Rat NKAP(NFKB Activating Protein) ELISA Kit
To Order Contact us: Mark@operatiebrp.nl
Rat NFKB Activating Protein (NKAP) ELISA Kit |
RDR-NKAP-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 811 |
Rat NFKB Activating Protein (NKAP) ELISA Kit |
RD-NKAP-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Rat NFKB Activating Protein (NKAP) ELISA Kit |
RD-NKAP-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 775 |
Human NFKB Activating Protein (NKAP) ELISA Kit |
DLR-NKAP-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human NFKB Activating Protein (NKAP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human NFKB Activating Protein (NKAP) in samples from tissue homogenates or other biological fluids. |
Human NFKB Activating Protein (NKAP) ELISA Kit |
DLR-NKAP-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human NFKB Activating Protein (NKAP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human NFKB Activating Protein (NKAP) in samples from tissue homogenates or other biological fluids. |
Mouse NFKB Activating Protein (NKAP) ELISA Kit |
DLR-NKAP-Mu-48T |
DL Develop |
48T |
EUR 527 |
- Should the Mouse NFKB Activating Protein (NKAP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse NFKB Activating Protein (NKAP) in samples from tissue homogenates or other biological fluids. |
Mouse NFKB Activating Protein (NKAP) ELISA Kit |
DLR-NKAP-Mu-96T |
DL Develop |
96T |
EUR 688 |
- Should the Mouse NFKB Activating Protein (NKAP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse NFKB Activating Protein (NKAP) in samples from tissue homogenates or other biological fluids. |
Human NFKB Activating Protein (NKAP) ELISA Kit |
RDR-NKAP-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human NFKB Activating Protein (NKAP) ELISA Kit |
RDR-NKAP-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Mouse NFKB Activating Protein (NKAP) ELISA Kit |
RDR-NKAP-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse NFKB Activating Protein (NKAP) ELISA Kit |
RDR-NKAP-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
Human NFKB Activating Protein (NKAP) ELISA Kit |
RD-NKAP-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human NFKB Activating Protein (NKAP) ELISA Kit |
RD-NKAP-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Mouse NFKB Activating Protein (NKAP) ELISA Kit |
RD-NKAP-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse NFKB Activating Protein (NKAP) ELISA Kit |
RD-NKAP-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Rat NFKB Activating Protein (NKAP) ELISA Kit |
20-abx155896 |
Abbexa |
-
EUR 7237.00
-
EUR 3855.00
-
EUR 895.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Rat NFKB Activating Protein (NKAP) ELISA Kit |
SEH538Ra-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5124.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat NFKB Activating Protein (NKAP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat NFKB Activating Protein (NKAP) in Tissue homogenates and other biological fluids. |
Rat NFKB Activating Protein (NKAP) ELISA Kit |
SEH538Ra-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 509.64 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat NFKB Activating Protein (NKAP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat NFKB Activating Protein (NKAP) in Tissue homogenates and other biological fluids. |
Rat NFKB Activating Protein (NKAP) ELISA Kit |
SEH538Ra-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 685.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat NFKB Activating Protein (NKAP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat NFKB Activating Protein (NKAP) in Tissue homogenates and other biological fluids. |
Rat NFKB Activating Protein (NKAP) ELISA Kit |
SEH538Ra-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2783.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat NFKB Activating Protein (NKAP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat NFKB Activating Protein (NKAP) in Tissue homogenates and other biological fluids. |
Rat NFKB Activating Protein (NKAP) ELISA Kit |
4-SEH538Ra |
Cloud-Clone |
-
EUR 5175.00
-
EUR 2734.00
-
EUR 686.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as NFKB Activating Protein elisa. Alternative names of the recognized antigen: NF Kappa B Activating Protein
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat NFKB Activating Protein (NKAP) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Rat NFKB Activating Protein (NKAP) Protein |
20-abx654558 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Rat NFKB Activating Protein (NKAP) CLIA Kit |
20-abx495468 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
NFKB Activating Protein (NKAP) Antibody |
20-abx177804 |
Abbexa |
|
|
|
NFKB Activating Protein (NKAP) Antibody |
20-abx173819 |
Abbexa |
|
|
|
ELISA kit for Rat NKAP (NFKB Activating Protein) |
ELK7219 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to NFKB Activating Protein (NKAP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to NFK
- Show more
|
Description: A sandwich ELISA kit for detection of NFKB Activating Protein from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human NFKB Activating Protein (NKAP) ELISA Kit |
SEH538Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human NFKB Activating Protein (NKAP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human NFKB Activating Protein (NKAP) in Tissue homogenates, cell lysates and other biological fluids. |
Human NFKB Activating Protein (NKAP) ELISA Kit |
SEH538Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human NFKB Activating Protein (NKAP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human NFKB Activating Protein (NKAP) in Tissue homogenates, cell lysates and other biological fluids. |
