Rat VASP(Vasodilator Stimulated Phosphoprotein) ELISA Kit

Rat VASP(Vasodilator Stimulated Phosphoprotein) ELISA Kit

To Order Contact us:  Mark@operatiebrp.nl

Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit
RD-VASP-Ra-96Tests 96 Tests
EUR 775
Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit
DLR-VASP-Hu-48T 48T
EUR 517
  • Should the Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Vasodilator Stimulated Phosphoprotein (VASP) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit
DLR-VASP-Hu-96T 96T
EUR 673
  • Should the Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Vasodilator Stimulated Phosphoprotein (VASP) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit
RDR-VASP-Hu-48Tests 48 Tests
EUR 544
Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit
RDR-VASP-Hu-96Tests 96 Tests
EUR 756
Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit
RD-VASP-Hu-48Tests 48 Tests
EUR 521
Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit
RD-VASP-Hu-96Tests 96 Tests
EUR 723
Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit
abx595616-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.
Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit
abx571896-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.
Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit
20-abx156215
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit
SEC603Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Vasodilator Stimulated Phosphoprotein (VASP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Vasodilator Stimulated Phosphoprotein (VASP) in tissue homogenates, cell lysates and other biological fluids.
Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit
SEC603Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Vasodilator Stimulated Phosphoprotein (VASP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Vasodilator Stimulated Phosphoprotein (VASP) in tissue homogenates, cell lysates and other biological fluids.
Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit
SEC603Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Vasodilator Stimulated Phosphoprotein (VASP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Vasodilator Stimulated Phosphoprotein (VASP) in tissue homogenates, cell lysates and other biological fluids.
Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit
SEC603Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Vasodilator Stimulated Phosphoprotein (VASP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Vasodilator Stimulated Phosphoprotein (VASP) in tissue homogenates, cell lysates and other biological fluids.
Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit
4-SEC603Ra
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Vasodilator Stimulated Phosphoprotein elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Vasodilator Stimulated Phosphoprotein (VASP) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
Rat Vasodilator Stimulated Phosphoprotein ELISA Kit (VASP)
RK04016 96 Tests
EUR 521
Vasodilator-Stimulated Phosphoprotein (VASP) Antibody
abx122736-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Vasodilator-Stimulated Phosphoprotein (VASP) Antibody
20-abx000578
  • EUR 495.00
  • EUR 356.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Vasodilator-Stimulated Phosphoprotein (VASP) Antibody
20-abx008586
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Vasodilator-Stimulated Phosphoprotein (VASP) Antibody
20-abx008587
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Vasodilator-Stimulated Phosphoprotein (VASP) Antibody
abx027730-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Vasodilator-Stimulated Phosphoprotein (VASP) Antibody
abx027730-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Vasodilator Stimulated Phosphoprotein (VASP) Antibody
20-abx175079
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Vasodilator Stimulated Phosphoprotein (VASP) Antibody
20-abx175080
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.
Vasodilator Stimulated Phosphoprotein (VASP) Antibody
20-abx329100
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Vasodilator Stimulated Phosphoprotein (VASP) Antibody
20-abx329101
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Vasodilator Stimulated Phosphoprotein (VASP) Antibody
20-abx330059
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Vasodilator Stimulated Phosphoprotein (VASP) Antibody
20-abx330060
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Vasodilator Stimulated Phosphoprotein (VASP) Antibody
abx331405-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.
Vasodilator Stimulated Phosphoprotein (VASP) Antibody
abx331426-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.
Vasodilator-Stimulated Phosphoprotein (VASP) Antibody
abx431699-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Vasodilator-Stimulated Phosphoprotein (VASP) Antibody
abx433438-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Vasodilator-Stimulated Phosphoprotein (VASP) Antibody
abx239375-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Vasodilator Stimulated Phosphoprotein (VASP) Protein
20-abx262757
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.
Vasodilator Stimulated Phosphoprotein (VASP) Antibody
20-abx178859
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.
Vasodilator Stimulated Phosphoprotein (VASP) Antibody
20-abx178860
  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.
Rat Vasodilator Stimulated Phosphoprotein (VASP) Protein
20-abx655466
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Rat Vasodilator Stimulated Phosphoprotein (VASP) CLIA Kit
20-abx493792
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Cow Vasodilator-stimulated phosphoprotein (VASP) ELISA Kit
abx521216-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Dog Vasodilator-stimulated phosphoprotein (VASP) ELISA Kit
abx521217-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Mouse Vasodilator-stimulated phosphoprotein (VASP) ELISA Kit
abx521219-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.
Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit
abx570947-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.
Bovine VASP/ Vasodilator-stimulated phosphoprotein ELISA Kit
E0281Bo 1 Kit
EUR 717
Human VASP/ Vasodilator-stimulated phosphoprotein ELISA Kit
E2652Hu 1 Kit
EUR 605
Human VASP(Vasodilator-stimulated phosphoprotein) ELISA Kit
EH2489 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P50552
  • Alias: VASP
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml
Canine Vasodilator-stimulated phosphoprotein, VASP ELISA KIT
ELI-07731d 96 Tests
EUR 928
Human Vasodilator- stimulated phosphoprotein, VASP ELISA KIT
ELI-07732h 96 Tests
EUR 824
Mouse Vasodilator- stimulated phosphoprotein, Vasp ELISA KIT
ELI-07733m 96 Tests
EUR 865
Bovine Vasodilator- stimulated phosphoprotein, VASP ELISA KIT
ELI-07734b 96 Tests
EUR 928
Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit
20-abx153458
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit
abx251857-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.
Human Vasodilator-stimulated phosphoprotein(VASP) ELISA kit
CSB-EL025797HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Vasodilator-stimulated phosphoprotein (VASP) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Vasodilator-stimulated phosphoprotein(VASP) ELISA kit
1-CSB-EL025797HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Vasodilator-stimulated phosphoprotein(VASP) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit
SEC603Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasodilator Stimulated Phosphoprotein (VASP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inte
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vasodilator Stimulated Phosphoprotein (VASP) in tissue homogenates, cell lysates and other biological fluids.
Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit
SEC603Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasodilator Stimulated Phosphoprotein (VASP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inte
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vasodilator Stimulated Phosphoprotein (VASP) in tissue homogenates, cell lysates and other biological fluids.
Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit
SEC603Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasodilator Stimulated Phosphoprotein (VASP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inte
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vasodilator Stimulated Phosphoprotein (VASP) in tissue homogenates, cell lysates and other biological fluids.
Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit
SEC603Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasodilator Stimulated Phosphoprotein (VASP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inte
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vasodilator Stimulated Phosphoprotein (VASP) in tissue homogenates, cell lysates and other biological fluids.
Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit
4-SEC603Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Vasodilator Stimulated Phosphoprotein elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Vasodilator Stimulated Phosphoprotein (VASP) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
Human Vasodilator Stimulated Phosphoprotein(VASP)ELISA Kit
QY-E00688 96T
EUR 361
ELISA kit for Rat VASP (Vasodilator Stimulated Phosphoprotein)
ELK7201 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Vasodilator Stimulated Phosphoprotein (VASP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody s
  • Show more
Description: A sandwich ELISA kit for detection of Vasodilator Stimulated Phosphoprotein from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Rat VASP (Vasodilator Stimulated Phosphoprotein)
E-EL-R1207 1 plate of 96 wells
EUR 534
  • Gentaur's VASP ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat VASP. Standards or samples are added to the micro ELISA plate wells and combined with the
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat VASP (Vasodilator Stimulated Phosphoprotein) in samples from Serum, Plasma, Cell supernatant
Human Vasodilator Stimulated Phosphoprotein (VASP) Protein
20-abx655467
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Vasodilator Stimulated Phosphoprotein (VASP) Blocking Peptide
20-abx063408
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
Human Vasodilator Stimulated Phosphoprotein (VASP) CLIA Kit
20-abx493791
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
ELISA kit for Human VASP (Vasodilator Stimulated Phosphoprotein)
E-EL-H2529 1 plate of 96 wells
EUR 534
  • Gentaur's VASP ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human VASP. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human VASP (Vasodilator Stimulated Phosphoprotein) in samples from Serum, Plasma, Cell supernatant
Vasp ELISA Kit| Mouse Vasodilator-stimulated phosphoprotein ELI
EF016488 96 Tests
