgcactcttgctctcggtccggggaccggaatggactcacccatc
  • Show more
Description: A cloning plasmid for the NKAP gene.

NKAP Polyclonal Antibody

ABP59470-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human NKAP protein at amino acid sequence of 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of NKAP from Human. This NKAP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NKAP protein at amino acid sequence of 10-90

NKAP Polyclonal Antibody

ABP59470-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human NKAP protein at amino acid sequence of 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of NKAP from Human. This NKAP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NKAP protein at amino acid sequence of 10-90

NKAP Polyclonal Antibody

ABP59470-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NKAP protein at amino acid sequence of 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of NKAP from Human. This NKAP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NKAP protein at amino acid sequence of 10-90

NKAP Polyclonal Antibody

ES9264-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NKAP from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

NKAP Polyclonal Antibody

ES9264-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NKAP from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

pENTR223-NKAP vector

PVT12090 2 ug
EUR 308

pCMV-SPORT6-NKAP

PVT13487 2 ug
EUR 391

Anti-NKAP antibody

STJ115697 100 µl
EUR 277
Description: This gene encodes a protein that is involved in the activation of the ubiquitous transcription factor NF-kappaB. This protein is associated with the the histone deacetylase HDAC3 and with the Notch corepressor complex, and it thereby acts as a transcriptional repressor of Notch target genes. It is also required for alphabeta T cell development. A related pseudogene has been identified on chromosome X, while a related and intronless retrocopy, which has an intact CDS and may be functional, is located on chromosome 6.

Anti-NKAP antibody

STJ190422 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NKAP

Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol)

RAT-5 1
EUR 1138

Recombinant human NKAP-like protein

P1309 100ug Ask for price
  • Uniprot ID: Q5M9Q1
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human NKAP-like protein

Rat Nuclear Factor kappa B (NFkB) ELISA Kit

20-abx155891
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Nuclear Factor Kappa B (NFkB) ELISA Kit

SEB824Ra-10x96wellstestplate 10x96-wells test plate
EUR 4875.49
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Nuclear Factor Kappa B (NFkB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Nuclear Factor Kappa B (NFkB) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Nuclear Factor Kappa B (NFkB) ELISA Kit

SEB824Ra-1x48wellstestplate 1x48-wells test plate
EUR 489.16
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Nuclear Factor Kappa B (NFkB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Nuclear Factor Kappa B (NFkB) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Nuclear Factor Kappa B (NFkB) ELISA Kit

SEB824Ra-1x96wellstestplate 1x96-wells test plate
EUR 655.94
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Nuclear Factor Kappa B (NFkB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Nuclear Factor Kappa B (NFkB) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Nuclear Factor Kappa B (NFkB) ELISA Kit

SEB824Ra-5x96wellstestplate 5x96-wells test plate
EUR 2651.73
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Nuclear Factor Kappa B (NFkB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Nuclear Factor Kappa B (NFkB) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Nuclear Factor Kappa B (NFkB) ELISA Kit

4-SEB824Ra
  • EUR 4926.00
  • EUR 2602.00
  • EUR 656.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Nuclear Factor Kappa B elisa. Alternative names of the recognized antigen: NF-KB1
  • EBP-1
  • KBF1
  • NF-Kappa-B
  • NFKB-P105
  • NFKB-P50
  • Nuclear Factor Of Kappa Light Polypeptide Gene Enhancer In B-Cells 1
  • Nuclear factor NF-kappa-B p105 subuni
  • Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Nuclear Factor Kappa B (NFkB) in samples from tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Nuclear Factor Kappa B ELISA Kit (NFkB)

RK03838 96 Tests
EUR 521

Nkap sgRNA CRISPR Lentivector set (Rat)

K6259601 3 x 1.0 ug
EUR 339

Rat Platelet activating factor ELISA kit

E02P0589-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Platelet activating factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Platelet activating factor ELISA kit

E02P0589-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Platelet activating factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Platelet activating factor ELISA kit

E02P0589-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Platelet activating factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