Human NFKB Activating Protein (NKAP) ELISA Kit |
SEH538Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human NFKB Activating Protein (NKAP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human NFKB Activating Protein (NKAP) in Tissue homogenates, cell lysates and other biological fluids. |
Human NFKB Activating Protein (NKAP) ELISA Kit |
SEH538Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human NFKB Activating Protein (NKAP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human NFKB Activating Protein (NKAP) in Tissue homogenates, cell lysates and other biological fluids. |
Human NFKB Activating Protein (NKAP) ELISA Kit |
4-SEH538Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as NFKB Activating Protein elisa. Alternative names of the recognized antigen: NF Kappa B Activating Protein
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human NFKB Activating Protein (NKAP) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
ELISA kit for Human NKAP (NFKB Activating Protein) |
ELK5265 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to NFKB Activating Protein (NKAP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to NFK
- Show more
|
Description: A sandwich ELISA kit for detection of NFKB Activating Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Rat Nkap/ NF-kappa-B-activating protein ELISA Kit |
E0672Ra |
Sunlong |
1 Kit |
EUR 646 |
Rat NF-kappa-B-activating protein (NKAP) ELISA Kit |
abx256487-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Rat Nkap(NF-kappa-B-activating protein) ELISA Kit |
ER0510 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 78-5000 pg/ml
- Uniprot ID: Q4V7C9
- Alias: Nkap
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 46.9pg/ml |
Nkap ELISA Kit| Rat NF-kappa-B-activating protein ELISA Kit |
EF017347 |
Lifescience Market |
96 Tests |
EUR 689 |
Rat Nuclear Factor Kappa B (NFkB) ELISA Kit |
DLR-NFkB-Ra-48T |
DL Develop |
48T |
EUR 528 |
- Should the Rat Nuclear Factor Kappa B (NFkB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Nuclear Factor Kappa B (NFkB) in samples from tissue homogenates, cell lysates or other biological fluids. |
Rat Nuclear Factor Kappa B (NFkB) ELISA Kit |
DLR-NFkB-Ra-96T |
DL Develop |
96T |
EUR 690 |
- Should the Rat Nuclear Factor Kappa B (NFkB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Nuclear Factor Kappa B (NFkB) in samples from tissue homogenates, cell lysates or other biological fluids. |
Rat Nuclear Factor Kappa B (NFkB) ELISA Kit |
RDR-NFkB-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 558 |
Rat Nuclear Factor Kappa B (NFkB) ELISA Kit |
RDR-NFkB-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 776 |
Rat Nuclear Factor Kappa B (NFkB) ELISA Kit |
RD-NFkB-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 534 |
Rat Nuclear Factor Kappa B (NFkB) ELISA Kit |
RD-NFkB-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 742 |
Human NF-kappa-B-activating protein (NKAP) ELISA Kit |
20-abx156948 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human NF-kappa-B-activating protein (NKAP) ELISA Kit |
abx250790-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Mouse Nkap/ NF-kappa-B-activating protein ELISA Kit |
E1027Mo |
Sunlong |
1 Kit |
EUR 632 |
Human NKAP/ NF-kappa-B-activating protein ELISA Kit |
E1747Hu |
Sunlong |
1 Kit |
EUR 605 |
Human NKAP(NF-kappa-B-activating protein) ELISA Kit |
EH1507 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: Q8N5F7
- Alias: NKAP(NF-kappa-B-activating protein)
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Mouse NF- kappa- B- activating protein, Nkap ELISA KIT |
ELI-13129m |
Lifescience Market |
96 Tests |
EUR 865 |
Human NF- kappa- B- activating protein, NKAP ELISA KIT |
ELI-22119h |
Lifescience Market |
96 Tests |
EUR 824 |
Mouse NF-kappa-B-activating protein (NKAP) ELISA Kit |
abx516445-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Nkap ELISA Kit| Mouse NF-kappa-B-activating protein ELISA Kit |
EF015681 |
Lifescience Market |
96 Tests |
EUR 689 |
Chicken Nuclear Factor Kappa B (NFkB) ELISA Kit |
DLR-NFkB-Ch-48T |
DL Develop |
48T |
EUR 528 |
- Should the Chicken Nuclear Factor Kappa B (NFkB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Chicken Nuclear Factor Kappa B (NFkB) in samples from tissue homogenates, cell lysates or other biological fluids. |
Chicken Nuclear Factor Kappa B (NFkB) ELISA Kit |
DLR-NFkB-Ch-96T |
DL Develop |
96T |
EUR 690 |
- Should the Chicken Nuclear Factor Kappa B (NFkB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Chicken Nuclear Factor Kappa B (NFkB) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Nuclear Factor Kappa B (NFkB) ELISA Kit |
DLR-NFkB-Hu-48T |
DL Develop |
48T |
EUR 498 |
- Should the Human Nuclear Factor Kappa B (NFkB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Nuclear Factor Kappa B (NFkB) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Nuclear Factor Kappa B (NFkB) ELISA Kit |
DLR-NFkB-Hu-96T |
DL Develop |
96T |
EUR 647 |
- Should the Human Nuclear Factor Kappa B (NFkB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Nuclear Factor Kappa B (NFkB) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Mouse Nuclear Factor Kappa B (NFkB) ELISA Kit |
DLR-NFkB-Mu-48T |
DL Develop |
48T |
EUR 450 |
- Should the Mouse Nuclear Factor Kappa B (NFkB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Nuclear Factor Kappa B (NFkB) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Mouse Nuclear Factor Kappa B (NFkB) ELISA Kit |
DLR-NFkB-Mu-96T |
DL Develop |
96T |
EUR 582 |
- Should the Mouse Nuclear Factor Kappa B (NFkB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Nuclear Factor Kappa B (NFkB) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Chicken Nuclear Factor Kappa B (NFkB) ELISA Kit |