EUR 689
VASP ELISA Kit| Bovine Vasodilator-stimulated phosphoprotein EL
EF012017 96 Tests
EUR 689
ELISA kit for Human VASP (Vasodilator Stimulated Phosphoprotein)
ELK3481 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Vasodilator Stimulated Phosphoprotein (VASP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody s
  • Show more
Description: A sandwich ELISA kit for detection of Vasodilator Stimulated Phosphoprotein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Human Vasodilator-stimulated phosphoprotein (VASP)
KTE60071-48T 48T
EUR 332
  • Synaptic vesicles are responsible for regulating the storage and release of neurotransmitters in the nerve terminal. Northern blot analysis revealed that a 5.8-kb transcript is expressed in electromotor neurons. Western blot analysis determined expre
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Vasodilator-stimulated phosphoprotein (VASP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Vasodilator-stimulated phosphoprotein (VASP)
KTE60071-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Synaptic vesicles are responsible for regulating the storage and release of neurotransmitters in the nerve terminal. Northern blot analysis revealed that a 5.8-kb transcript is expressed in electromotor neurons. Western blot analysis determined expre
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Vasodilator-stimulated phosphoprotein (VASP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Vasodilator-stimulated phosphoprotein (VASP)
KTE60071-96T 96T
EUR 539
  • Synaptic vesicles are responsible for regulating the storage and release of neurotransmitters in the nerve terminal. Northern blot analysis revealed that a 5.8-kb transcript is expressed in electromotor neurons. Western blot analysis determined expre
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Vasodilator-stimulated phosphoprotein (VASP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
VASP Vasodilator-Stimulated Phosphoprotein Human Recombinant Protein
PROTP50552 Regular: 10ug
EUR 317
Description: VASP Human Recombinant fused with a 20 amino acid His tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 363 amino acids (1-343 a.a.) and having a molecular mass of 37.5kDa (Molecular weight on SDS-PAGE will appear higher). ;The VASP is purified by proprietary chromatographic techniques.
Vasodilator Stimulated Phosphoprotein Phospho-Thr278 (VASP pT278) Antibody
20-abx326549
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Vasodilator Stimulated Phosphoprotein Phospho-Ser238 (VASP pS238) Antibody
20-abx328568
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Vasodilator Stimulated Phosphoprotein Phospho-Ser157 (VASP pS157) Antibody
20-abx329102
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Vasodilator Stimulated Phosphoprotein Phospho-Ser157 (VASP pS157) Antibody
20-abx330021
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Vasodilator Stimulated Phosphoprotein Phospho-Ser157 (VASP pS157) Antibody
abx332983-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.
Vasodilator Stimulated Phosphoprotein Phospho-Ser239 (VASP pS239) Antibody
abx332986-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.
Vasodilator-Stimulated Phosphoprotein Antibody
20-abx116593
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Recombinant Human Vasodilator-Stimulated Phosphoprotein
7-06844 2µg Ask for price
Recombinant Human Vasodilator-Stimulated Phosphoprotein
7-06845 10µg Ask for price
Recombinant Human Vasodilator-Stimulated Phosphoprotein
7-06846 1mg Ask for price
ELISA kit for Bovine Vasodilator-stimulated phosphoprotein
EK4996 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Bovine Vasodilator-stimulated phosphoprotein in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for Human Vasodilator-stimulated phosphoprotein
EK4997 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Vasodilator-stimulated phosphoprotein in samples from serum, plasma, tissue homogenates and other biological fluids.
Human VASP ELISA Kit
ELA-E9578h 96 Tests
EUR 824
VASP ELISA KIT|Human
EF006523 96 Tests
EUR 689
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202
Rat Secreted phosphoprotein 24 ELISA kit
E02S0309-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Secreted phosphoprotein 24 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Secreted phosphoprotein 24 ELISA kit
E02S0309-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Secreted phosphoprotein 24 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Secreted phosphoprotein 24 ELISA kit
E02S0309-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Secreted phosphoprotein 24 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Ena/VASP-Like Protein (EVL) ELISA Kit
abx391304-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Rat Golgi phosphoprotein 3 (GOLPH3) ELISA Kit
abx556210-96tests 96 tests
EUR 668
  • Shipped within 1-3 weeks.