FLAP ELISA Kit| Rat 5-Lipoxygenase Activating Protein ELISA Kit

EF017730 96 Tests
EUR 689

GAP ELISA Kit| Rat Ras Gtpase Activating Protein ELISA Kit

EF017749 96 Tests
EUR 689

Rat Neutrophil Activating Protein 3 (NAP3) ELISA Kit

DLR-NAP3-Ra-48T 48T
EUR 376
  • Should the Rat Neutrophil Activating Protein 3 (NAP3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Neutrophil Activating Protein 3 (NAP3) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Neutrophil Activating Protein 3 (NAP3) ELISA Kit

DLR-NAP3-Ra-96T 96T
EUR 479
  • Should the Rat Neutrophil Activating Protein 3 (NAP3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Neutrophil Activating Protein 3 (NAP3) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Gamma-Secretase Activating Protein (gSAP) ELISA Kit

DLR-gSAP-Ra-48T 48T
EUR 590
  • Should the Rat Gamma-Secretase Activating Protein (gSAP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Gamma-Secretase Activating Protein (gSAP) in samples from tissue homogenates or other biological fluids.

Rat Gamma-Secretase Activating Protein (gSAP) ELISA Kit

DLR-gSAP-Ra-96T 96T
EUR 774
  • Should the Rat Gamma-Secretase Activating Protein (gSAP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Gamma-Secretase Activating Protein (gSAP) in samples from tissue homogenates or other biological fluids.

Rat gamma Secretase Activating Protein (gSAP) ELISA Kit

20-abx155611
  • EUR 7911.00
  • EUR 4215.00
  • EUR 973.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Ras Gtpase Activating Protein (GAP) ELISA Kit

abx256943-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Rat Phospholipase A2 Activating Protein (PLAA) ELISA Kit

abx391806-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat FLAP(5-Lipoxygenase Activating Protein) ELISA Kit

ER0955 96T
EUR 524.1
  • Detection range: 15.625-1000 pg/ml
  • Uniprot ID: P20291
  • Alias: FLAP
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 9.375pg/ml

Rat GAP(Ras Gtpase Activating Protein) ELISA Kit

ER0977 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P50904
  • Alias: GAP
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.094 ng/ml

Rat Neutrophil Activating Protein 3(NAP3)ELISA kit

QY-E10212 96T
EUR 361

Rat Phospholipase A2 Activating Protein(PLAA)ELISA kit

QY-E10546 96T
EUR 413

Rat Neutrophil Activating Protein 3 (NAP3) ELISA Kit

SEA041Ra-10x96wellstestplate 10x96-wells test plate
EUR 3016.71
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neutrophil Activating Protein 3 (NAP3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Neutrophil Activating Protein 3 (NAP3) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Neutrophil Activating Protein 3 (NAP3) ELISA Kit

SEA041Ra-1x48wellstestplate 1x48-wells test plate
EUR 336.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neutrophil Activating Protein 3 (NAP3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Neutrophil Activating Protein 3 (NAP3) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Neutrophil Activating Protein 3 (NAP3) ELISA Kit

SEA041Ra-1x96wellstestplate 1x96-wells test plate
EUR 437.26
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neutrophil Activating Protein 3 (NAP3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Neutrophil Activating Protein 3 (NAP3) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Neutrophil Activating Protein 3 (NAP3) ELISA Kit

SEA041Ra-5x96wellstestplate 5x96-wells test plate
EUR 1667.67
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neutrophil Activating Protein 3 (NAP3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Neutrophil Activating Protein 3 (NAP3) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Neutrophil Activating Protein 3 (NAP3) ELISA Kit

4-SEA041Ra
  • EUR 3067.00
  • EUR 1618.00
  • EUR 438.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Neutrophil Activating Protein 3 elisa. Alternative names of the recognized antigen: CXCL1
  • GRO1
  • GROa
  • GRO-A
  • MGSA-A
  • NAP3
  • SCYB1
  • Chemokine C-X-C-Motif Ligand 1
  • Melanoma Growth Stimulating Activity Alpha
  • Fibroblast Secretory Protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Neutrophil Activating Protein 3 (NAP3) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Gamma-Secretase Activating Protein (gSAP) ELISA Kit