RDR-NFkB-Ch-48Tests |
Reddot Biotech |
48 Tests |
EUR 558 |
Chicken Nuclear Factor Kappa B (NFkB) ELISA Kit |
RDR-NFkB-Ch-96Tests |
Reddot Biotech |
96 Tests |
EUR 776 |
Human Nuclear Factor Kappa B (NFkB) ELISA Kit |
RDR-NFkB-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 522 |
Human Nuclear Factor Kappa B (NFkB) ELISA Kit |
RDR-NFkB-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 724 |
Mouse Nuclear Factor Kappa B (NFkB) ELISA Kit |
RDR-NFkB-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 465 |
Mouse Nuclear Factor Kappa B (NFkB) ELISA Kit |
RDR-NFkB-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 643 |
Chicken Nuclear Factor Kappa B (NFkB) ELISA Kit |
RD-NFkB-Ch-48Tests |
Reddot Biotech |
48 Tests |
EUR 534 |
Chicken Nuclear Factor Kappa B (NFkB) ELISA Kit |
RD-NFkB-Ch-96Tests |
Reddot Biotech |
96 Tests |
EUR 742 |
Human Nuclear Factor Kappa B (NFkB) ELISA Kit |
RD-NFkB-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Nuclear Factor Kappa B (NFkB) ELISA Kit |
RD-NFkB-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Mouse Nuclear Factor Kappa B (NFkB) ELISA Kit |
RD-NFkB-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 446 |
Mouse Nuclear Factor Kappa B (NFkB) ELISA Kit |
RD-NFkB-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 615 |
NF-Kappa-B-Activating Protein (NKAP) Antibody |
abx026787-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
NF-Kappa-B-Activating Protein (NKAP) Antibody |
abx026787-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
NF-Kappa-B-Activating Protein (NKAP) Antibody |
20-abx217178 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human NF-kappa-B-activating protein (NKAP) CLIA Kit |
20-abx495467 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
NKAP ELISA Kit (Rat) (OKCD09062) |
OKCD09062 |
Aviva Systems Biology |
96 Wells |
EUR 1053 |
Description: Description of target: This gene encodes a protein that is involved in the activation of the ubiquitous transcription factor NF-kappaB. This protein is associated with the the histone deacetylase HDAC3 and with the Notch corepressor complex, and it thereby acts as a transcriptional repressor of Notch target genes. It is also required for alphabeta T cell development. A related pseudogene has been identified on chromosome X, while a related and intronless retrocopy, which has an intact CDS and may be functional, is located on chromosome 6.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 0.061ng/mL |
NKAP ELISA Kit (Rat) (OKEH02302) |
OKEH02302 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
Description: Description of target: ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 40.6 pg/mL |
Rat NFkB ELISA Kit |
ERN0018 |
Abclonal |
96Tests |
EUR 521 |
NKAP Recombinant Protein (Rat) |
RP213986 |
ABM |
100 ug |
Ask for price |
Rat NFkB p65 ELISA Kit |
ERN0028 |
Abclonal |
96Tests |
EUR 521 |
NFkB ELISA Kit (Rat) (OKAN05663) |
OKAN05663 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.114 ng/mL |
NFKB ELISA Kit (Rat) (OKWB00365) |
OKWB00365 |
Aviva Systems Biology |
96 Wells |
EUR 572 |
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Type: Quantitative Sandwich ELISA;Sensitivity: 46.9 pg/mL |
NKAP ELISA Kit (Human) (OKCD09061) |
OKCD09061 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: This gene encodes a protein that is involved in the activation of the ubiquitous transcription factor NF-kappaB. This protein is associated with the the histone deacetylase HDAC3 and with the Notch corepressor complex, and it thereby acts as a transcriptional repressor of Notch target genes. It is also required for alphabeta T cell development. A related pseudogene has been identified on chromosome X, while a related and intronless retrocopy, which has an intact CDS and may be functional, is located on chromosome 6. ;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.065ng/mL |
NKAP ELISA Kit (Mouse) (OKEH05558) |
OKEH05558 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
Description: Description of target: Acts as a transcriptional repressor. Plays a role as a transcriptional corepressor of the Notch-mediated signaling required for T-cell development. Also involved in the TNF and IL-1 induced NF-kappa-B activation. Associates with chromatin at the Notch-regulated SKP2 promoter.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 40.5 pg/mL |
NKAP ELISA Kit (Human) (OKEH02301) |
OKEH02301 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: This gene encodes a protein that is involved in the activation of the ubiquitous transcription factor NF-kappaB. This protein is associated with the the histone deacetylase HDAC3 and with the Notch corepressor complex, and it thereby acts as a transcriptional repressor of Notch target genes. It is also required for alphabeta T cell development. A related pseudogene has been identified on chromosome X, while a related and intronless retrocopy, which has an intact CDS and may be functional, is located on chromosome 6.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.1 ng/mL |
Rat NKAP shRNA Plasmid |
20-abx988918 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
NKAP Antibody |
45687-100ul |
SAB |
100ul |
EUR 252 |
NKAP Antibody |
45687-50ul |
SAB |
50ul |
EUR 187 |
NKAP Antibody |
DF9069 |
Affbiotech |
200ul |
EUR 304 |
Description: NKAP Antibody detects endogenous levels of total NKAP. |
NKAP siRNA |
20-abx903568 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NKAP siRNA |
20-abx925951 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NKAP siRNA |
20-abx925952 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human NFkB ELISA Kit |
EHN0018 |
Abclonal |
96Tests |
EUR 521 |
Bovine NFkB ELISA Kit |
EBN0018 |
Abclonal |
96Tests |
EUR 521 |