Rat Secreted phosphoprotein 24(SPP2) ELISA kit
E02S0398-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Secreted phosphoprotein 24(SPP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Secreted phosphoprotein 24(SPP2) ELISA kit
E02S0398-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Secreted phosphoprotein 24(SPP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Secreted phosphoprotein 24(SPP2) ELISA kit
E02S0398-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Secreted phosphoprotein 24(SPP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Evl ELISA Kit| Rat Ena/VASP-like protein ELISA Kit
EF018659 96 Tests
EUR 689
Rat Lipolysis Stimulated Lipoprotein Receptor (LSR) ELISA Kit
abx391555-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Golph3 ELISA Kit| Rat Golgi phosphoprotein 3 ELISA Kit
EF018765 96 Tests
EUR 689
VASP Recombinant Protein (Rat)
RP236285 100 ug Ask for price
VASP Colorimetric Cell-Based ELISA Kit
EKC1588 100ul
EUR 572
Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol)
RAT-5 1
EUR 1138
Human interferon- stimulated protein ELISA Kit
ELA-E1755h 96 Tests
EUR 824
Phosphoprotein Purification Kit
AKR-105 2 preps
EUR 299
Description: The Phosphoprotein Purification Kit provides an efficient system for quick purification/enrichment of phosphoproteins from various samples. Phosphorylated proteins are affinity purified from lysates with a single-step purification matrix. The entire procedure takes about 4 hours. Each preparation can handle 2.5 mg of total lysate protein (approx. one confluent 100 mm dish).
Phosphoprotein Purification Kit
AKR-106 5 preps
EUR 485
Description: The Phosphoprotein Purification Kit provides an efficient system for quick purification/enrichment of phosphoproteins from various samples. Phosphorylated proteins are affinity purified from lysates with a single-step purification matrix. The entire procedure takes about 4 hours. Each preparation can handle 2.5 mg of total lysate protein (approx. one confluent 100 mm dish).
VASP Antibody
AF6337 200ul
EUR 304
Description: VASP Antibody detects endogenous levels of total VASP.
VASP Antibody
AF6338 200ul
EUR 304
Description: VASP Antibody detects endogenous levels of total VASP.
VASP Antibody
ABF6337 100 ug
EUR 438
VASP Antibody
ABF6338 100 ug
EUR 438
VASP siRNA
20-abx939342
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
VASP siRNA
20-abx939343
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
VASP antibody
70R-50533 100 ul
EUR 244
Description: Purified Polyclonal VASP antibody
VASP antibody
70R-50534 100 ul
EUR 244
Description: Purified Polyclonal VASP antibody
VASP antibody
70R-51671 100 ul
EUR 287
Description: Purified Polyclonal VASP antibody
VASP antibody
70R-34661 100 ug
EUR 327
Description: Purified Rabbit polyclonal VASP antibody
VASP antibody
70R-21241 50 ul
EUR 435
Description: Rabbit polyclonal VASP antibody
VASP antibody
70R-31071 100 ug
EUR 327
Description: Rabbit polyclonal VASP antibody
VASP Antibody
3718-100
EUR 316
VASP Antibody
3718-30T
EUR 146
VASP Antibody
48793-100ul 100ul
EUR 333
VASP Antibody
48793-50ul 50ul
EUR 239
VASP antibody
10R-6259 100 ul
EUR 726
Description: Mouse monoclonal VASP antibody
VASP antibody
10R-6261 100 ul
EUR 691
Description: Mouse monoclonal VASP antibody
VASP antibody
10R-6262 100 ul
EUR 691
Description: Mouse monoclonal VASP antibody
VASP antibody
10R-7236 100 ul
EUR 691
Description: Mouse monoclonal VASP antibody
VASP antibody
20R-1715 100 ug
EUR 716
Description: Rabbit polyclonal VASP antibody
VASP antibody
20R-2008 50 ug
EUR 281
Description: Rabbit polyclonal VASP antibody
VASP antibody
20R-2056 50 ug
EUR 281
Description: Rabbit polyclonal VASP antibody
VASP antibody
20R-2339 50 ug
EUR 281
Description: Rabbit polyclonal VASP antibody
VASP antibody
20R-2370 50 ug
EUR 281
Description: Rabbit polyclonal VASP antibody
VASP antibody
70R-12030 100 ug
EUR 403
Description: Rabbit polyclonal VASP antibody
VASP antibody
70R-10267 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal VASP antibody
VASP antibody
70R-10268 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal VASP antibody
VASP Antibody
1-CSB-PA004422
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against VASP. Recognizes VASP from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000
VASP Antibody
1-CSB-PA004424
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against VASP. Recognizes VASP from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000
VASP Antibody
1-CSB-PA010556
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against VASP. Recognizes VASP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000
VASP Antibody
1-CSB-PA060049
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against VASP. Recognizes VASP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000
VASP Antibody
1-CSB-PA025797GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against VASP. Recognizes VASP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF
anti-VASP
YF-PA15255 50 ug
EUR 363
Description: Mouse polyclonal to VASP
anti-VASP
YF-PA15256 100 ug
EUR 403
Description: Rabbit polyclonal to VASP
Rat Stress-Induced-Phosphoprotein 1 (STIP1) ELISA Kit
abx556233-96tests 96 tests
EUR 668
  • Shipped within 1-3 weeks.