RDR-gSAP-Ra-48Tests 48 Tests
EUR 631

Rat Gamma-Secretase Activating Protein (gSAP) ELISA Kit

RDR-gSAP-Ra-96Tests 96 Tests
EUR 880

Rat Neutrophil Activating Protein 3 (NAP3) ELISA Kit

RDR-NAP3-Ra-48Tests 48 Tests
EUR 377

Rat Neutrophil Activating Protein 3 (NAP3) ELISA Kit

RDR-NAP3-Ra-96Tests 96 Tests
EUR 518

Rat Neutrophil Activating Protein 3 ELISA Kit (NAP3)

RK04051 96 Tests
EUR 521

Rat Gamma-Secretase Activating Protein (gSAP) ELISA Kit

RD-gSAP-Ra-48Tests 48 Tests
EUR 603

Rat Gamma-Secretase Activating Protein (gSAP) ELISA Kit

RD-gSAP-Ra-96Tests 96 Tests
EUR 840

Rat Neutrophil Activating Protein 3 (NAP3) ELISA Kit

RD-NAP3-Ra-48Tests 48 Tests
EUR 362

Rat Neutrophil Activating Protein 3 (NAP3) ELISA Kit

RD-NAP3-Ra-96Tests 96 Tests
EUR 495

Rat Gamma-Secretase Activating Protein (gSAP) ELISA Kit

SER761Ra-10x96wellstestplate 10x96-wells test plate
EUR 5621.62
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Gamma-Secretase Activating Protein (gSAP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Gamma-Secretase Activating Protein (gSAP) in Tissue homogenates and other biological fluids.

Rat Gamma-Secretase Activating Protein (gSAP) ELISA Kit

SER761Ra-1x48wellstestplate 1x48-wells test plate
EUR 550.6
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Gamma-Secretase Activating Protein (gSAP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Gamma-Secretase Activating Protein (gSAP) in Tissue homogenates and other biological fluids.

Rat Gamma-Secretase Activating Protein (gSAP) ELISA Kit

SER761Ra-1x96wellstestplate 1x96-wells test plate
EUR 743.72
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Gamma-Secretase Activating Protein (gSAP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Gamma-Secretase Activating Protein (gSAP) in Tissue homogenates and other biological fluids.

Rat Gamma-Secretase Activating Protein (gSAP) ELISA Kit

SER761Ra-5x96wellstestplate 5x96-wells test plate
EUR 3046.74
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Gamma-Secretase Activating Protein (gSAP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Gamma-Secretase Activating Protein (gSAP) in Tissue homogenates and other biological fluids.

Rat Gamma-Secretase Activating Protein (gSAP) ELISA Kit

4-SER761Ra
  • EUR 5672.00
  • EUR 2997.00
  • EUR 744.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Gamma-Secretase Activating Protein elisa. Alternative names of the recognized antigen: PION
  • Pigeon Homolog
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Gamma-Secretase Activating Protein (gSAP) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Guinea Pig NFkB p65 ELISA Kit

EGN0028 96Tests
EUR 521

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

ELISA kit for Rat NFkB (Nuclear Factor Kappa B)

ELK5691 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Nuclear Factor Kappa B (NF?B). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Nucl
  • Show more
Description: A sandwich ELISA kit for detection of Nuclear Factor Kappa B from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Mouse NKAP shRNA Plasmid

20-abx975944
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human NKAP shRNA Plasmid

20-abx962402
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NAP-2 ELISA Kit| Rat Neutrophil Activating Protein-2 ELISA Kit

EF017906 96 Tests
EUR 689

NAP-3 ELISA Kit| Rat Neutrophil Activating Protein -3 ELISA Kit

EF017907 96 Tests
EUR 689

Abra ELISA Kit| Rat Actin-binding Rho-activating protein ELISA

EF018276 96 Tests
EUR 689

Arhgap35 ELISA Kit| Rat Rho GTPase-activating protein 35 ELISA

EF018738 96 Tests
EUR 689

Plaa ELISA Kit| Rat Phospholipase A-2-activating protein ELISA

EF019166 96 Tests
EUR 689

ELISA kit for Rat PLA2P (Phospholipase A2 Activating Protein)

E-EL-R0732 1 plate of 96 wells
EUR 534
  • Gentaur's PLA2P ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat PLA2P. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat PLA2P (Phospholipase A2 Activating Protein) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Rat GAP (Ras Gtpase Activating Protein)