Anserini NFkB ELISA Kit |
EAN0018 |
Abclonal |
96Tests |
EUR 521 |
Chicken NFkB ELISA Kit |
ECKN0018 |
Abclonal |
96Tests |
EUR 521 |
Canine NFkB ELISA Kit |
ECN0018 |
Abclonal |
96Tests |
EUR 521 |
Goat NFkB ELISA Kit |
EGTN0018 |
Abclonal |
96Tests |
EUR 521 |
Porcine NFkB ELISA Kit |
EPN0018 |
Abclonal |
96Tests |
EUR 521 |
Sheep NFkB ELISA Kit |
ESN0018 |
Abclonal |
96Tests |
EUR 521 |
Rabbit NFkB ELISA Kit |
ERTN0018 |
Abclonal |
96Tests |
EUR 521 |
Monkey NFkB ELISA Kit |
EMKN0018 |
Abclonal |
96Tests |
EUR 521 |
Mouse NFkB ELISA Kit |
EMN0018 |
Abclonal |
96Tests |
EUR 521 |
NKAP Recombinant Protein (Human) |
RP021271 |
ABM |
100 ug |
Ask for price |
NKAP Recombinant Protein (Human) |
RP021274 |
ABM |
100 ug |
Ask for price |
NKAP Recombinant Protein (Mouse) |
RP154202 |
ABM |
100 ug |
Ask for price |
Nkap ORF Vector (Rat) (pORF) |
ORF071330 |
ABM |
1.0 ug DNA |
EUR 506 |
NKAP Protein Vector (Rat) (pPB-C-His) |
PV285318 |
ABM |
500 ng |
EUR 603 |
NKAP Protein Vector (Rat) (pPB-N-His) |
PV285319 |
ABM |
500 ng |
EUR 603 |
NKAP Protein Vector (Rat) (pPM-C-HA) |
PV285320 |
ABM |
500 ng |
EUR 603 |
NKAP Protein Vector (Rat) (pPM-C-His) |
PV285321 |
ABM |
500 ng |
EUR 603 |
Rat Neutrophil activating protein 2 ELISA kit |
E02N0072-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Neutrophil activating protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Neutrophil activating protein 2 ELISA kit |
E02N0072-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Neutrophil activating protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Neutrophil activating protein 2 ELISA kit |
E02N0072-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Neutrophil activating protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Phospholipase A1 Activating Protein ELISA kit |
E02P0125-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Phospholipase A1 Activating Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Phospholipase A1 Activating Protein ELISA kit |
E02P0125-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Phospholipase A1 Activating Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Phospholipase A1 Activating Protein ELISA kit |
E02P0125-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Phospholipase A1 Activating Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Ras GTPase Activating Protein ELISA kit |
E02R0029-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Ras GTPase Activating Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Ras GTPase Activating Protein ELISA kit |
E02R0029-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Ras GTPase Activating Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Ras GTPase Activating Protein ELISA kit |
E02R0029-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Ras GTPase Activating Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea Pig NFkB ELISA Kit |
EGN0018 |
Abclonal |
96Tests |
EUR 521 |
Human NFkB p65 ELISA Kit |
EHN0028 |
Abclonal |
96Tests |
EUR 521 |
Bovine NFkB p65 ELISA Kit |
EBN0028 |
Abclonal |
96Tests |
EUR 521 |
Anserini NFkB p65 ELISA Kit |
EAN0028 |
Abclonal |
96Tests |
EUR 521 |
Chicken NFkB p65 ELISA Kit |
ECKN0028 |
Abclonal |
96Tests |
EUR 521 |
Canine NFkB p65 ELISA Kit |
ECN0028 |
Abclonal |
96Tests |
EUR 521 |
Goat NFkB p65 ELISA Kit |
EGTN0028 |
Abclonal |
96Tests |
EUR 521 |
Porcine NFkB p65 ELISA Kit |
EPN0028 |
Abclonal |
96Tests |
EUR 521 |
Sheep NFkB p65 ELISA Kit |
ESN0028 |
Abclonal |
96Tests |
EUR 521 |
Rabbit NFkB p65 ELISA Kit |
ERTN0028 |
Abclonal |
96Tests |
EUR 521 |
Monkey NFkB p65 ELISA Kit |
EMKN0028 |
Abclonal |
96Tests |
EUR 521 |
Mouse NFkB p65 ELISA Kit |
EMN0028 |
Abclonal |
96Tests |
EUR 521 |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol) |
RAT-5 |
Alpha Diagnostics |
1 |
EUR 1138 |
NKAP Rabbit pAb |
A13748-100ul |
Abclonal |
100 ul |
EUR 308 |
NKAP Rabbit pAb |
A13748-200ul |
Abclonal |
200 ul |
EUR 459 |
NKAP Rabbit pAb |
A13748-20ul |
Abclonal |
20 ul |
EUR 183 |
NKAP Rabbit pAb |
A13748-50ul |
Abclonal |
50 ul |
EUR 223 |
NKAP Blocking Peptide |
DF9069-BP |
Affbiotech |
1mg |
EUR 195 |
NKAP Conjugated Antibody |
C45687 |
SAB |
100ul |
EUR 397 |
NKAP cloning plasmid |
CSB-CL847637HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1248
- Sequence: atggctccggtgtccggctcacgcagcccggatagggaggcctcgggctcggggggaagacgtcgcagttcgtcgaagagtccgaagcccagcaaatctgcccgctccccgcggggccgccgctctcgctcgcactcttgctctcggtccggggaccggaatggactcacccatc
- Show more
|
Description: A cloning plasmid for the NKAP gene. |
NKAP cloning plasmid |
CSB-CL847637HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1248
- Sequence: atggctccggtgtccggctcacgcagcccggatagggaggcctcgggctcggggggaagacgtcgcagttcgtcgaagagtccgaagcccagcaaatctgcccgctccccgcggggccgccgctctcgctcgcactcttgctctcggtccggggaccggaatggactcacccatc
- Show more
|
Description: A cloning plasmid for the NKAP gene. |
NKAP Polyclonal Antibody |
ABP59470-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human NKAP protein at amino acid sequence of 10-90
- Applications tips:
|
Description: A polyclonal antibody for detection of NKAP from Human. This NKAP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NKAP protein at amino acid sequence of 10-90 |
NKAP Polyclonal Antibody |
ABP59470-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human NKAP protein at amino acid sequence of 10-90
- Applications tips:
|
Description: A polyclonal antibody for detection of NKAP from Human. This NKAP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NKAP protein at amino acid sequence of 10-90 |
NKAP Polyclonal Antibody |
ABP59470-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human NKAP protein at amino acid sequence of 10-90
- Applications tips:
|