Rat Astrocytic phosphoprotein PEA 15(PEA15) ELISA kit
E02A1941-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Astrocytic phosphoprotein PEA 15(PEA15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Astrocytic phosphoprotein PEA 15(PEA15) ELISA kit
E02A1941-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Astrocytic phosphoprotein PEA 15(PEA15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Astrocytic phosphoprotein PEA 15(PEA15) ELISA kit
E02A1941-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Astrocytic phosphoprotein PEA 15(PEA15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Stress-induced-phosphoprotein 1, STI1 ELISA Kit
ELI-23673r 96 Tests
EUR 886
ELISA kit for Rat Secreted phosphoprotein 24 (SPP2)
KTE100125-48T 48T
EUR 332
  • Sphingosine-1-phosphate (S1P) is a bioactive sphingolipid metabolite that regulates diverse biologic processes. SGPP2 catalyzes the degradation of S1P.The deduced 399-amino acid protein has a calculated molecular mass of 44.7 kD and shares 39.3% amin
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Secreted phosphoprotein 24 (SPP2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Rat Secreted phosphoprotein 24 (SPP2)
KTE100125-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Sphingosine-1-phosphate (S1P) is a bioactive sphingolipid metabolite that regulates diverse biologic processes. SGPP2 catalyzes the degradation of S1P.The deduced 399-amino acid protein has a calculated molecular mass of 44.7 kD and shares 39.3% amin
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Secreted phosphoprotein 24 (SPP2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Rat Secreted phosphoprotein 24 (SPP2)
KTE100125-96T 96T
EUR 539
  • Sphingosine-1-phosphate (S1P) is a bioactive sphingolipid metabolite that regulates diverse biologic processes. SGPP2 catalyzes the degradation of S1P.The deduced 399-amino acid protein has a calculated molecular mass of 44.7 kD and shares 39.3% amin
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Secreted phosphoprotein 24 (SPP2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Rat Stress Induced Phosphoprotein 1(STIP1)ELISA kit
QY-E10472 96T
EUR 361
Stip1 ELISA Kit| Rat Stress-induced-phosphoprotein 1 ELISA Kit
EF019383 96 Tests
EUR 689
Lsr ELISA Kit| Rat Lipolysis-stimulated lipoprotein receptor EL
EF018913 96 Tests
EUR 689
Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
Vasp ORF Vector (Rat) (pORF)
ORF078763 1.0 ug DNA
EUR 506
Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
Mouse Secreted phosphoprotein 24 ELISA kit
E03S0309-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Secreted phosphoprotein 24 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Secreted phosphoprotein 24 ELISA kit
E03S0309-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Secreted phosphoprotein 24 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Secreted phosphoprotein 24 ELISA kit
E03S0309-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Secreted phosphoprotein 24 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Secreted phosphoprotein 24 ELISA kit
E04S0309-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Secreted phosphoprotein 24 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Secreted phosphoprotein 24 ELISA kit
E04S0309-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Secreted phosphoprotein 24 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Secreted phosphoprotein 24 ELISA kit
E04S0309-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Secreted phosphoprotein 24 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Secreted phosphoprotein 24 ELISA kit
E01S0309-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Secreted phosphoprotein 24 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Secreted phosphoprotein 24 ELISA kit
E01S0309-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Secreted phosphoprotein 24 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Secreted phosphoprotein 24 ELISA kit
E01S0309-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Secreted phosphoprotein 24 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Secreted phosphoprotein 24 ELISA kit
E06S0309-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Secreted phosphoprotein 24 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Secreted phosphoprotein 24 ELISA kit