E-EL-R0839 1 plate of 96 wells
EUR 534
  • Gentaur's GAP ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat GAP. Standards or samples are added to the micro ELISA plate wells and combined with the sp
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat GAP (Ras Gtpase Activating Protein) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Rat FLAP (5-Lipoxygenase Activating Protein)

E-EL-R1099 1 plate of 96 wells
EUR 534
  • Gentaur's FLAP ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat FLAP. Standards or samples are added to the micro ELISA plate wells and combined with the
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat FLAP (5-Lipoxygenase Activating Protein) in samples from Serum, Plasma, Cell supernatant

Rat Actin binding Rho activating protein(ABRA) ELISA kit

E02A1164-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Actin binding Rho activating protein(ABRA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Actin binding Rho activating protein(ABRA) ELISA kit

E02A1164-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Actin binding Rho activating protein(ABRA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Actin binding Rho activating protein(ABRA) ELISA kit

E02A1164-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Actin binding Rho activating protein(ABRA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Arachidonate 5 lipoxygenase activating protein(ALOX5AP) ELISA kit

E02A1402-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Arachidonate 5 lipoxygenase activating protein(ALOX5AP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Arachidonate 5 lipoxygenase activating protein(ALOX5AP) ELISA kit

E02A1402-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Arachidonate 5 lipoxygenase activating protein(ALOX5AP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Arachidonate 5 lipoxygenase activating protein(ALOX5AP) ELISA kit

E02A1402-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Arachidonate 5 lipoxygenase activating protein(ALOX5AP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat ARF GTPase activating protein GIT1(GIT1) ELISA kit

E02A1874-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat ARF GTPase activating protein GIT1(GIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat ARF GTPase activating protein GIT1(GIT1) ELISA kit

E02A1874-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat ARF GTPase activating protein GIT1(GIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat ARF GTPase activating protein GIT1(GIT1) ELISA kit

E02A1874-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat ARF GTPase activating protein GIT1(GIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat ARF GTPase activating protein GIT2(GIT2) ELISA kit

E02A1875-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat ARF GTPase activating protein GIT2(GIT2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat ARF GTPase activating protein GIT2(GIT2) ELISA kit

E02A1875-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat ARF GTPase activating protein GIT2(GIT2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat ARF GTPase activating protein GIT2(GIT2) ELISA kit

E02A1875-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat ARF GTPase activating protein GIT2(GIT2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Rho GTPase activating protein 15(ARHGAP15) ELISA kit

E02R0367-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Rho GTPase activating protein 15(ARHGAP15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Rho GTPase activating protein 15(ARHGAP15) ELISA kit

E02R0367-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Rho GTPase activating protein 15(ARHGAP15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Rho GTPase activating protein 15(ARHGAP15) ELISA kit

E02R0367-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Rho GTPase activating protein 15(ARHGAP15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Rho GTPase activating protein 19(ARHGAP19) ELISA kit

E02R0368-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Rho GTPase activating protein 19(ARHGAP19) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Rho GTPase activating protein 19(ARHGAP19) ELISA kit

E02R0368-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Rho GTPase activating protein 19(ARHGAP19) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Rho GTPase activating protein 19(ARHGAP19) ELISA kit

E02R0368-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Rho GTPase activating protein 19(ARHGAP19) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Rho GTPase activating protein 26(ARHGAP26) ELISA kit

E02R0369-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Rho GTPase activating protein 26(ARHGAP26) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Rho GTPase activating protein 26(ARHGAP26) ELISA kit

E02R0369-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Rho GTPase activating protein 26(ARHGAP26) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Rho GTPase activating protein 26(ARHGAP26) ELISA kit

E02R0369-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Rho GTPase activating protein 26(ARHGAP26) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Arachidonate 5-Lipoxygenase Activating Protein (ALOX5AP) ELISA Kit

abx256923-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

ELISA kit for Rat NF-kappa-B-activating protein

EK3216 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat NF-kappa-B-activating protein in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Rat NAP3 (Neutrophil Activating Protein 3)