Description: A polyclonal antibody for detection of NKAP from Human. This NKAP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NKAP protein at amino acid sequence of 10-90 |
NKAP Polyclonal Antibody |
ES9264-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NKAP from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
NKAP Polyclonal Antibody |
ES9264-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NKAP from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Anti-NKAP antibody |
STJ115697 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a protein that is involved in the activation of the ubiquitous transcription factor NF-kappaB. This protein is associated with the the histone deacetylase HDAC3 and with the Notch corepressor complex, and it thereby acts as a transcriptional repressor of Notch target genes. It is also required for alphabeta T cell development. A related pseudogene has been identified on chromosome X, while a related and intronless retrocopy, which has an intact CDS and may be functional, is located on chromosome 6. |
Anti-NKAP antibody |
STJ190422 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to NKAP |
Recombinant human NKAP-like protein |
P1309 |
FN Test |
100ug |
Ask for price |
- Uniprot ID: Q5M9Q1
- Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
|
Description: Recombinant protein for human NKAP-like protein |
Rat Nuclear Factor kappa B (NFkB) ELISA Kit |
20-abx155891 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Rat Nuclear Factor Kappa B (NFkB) ELISA Kit |
SEB824Ra-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4875.49 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Nuclear Factor Kappa B (NFkB) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Nuclear Factor Kappa B (NFkB) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Nuclear Factor Kappa B (NFkB) ELISA Kit |
SEB824Ra-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 489.16 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Nuclear Factor Kappa B (NFkB) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Nuclear Factor Kappa B (NFkB) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Nuclear Factor Kappa B (NFkB) ELISA Kit |
SEB824Ra-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 655.94 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Nuclear Factor Kappa B (NFkB) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Nuclear Factor Kappa B (NFkB) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Nuclear Factor Kappa B (NFkB) ELISA Kit |
SEB824Ra-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2651.73 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Nuclear Factor Kappa B (NFkB) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Nuclear Factor Kappa B (NFkB) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Nuclear Factor Kappa B (NFkB) ELISA Kit |
4-SEB824Ra |
Cloud-Clone |
-
EUR 4926.00
-
EUR 2602.00
-
EUR 656.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Nuclear Factor Kappa B elisa. Alternative names of the recognized antigen: NF-KB1
- EBP-1
- KBF1
- NF-Kappa-B
- NFKB-P105
- NFKB-P50
- Nuclear Factor Of Kappa Light Polypeptide Gene Enhancer In B-Cells 1
- Nuclear factor NF-kappa-B p105 subuni
- Show more
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Nuclear Factor Kappa B (NFkB) in samples from tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Rat Nuclear Factor Kappa B ELISA Kit (NFkB) |
RK03838 |
Abclonal |
96 Tests |
EUR 521 |
Nkap sgRNA CRISPR Lentivector set (Rat) |
K6259601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Rat Platelet activating factor ELISA kit |
E02P0589-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Platelet activating factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Platelet activating factor ELISA kit |
E02P0589-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Platelet activating factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Platelet activating factor ELISA kit |
E02P0589-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Platelet activating factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Neutrophil Activating Protein 3 (NAP3) ELISA Kit |
DLR-NAP3-Ra-48T |
DL Develop |
48T |
EUR 376 |
- Should the Rat Neutrophil Activating Protein 3 (NAP3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Neutrophil Activating Protein 3 (NAP3) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Rat Neutrophil Activating Protein 3 (NAP3) ELISA Kit |
DLR-NAP3-Ra-96T |
DL Develop |
96T |
EUR 479 |
- Should the Rat Neutrophil Activating Protein 3 (NAP3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Neutrophil Activating Protein 3 (NAP3) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Rat Gamma-Secretase Activating Protein (gSAP) ELISA Kit |
DLR-gSAP-Ra-48T |
DL Develop |
48T |
EUR 590 |
- Should the Rat Gamma-Secretase Activating Protein (gSAP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Gamma-Secretase Activating Protein (gSAP) in samples from tissue homogenates or other biological fluids. |
Rat Gamma-Secretase Activating Protein (gSAP) ELISA Kit |
DLR-gSAP-Ra-96T |
DL Develop |
96T |
EUR 774 |
- Should the Rat Gamma-Secretase Activating Protein (gSAP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Gamma-Secretase Activating Protein (gSAP) in samples from tissue homogenates or other biological fluids. |
Rat gamma Secretase Activating Protein (gSAP) ELISA Kit |
20-abx155611 |
Abbexa |
-
EUR 7911.00
-
EUR 4215.00
-
EUR 973.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Rat Ras Gtpase Activating Protein (GAP) ELISA Kit |
abx256943-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Rat Phospholipase A2 Activating Protein (PLAA) ELISA Kit |
abx391806-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Rat FLAP(5-Lipoxygenase Activating Protein) ELISA Kit |