E06S0309-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Secreted phosphoprotein 24 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Secreted phosphoprotein 24 ELISA kit
E06S0309-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Secreted phosphoprotein 24 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Secreted phosphoprotein 24 ELISA kit
E08S0309-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Secreted phosphoprotein 24 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Secreted phosphoprotein 24 ELISA kit
E08S0309-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Secreted phosphoprotein 24 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Secreted phosphoprotein 24 ELISA kit
E08S0309-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Secreted phosphoprotein 24 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Secreted phosphoprotein 24 ELISA kit
E07S0309-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Secreted phosphoprotein 24 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Secreted phosphoprotein 24 ELISA kit
E07S0309-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Secreted phosphoprotein 24 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Secreted phosphoprotein 24 ELISA kit
E07S0309-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Secreted phosphoprotein 24 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Secreted phosphoprotein 24 ELISA kit
E09S0309-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Secreted phosphoprotein 24 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Secreted phosphoprotein 24 ELISA kit
E09S0309-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Secreted phosphoprotein 24 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Secreted phosphoprotein 24 ELISA kit
E09S0309-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Secreted phosphoprotein 24 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human interferon-stimulated protein(ISP)ELISA Kit
GA-E0431HM-48T 48T
EUR 289
Human interferon-stimulated protein(ISP)ELISA Kit
GA-E0431HM-96T 96T
EUR 466
human interferon-stimulated protein,ISP ELISA Kit
201-12-0415 96 tests
EUR 440
  • This interferon-stimulated protein ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human interferon-stimulated protein(ISP)ELISA Kit
QY-E03447 96T
EUR 361
PCR Mycoplasma Detection Kit
M034-Kit Kit
EUR 266
Rat Dentin Matrix Acidic Phosphoprotein 1 (DMP1) ELISA Kit
abx519332-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Rat GAP-Associated Tyrosine Phosphoprotein P62 (KHDRBS1) ELISA Kit
abx391526-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Rat Interferon stimulated gene 20 kDa protein(ISG20) ELISA kit
E02I0441-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Interferon stimulated gene 20 kDa protein(ISG20) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Interferon stimulated gene 20 kDa protein(ISG20) ELISA kit
E02I0441-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Interferon stimulated gene 20 kDa protein(ISG20) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Interferon stimulated gene 20 kDa protein(ISG20) ELISA kit
E02I0441-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Interferon stimulated gene 20 kDa protein(ISG20) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
PhosphoSeek? Phosphoprotein Purification Kit
K1401-2
EUR 512
PhosphoSeek? Phosphoprotein Purification Kit
K1401-6
EUR 958
PhosphoSeek? Phosphoprotein Enrichment Kit
K1402-2
EUR 441
PhosphoSeek? Phosphoprotein Enrichment Kit
K1402-6
EUR 784
VASP Blocking Peptide
AF6337-BP 1mg
EUR 195
VASP Blocking Peptide
AF6338-BP 1mg
EUR 195
Polyclonal VASP Antibody
AMM08455G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human VASP . This antibody is tested and proven to work in the following applications:
Polyclonal VASP Antibody
AMM08456G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human VASP . This antibody is tested and proven to work in the following applications:
VASP Conjugated Antibody
C48793 100ul
EUR 397
VASP cloning plasmid
CSB-CL025797HU1-10ug 10ug
EUR 430
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1143
  • Sequence: atgagcgagacggtcatctgttccagccgggccactgtgatgctttatgatgatggcaacaagcgatggctccctgctggcacgggtccccaggccttcagccgcgtccagatctaccacaaccccacggccaattcctttcgcgtcgtgggccggaagatgcagcccgaccagc
  • Show more
Description: A cloning plasmid for the VASP gene.
VASP cloning plasmid
CSB-CL025797HU2-10ug 10ug
EUR 430
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1143
  • Sequence: atgagcagcgagacggtcatctgttccagccgggccactgtgatgctttatgatgatggcaacaagcgatggctccctgctggcacgggtccccaggccttcagccgcgtccagatctaccacaaccccacggccaattcctttcgcgtcgtgggccggaagatgcagcccgacc
  • Show more
Description: A cloning plasmid for the VASP gene.
anti- VASP antibody
FNab09375 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:5000
  • IHC: 1:20-1:200;IF: 1:20-1:200
  • IP: 1:200-1:2000
  • Immunogen: vasodilator-stimulated phosphoprotein
  • Uniprot ID: P50552
  • Gene ID: 7408
Description: Antibody raised against VASP
VASP Polyclonal Antibody
ES7483-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VASP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
VASP Polyclonal Antibody
ES7483-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VASP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
VASP Polyclonal Antibody
ES7484-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VASP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
VASP Polyclonal Antibody
ES7484-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VASP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
VASP Polyclonal Antibody
ES3686-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VASP from Human/Mouse/Rat/Monkey. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA
VASP Polyclonal Antibody
ES3686-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VASP from Human/Mouse/Rat/Monkey. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA
VASP Polyclonal Antibody
ES3687-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VASP from Human/Mouse/Rat/Monkey. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA
VASP Polyclonal Antibody
ES3687-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VASP from Human/Mouse/Rat/Monkey. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA
VASP (pS157) Antibody
20-abx119337
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.
VASP (pS238) Antibody
20-abx119338
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.
VASP Polyclonal Antibody
ABP52687-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human VASP around the non-phosphorylation site of S238
  • Applications tips:
Description: A polyclonal antibody for detection of VASP from Human, Mouse, Rat, Monkey. This VASP antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VASP around the non-phosphorylation site of S238
VASP Polyclonal Antibody
ABP52687-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human VASP around the non-phosphorylation site of S238
  • Applications tips:
Description: A polyclonal antibody for detection of VASP from Human, Mouse, Rat, Monkey. This VASP antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VASP around the non-phosphorylation site of S238
VASP Polyclonal Antibody
ABP52687-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human VASP around the non-phosphorylation site of S238
  • Applications tips:
Description: A polyclonal antibody for detection of VASP from Human, Mouse, Rat, Monkey. This VASP antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VASP around the non-phosphorylation site of S238
VASP Polyclonal Antibody
ABP52688-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human VASP around the non-phosphorylation site of S157
  • Applications tips:
Description: A polyclonal antibody for detection of VASP from Human, Mouse, Rat, Monkey. This VASP antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VASP around the non-phosphorylation site of S157
VASP Polyclonal Antibody
ABP52688-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human VASP around the non-phosphorylation site of S157
  • Applications tips:
Description: A polyclonal antibody for detection of VASP from Human, Mouse, Rat, Monkey. This VASP antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VASP around the non-phosphorylation site of S157
VASP Polyclonal Antibody
ABP52688-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human VASP around the non-phosphorylation site of S157
  • Applications tips:
Description: A polyclonal antibody for detection of VASP from Human, Mouse, Rat, Monkey. This VASP antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VASP around the non-phosphorylation site of S157
VASP (pS239) Antibody
20-abx000239
  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
VASP (pS157) Antibody
20-abx000265
  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
VASP (pS238) Antibody
20-abx133046
  • EUR 314.00
  • EUR 467.00
  • EUR 203.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
VASP (pS157) Antibody
20-abx134698
  • EUR 314.00
  • EUR 467.00
  • EUR 203.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
VASP Polyclonal Antibody
ABP56484-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human VASP around the non-phosphorylation site of T278
  • Applications tips:
Description: A polyclonal antibody for detection of VASP from Human, Mouse, Rat. This VASP antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VASP around the non-phosphorylation site of T278
VASP Polyclonal Antibody
ABP56484-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human VASP around the non-phosphorylation site of T278
  • Applications tips:
Description: A polyclonal antibody for detection of VASP from Human, Mouse, Rat. This VASP antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VASP around the non-phosphorylation site of T278
VASP Polyclonal Antibody
ABP56484-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human VASP around the non-phosphorylation site of T278
  • Applications tips:
Description: A polyclonal antibody for detection of VASP from Human, Mouse, Rat. This VASP antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VASP around the non-phosphorylation site of T278
VASP Polyclonal Antibody
ABP56485-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human VASP around the non-phosphorylation site of S157
  • Applications tips:
Description: A polyclonal antibody for detection of VASP from Human, Mouse, Rat. This VASP antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VASP around the non-phosphorylation site of S157