ELK1237 1 plate of 96 wells
EUR 372
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Neutrophil Activating Protein 3 (NAP3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specifi
  • Show more
Description: A sandwich ELISA kit for detection of Neutrophil Activating Protein 3 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Rat neutrophil activating protein-2,NAP-2 ELISA Kit

CN-01949R1 96T
EUR 471

Rat neutrophil activating protein-2,NAP-2 ELISA Kit

CN-01949R2 48T
EUR 322

Rat ARF GTPase Activating Protein GIT1 (GIT1) ELISA Kit

abx391381-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Rho GTPase Activating Protein 35 (ARHGAP35) ELISA Kit

abx391382-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Phospholipase A2 Activating Protein / PLA2P (PLAA) ELISA Kit

abx353835-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Rat Actin Binding Rho Activating Protein (ABRA) ELISA Kit

abx390923-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

ELISA kit for Rat gSAP (Gamma-Secretase Activating Protein)

ELK8025 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Gamma-Secretase Activating Protein (?SAP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody spec
  • Show more
Description: A sandwich ELISA kit for detection of Gamma-Secretase Activating Protein from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Rat NAP-2(Neutrophil Activating Protein-2) ELISA Kit

ER1178 96T
EUR 524.1
  • Detection range: 156.25-10000 pg/ml
  • Alias: NAP-2/CXCL7/CTAP III/PPBP/connective tissue-activating peptide III/CTAP3CTAP-III/CXC chemokine ligand 7/C-X-C motif chemokine 7/CXCL7b-TG1/LA-PF4/LDGFTC1/Leukocyte-derived growth factor/low-affinity platelet
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 93.75pg/ml

Rat neutrophil activating protein-2(NAP-2)ELISA Kit

GA-E0771RT-48T 48T
EUR 317

Rat neutrophil activating protein-2(NAP-2)ELISA Kit

GA-E0771RT-96T 96T
EUR 496

ELISA kit for Rat Gamma-Secretase Activating Protein (GSAP)

KTE100915-48T 48T
EUR 354
  • Formation of amyloid-beta is catalyzed by gamma-secretase, a protease with numerous substrates. PION, or GSAP, selectively increases amyloid-beta production through a mechanism involving its interaction with both gamma-secretase and its substrate, th
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Gamma-Secretase Activating Protein (GSAP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Gamma-Secretase Activating Protein (GSAP)

KTE100915-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Formation of amyloid-beta is catalyzed by gamma-secretase, a protease with numerous substrates. PION, or GSAP, selectively increases amyloid-beta production through a mechanism involving its interaction with both gamma-secretase and its substrate, th
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Gamma-Secretase Activating Protein (GSAP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Gamma-Secretase Activating Protein (GSAP)

KTE100915-96T 96T
EUR 572
  • Formation of amyloid-beta is catalyzed by gamma-secretase, a protease with numerous substrates. PION, or GSAP, selectively increases amyloid-beta production through a mechanism involving its interaction with both gamma-secretase and its substrate, th
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Gamma-Secretase Activating Protein (GSAP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Rat neutrophil activating protein-2(NAP-2)ELISA Kit

QY-E10881 96T
EUR 361

PAF ELISA Kit| Rat Platelet Activating Factor ELISA Kit

EF017941 96 Tests
EUR 689

Nkap sgRNA CRISPR Lentivector (Rat) (Target 1)

K6259602 1.0 ug DNA
EUR 154

Nkap sgRNA CRISPR Lentivector (Rat) (Target 2)

K6259603 1.0 ug DNA
EUR 154

Nkap sgRNA CRISPR Lentivector (Rat) (Target 3)

K6259604 1.0 ug DNA
EUR 154

Rat Glia-activating factor(FGF9) ELISA kit

E02G0407-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Glia-activating factor(FGF9) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Glia-activating factor(FGF9) ELISA kit

E02G0407-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Glia-activating factor(FGF9) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Glia-activating factor(FGF9) ELISA kit

E02G0407-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Glia-activating factor(FGF9) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Platelet activating factor receptor ELISA kit

E02P0037-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Platelet activating factor receptor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Platelet activating factor receptor ELISA kit

E02P0037-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Platelet activating factor receptor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Platelet activating factor receptor ELISA kit

E02P0037-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Platelet activating factor receptor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.