ER0955 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 15.625-1000 pg/ml
- Uniprot ID: P20291
- Alias: FLAP
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 9.375pg/ml |
Rat GAP(Ras Gtpase Activating Protein) ELISA Kit |
ER0977 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: P50904
- Alias: GAP
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.094 ng/ml |
Rat Phospholipase A2 Activating Protein(PLAA)ELISA kit |
QY-E10546 |
Qayee Biotechnology |
96T |
EUR 413 |
Rat Neutrophil Activating Protein 3 (NAP3) ELISA Kit |
SEA041Ra-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 3016.71 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neutrophil Activating Protein 3 (NAP3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Neutrophil Activating Protein 3 (NAP3) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Neutrophil Activating Protein 3 (NAP3) ELISA Kit |
SEA041Ra-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 336.08 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neutrophil Activating Protein 3 (NAP3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Neutrophil Activating Protein 3 (NAP3) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Neutrophil Activating Protein 3 (NAP3) ELISA Kit |
SEA041Ra-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 437.26 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neutrophil Activating Protein 3 (NAP3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Neutrophil Activating Protein 3 (NAP3) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Neutrophil Activating Protein 3 (NAP3) ELISA Kit |
SEA041Ra-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 1667.67 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neutrophil Activating Protein 3 (NAP3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Neutrophil Activating Protein 3 (NAP3) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Neutrophil Activating Protein 3 (NAP3) ELISA Kit |
4-SEA041Ra |
Cloud-Clone |
-
EUR 3067.00
-
EUR 1618.00
-
EUR 438.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Neutrophil Activating Protein 3 elisa. Alternative names of the recognized antigen: CXCL1
- GRO1
- GROa
- GRO-A
- MGSA-A
- NAP3
- SCYB1
- Chemokine C-X-C-Motif Ligand 1
- Melanoma Growth Stimulating Activity Alpha
- Fibroblast Secretory Protein
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Neutrophil Activating Protein 3 (NAP3) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Rat Gamma-Secretase Activating Protein (gSAP) ELISA Kit |
RDR-gSAP-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 631 |
Rat Gamma-Secretase Activating Protein (gSAP) ELISA Kit |
RDR-gSAP-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 880 |
Rat Neutrophil Activating Protein 3 (NAP3) ELISA Kit |
RDR-NAP3-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 377 |
Rat Neutrophil Activating Protein 3 (NAP3) ELISA Kit |
RDR-NAP3-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 518 |
Rat Neutrophil Activating Protein 3 ELISA Kit (NAP3) |
RK04051 |
Abclonal |
96 Tests |
EUR 521 |
Rat Gamma-Secretase Activating Protein (gSAP) ELISA Kit |
RD-gSAP-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 603 |
Rat Gamma-Secretase Activating Protein (gSAP) ELISA Kit |
RD-gSAP-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 840 |
Rat Neutrophil Activating Protein 3 (NAP3) ELISA Kit |
RD-NAP3-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 362 |
Rat Neutrophil Activating Protein 3 (NAP3) ELISA Kit |
RD-NAP3-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 495 |
Rat Gamma-Secretase Activating Protein (gSAP) ELISA Kit |
SER761Ra-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5621.62 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Gamma-Secretase Activating Protein (gSAP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Ass
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Gamma-Secretase Activating Protein (gSAP) in Tissue homogenates and other biological fluids. |
Rat Gamma-Secretase Activating Protein (gSAP) ELISA Kit |
SER761Ra-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 550.6 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Gamma-Secretase Activating Protein (gSAP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Ass
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Gamma-Secretase Activating Protein (gSAP) in Tissue homogenates and other biological fluids. |
Rat Gamma-Secretase Activating Protein (gSAP) ELISA Kit |
SER761Ra-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 743.72 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Gamma-Secretase Activating Protein (gSAP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Ass
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Gamma-Secretase Activating Protein (gSAP) in Tissue homogenates and other biological fluids. |
Rat Gamma-Secretase Activating Protein (gSAP) ELISA Kit |
SER761Ra-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 3046.74 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Gamma-Secretase Activating Protein (gSAP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Ass
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Gamma-Secretase Activating Protein (gSAP) in Tissue homogenates and other biological fluids. |
Rat Gamma-Secretase Activating Protein (gSAP) ELISA Kit |
4-SER761Ra |
Cloud-Clone |
-
EUR 5672.00
-
EUR 2997.00
-
EUR 744.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Gamma-Secretase Activating Protein elisa. Alternative names of the recognized antigen: PION
- Pigeon Homolog
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Gamma-Secretase Activating Protein (gSAP) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
FLAP ELISA Kit| Rat 5-Lipoxygenase Activating Protein ELISA Kit |
EF017730 |
Lifescience Market |
96 Tests |
EUR 689 |
GAP ELISA Kit| Rat Ras Gtpase Activating Protein ELISA Kit |
EF017749 |
Lifescience Market |
96 Tests |
EUR 689 |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Guinea Pig NFkB p65 ELISA Kit |
EGN0028 |
Abclonal |
96Tests |
EUR 521 |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
ELISA kit for Rat NFkB (Nuclear Factor Kappa B) |
ELK5691 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Nuclear Factor Kappa B (NF?B). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Nucl
- Show more
|
Description: A sandwich ELISA kit for detection of Nuclear Factor Kappa B from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
Mouse NKAP shRNA Plasmid |
20-abx975944 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human NKAP shRNA Plasmid |
20-abx962402 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
NAP-2 ELISA Kit| Rat Neutrophil Activating Protein-2 ELISA Kit |
EF017906 |
Lifescience Market |
96 Tests |
EUR 689 |
NAP-3 ELISA Kit| Rat Neutrophil Activating Protein -3 ELISA Kit |
EF017907 |
Lifescience Market |
96 Tests |
EUR 689 |
Abra ELISA Kit| Rat Actin-binding Rho-activating protein ELISA |
EF018276 |
Lifescience Market |
96 Tests |
EUR 689 |
Arhgap35 ELISA Kit| Rat Rho GTPase-activating protein 35 ELISA |
EF018738 |
Lifescience Market |
96 Tests |
EUR 689 |
Plaa ELISA Kit| Rat Phospholipase A-2-activating protein ELISA |
EF019166 |
Lifescience Market |
96 Tests |
EUR 689 |
Nkap sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6259602 |
ABM |
1.0 ug DNA |
EUR 154 |
Nkap sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6259603 |
ABM |
1.0 ug DNA |
EUR 154 |
Nkap sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6259604 |
ABM |
1.0 ug DNA |
EUR 154 |
ELISA kit for Rat PLA2P (Phospholipase A2 Activating Protein) |
E-EL-R0732 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's PLA2P ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat PLA2P. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Rat PLA2P (Phospholipase A2 Activating Protein) in samples from Serum, Plasma, Cell supernatant |
ELISA kit for Rat GAP (Ras Gtpase Activating Protein) |
E-EL-R0839 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's GAP ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat GAP. Standards or samples are added to the micro ELISA plate wells and combined with the sp
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Rat GAP (Ras Gtpase Activating Protein) in samples from Serum, Plasma, Cell supernatant |
ELISA kit for Rat FLAP (5-Lipoxygenase Activating Protein) |
E-EL-R1099 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's FLAP ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat FLAP. Standards or samples are added to the micro ELISA plate wells and combined with the
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Rat FLAP (5-Lipoxygenase Activating Protein) in samples from Serum, Plasma, Cell supernatant |
Rat Actin binding Rho activating protein(ABRA) ELISA kit |
E02A1164-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Actin binding Rho activating protein(ABRA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Actin binding Rho activating protein(ABRA) ELISA kit |
E02A1164-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Actin binding Rho activating protein(ABRA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Actin binding Rho activating protein(ABRA) ELISA kit |
E02A1164-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Actin binding Rho activating protein(ABRA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Arachidonate 5 lipoxygenase activating protein(ALOX5AP) ELISA kit |
E02A1402-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Arachidonate 5 lipoxygenase activating protein(ALOX5AP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Arachidonate 5 lipoxygenase activating protein(ALOX5AP) ELISA kit |
E02A1402-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Arachidonate 5 lipoxygenase activating protein(ALOX5AP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Arachidonate 5 lipoxygenase activating protein(ALOX5AP) ELISA kit |
E02A1402-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Arachidonate 5 lipoxygenase activating protein(ALOX5AP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat ARF GTPase activating protein GIT1(GIT1) ELISA kit |
E02A1874-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat ARF GTPase activating protein GIT1(GIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat ARF GTPase activating protein GIT1(GIT1) ELISA kit |
E02A1874-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat ARF GTPase activating protein GIT1(GIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat ARF GTPase activating protein GIT1(GIT1) ELISA kit |
E02A1874-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat ARF GTPase activating protein GIT1(GIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat ARF GTPase activating protein GIT2(GIT2) ELISA kit |
E02A1875-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat ARF GTPase activating protein GIT2(GIT2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat ARF GTPase activating protein GIT2(GIT2) ELISA kit |
E02A1875-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat ARF GTPase activating protein GIT2(GIT2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat ARF GTPase activating protein GIT2(GIT2) ELISA kit |
E02A1875-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat ARF GTPase activating protein GIT2(GIT2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Rho GTPase activating protein 15(ARHGAP15) ELISA kit |
E02R0367-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Rho GTPase activating protein 15(ARHGAP15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Rho GTPase activating protein 15(ARHGAP15) ELISA kit |
E02R0367-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Rho GTPase activating protein 15(ARHGAP15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Rho GTPase activating protein 15(ARHGAP15) ELISA kit |
E02R0367-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Rho GTPase activating protein 15(ARHGAP15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Rho GTPase activating protein 19(ARHGAP19) ELISA kit |
E02R0368-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Rho GTPase activating protein 19(ARHGAP19) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Rho GTPase activating protein 19(ARHGAP19) ELISA kit |
E02R0368-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Rho GTPase activating protein 19(ARHGAP19) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Rho GTPase activating protein 19(ARHGAP19) ELISA kit |
E02R0368-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Rho GTPase activating protein 19(ARHGAP19) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Rho GTPase activating protein 26(ARHGAP26) ELISA kit |
E02R0369-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Rho GTPase activating protein 26(ARHGAP26) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Rho GTPase activating protein 26(ARHGAP26) ELISA kit |
E02R0369-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Rho GTPase activating protein 26(ARHGAP26) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Rho GTPase activating protein 26(ARHGAP26) ELISA kit |
E02R0369-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Rho GTPase activating protein 26(ARHGAP26) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Arachidonate 5-Lipoxygenase Activating Protein (ALOX5AP) ELISA Kit |
abx256923-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
ELISA kit for Rat NF-kappa-B-activating protein |
EK3216 |
SAB |
96 tests |
EUR 670 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat NF-kappa-B-activating protein in samples from serum, plasma, tissue homogenates and other biological fluids. |
ELISA kit for Rat NAP3 (Neutrophil Activating Protein 3) |
ELK1237 |
ELK Biotech |
1 plate of 96 wells |
EUR 372 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Neutrophil Activating Protein 3 (NAP3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specifi
- Show more
|
Description: A sandwich ELISA kit for detection of Neutrophil Activating Protein 3 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Rat neutrophil activating protein-2,NAP-2 ELISA Kit |
CN-01949R1 |
ChemNorm |
96T |
EUR 471 |
Rat neutrophil activating protein-2,NAP-2 ELISA Kit |
CN-01949R2 |
ChemNorm |
48T |
EUR 322 |
Rat ARF GTPase Activating Protein GIT1 (GIT1) ELISA Kit |
abx391381-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Rat Rho GTPase Activating Protein 35 (ARHGAP35) ELISA Kit |
abx391382-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Rat Phospholipase A2 Activating Protein / PLA2P (PLAA) ELISA Kit |
abx353835-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-12 working days.
|
Rat Actin Binding Rho Activating Protein (ABRA) ELISA Kit |
abx390923-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
ELISA kit for Rat gSAP (Gamma-Secretase Activating Protein) |
ELK8025 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Gamma-Secretase Activating Protein (?SAP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody spec
- Show more
|
Description: A sandwich ELISA kit for detection of Gamma-Secretase Activating Protein from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Rat NAP-2(Neutrophil Activating Protein-2) ELISA Kit |
ER1178 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 156.25-10000 pg/ml
- Alias: NAP-2/CXCL7/CTAP III/PPBP/connective tissue-activating peptide III/CTAP3CTAP-III/CXC chemokine ligand 7/C-X-C motif chemokine 7/CXCL7b-TG1/LA-PF4/LDGFTC1/Leukocyte-derived growth factor/low-affinity platelet
- Show more
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 93.75pg/ml |
Rat neutrophil activating protein-2(NAP-2)ELISA Kit |
GA-E0771RT-48T |
GenAsia Biotech |
48T |
EUR 317 |
Rat neutrophil activating protein-2(NAP-2)ELISA Kit |
GA-E0771RT-96T |
GenAsia Biotech |
96T |
EUR 496 |
ELISA kit for Rat Gamma-Secretase Activating Protein (GSAP) |
KTE100915-48T |
Abbkine |
48T |
EUR 354 |
- Formation of amyloid-beta is catalyzed by gamma-secretase, a protease with numerous substrates. PION, or GSAP, selectively increases amyloid-beta production through a mechanism involving its interaction with both gamma-secretase and its substrate, th
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Gamma-Secretase Activating Protein (GSAP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Gamma-Secretase Activating Protein (GSAP) |
KTE100915-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- Formation of amyloid-beta is catalyzed by gamma-secretase, a protease with numerous substrates. PION, or GSAP, selectively increases amyloid-beta production through a mechanism involving its interaction with both gamma-secretase and its substrate, th
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Gamma-Secretase Activating Protein (GSAP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Gamma-Secretase Activating Protein (GSAP) |
KTE100915-96T |
Abbkine |
96T |
EUR 572 |
- Formation of amyloid-beta is catalyzed by gamma-secretase, a protease with numerous substrates. PION, or GSAP, selectively increases amyloid-beta production through a mechanism involving its interaction with both gamma-secretase and its substrate, th
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Gamma-Secretase Activating Protein (GSAP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |