Rat VASP(Vasodilator Stimulated Phosphoprotein) ELISA Kit
To Order Contact us: Mark@operatiebrp.nl
 ELISA Kit) Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit |
|
RD-VASP-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 775 |
 ELISA Kit) Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit |
|
DLR-VASP-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Vasodilator Stimulated Phosphoprotein (VASP) in samples from tissue homogenates, cell lysates or other biological fluids. |
|
Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit |
|
DLR-VASP-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Vasodilator Stimulated Phosphoprotein (VASP) in samples from tissue homogenates, cell lysates or other biological fluids. |
|
Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit |
|
RDR-VASP-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
|
Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit |
|
RDR-VASP-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
|
Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit |
|
RD-VASP-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
|
Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit |
|
RD-VASP-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
 ELISA Kit) Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit |
|
abx595616-96tests |
Abbexa |
96 tests |
EUR 637 |
- Shipped within 1-2 weeks.
|
|
Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit |
|
abx571896-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-12 working days.
|
|
Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit |
|
20-abx156215 |
Abbexa |
-
EUR 7237.00
-
EUR 3855.00
-
EUR 895.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
|
Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit |
|
SEC603Ra-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5124.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Vasodilator Stimulated Phosphoprotein (VASP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Vasodilator Stimulated Phosphoprotein (VASP) in tissue homogenates, cell lysates and other biological fluids. |
|
Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit |
|
SEC603Ra-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 509.64 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Vasodilator Stimulated Phosphoprotein (VASP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Vasodilator Stimulated Phosphoprotein (VASP) in tissue homogenates, cell lysates and other biological fluids. |
|
Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit |
|
SEC603Ra-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 685.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Vasodilator Stimulated Phosphoprotein (VASP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Vasodilator Stimulated Phosphoprotein (VASP) in tissue homogenates, cell lysates and other biological fluids. |
|
Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit |
|
SEC603Ra-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2783.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Vasodilator Stimulated Phosphoprotein (VASP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Vasodilator Stimulated Phosphoprotein (VASP) in tissue homogenates, cell lysates and other biological fluids. |
|
Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit |
|
4-SEC603Ra |
Cloud-Clone |
-
EUR 5175.00
-
EUR 2734.00
-
EUR 686.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Vasodilator Stimulated Phosphoprotein elisa. Alternative names of the recognized antigen: n/a
|
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Vasodilator Stimulated Phosphoprotein (VASP) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
) Rat Vasodilator Stimulated Phosphoprotein ELISA Kit (VASP) |
|
RK04016 |
Abclonal |
96 Tests |
EUR 521 |
 Antibody) Vasodilator-Stimulated Phosphoprotein (VASP) Antibody |
|
abx122736-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
|
Vasodilator-Stimulated Phosphoprotein (VASP) Antibody |
|
20-abx000578 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
|
Vasodilator-Stimulated Phosphoprotein (VASP) Antibody |
|
20-abx008586 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
|
Vasodilator-Stimulated Phosphoprotein (VASP) Antibody |
|
20-abx008587 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
|
Vasodilator-Stimulated Phosphoprotein (VASP) Antibody |
|
abx027730-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
|
Vasodilator-Stimulated Phosphoprotein (VASP) Antibody |
|
abx027730-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
 Antibody) Vasodilator Stimulated Phosphoprotein (VASP) Antibody |
|
20-abx175079 |
Abbexa |
|
|
|
|
|
Vasodilator Stimulated Phosphoprotein (VASP) Antibody |
|
20-abx175080 |
Abbexa |
|
|
|
|
|
Vasodilator Stimulated Phosphoprotein (VASP) Antibody |
|
20-abx329100 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
|
Vasodilator Stimulated Phosphoprotein (VASP) Antibody |
|
20-abx329101 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
|
Vasodilator Stimulated Phosphoprotein (VASP) Antibody |
|
20-abx330059 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
|
Vasodilator Stimulated Phosphoprotein (VASP) Antibody |
|
20-abx330060 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
|
Vasodilator Stimulated Phosphoprotein (VASP) Antibody |
|
abx331405-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
|
Vasodilator Stimulated Phosphoprotein (VASP) Antibody |
|
abx331426-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
|
Vasodilator-Stimulated Phosphoprotein (VASP) Antibody |
|
abx431699-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
|
Vasodilator-Stimulated Phosphoprotein (VASP) Antibody |
|
abx433438-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
|
Vasodilator-Stimulated Phosphoprotein (VASP) Antibody |
|
abx239375-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
 Protein) Vasodilator Stimulated Phosphoprotein (VASP) Protein |
|
20-abx262757 |
Abbexa |
-
EUR 328.00
-
EUR 6397.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
|
Vasodilator Stimulated Phosphoprotein (VASP) Antibody |
|
20-abx178859 |
Abbexa |
|
|
|
|
|
Vasodilator Stimulated Phosphoprotein (VASP) Antibody |
|
20-abx178860 |
Abbexa |
|
|
|
|
 Protein) Rat Vasodilator Stimulated Phosphoprotein (VASP) Protein |
|
20-abx655466 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
 CLIA Kit) Rat Vasodilator Stimulated Phosphoprotein (VASP) CLIA Kit |
|
20-abx493792 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
|
 ELISA Kit) Cow Vasodilator-stimulated phosphoprotein (VASP) ELISA Kit |
|
abx521216-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Dog Vasodilator-stimulated phosphoprotein (VASP) ELISA Kit |
|
abx521217-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Mouse Vasodilator-stimulated phosphoprotein (VASP) ELISA Kit |
|
abx521219-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
|
Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit |
|
abx570947-96tests |
Abbexa |
96 tests |
EUR 754 |
- Shipped within 5-12 working days.
|
 Bovine VASP/ Vasodilator-stimulated phosphoprotein ELISA Kit |
|
E0281Bo |
Sunlong |
1 Kit |
EUR 717 |
 Human VASP/ Vasodilator-stimulated phosphoprotein ELISA Kit |
|
E2652Hu |
Sunlong |
1 Kit |
EUR 605 |
 ELISA Kit) Human VASP(Vasodilator-stimulated phosphoprotein) ELISA Kit |
|
EH2489 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: P50552
- Alias: VASP
|
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
 Canine Vasodilator-stimulated phosphoprotein, VASP ELISA KIT |
|
ELI-07731d |
Lifescience Market |
96 Tests |
EUR 928 |
 Human Vasodilator- stimulated phosphoprotein, VASP ELISA KIT |
|
ELI-07732h |
Lifescience Market |
96 Tests |
EUR 824 |
 Mouse Vasodilator- stimulated phosphoprotein, Vasp ELISA KIT |
|
ELI-07733m |
Lifescience Market |
96 Tests |
EUR 865 |
 Bovine Vasodilator- stimulated phosphoprotein, VASP ELISA KIT |
|
ELI-07734b |
Lifescience Market |
96 Tests |
EUR 928 |
|
Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit |
|
20-abx153458 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
|
Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit |
|
abx251857-96tests |
Abbexa |
96 tests |
EUR 754 |
- Shipped within 5-12 working days.
|
 ELISA kit) Human Vasodilator-stimulated phosphoprotein(VASP) ELISA kit |
|
CSB-EL025797HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Quantitativesandwich ELISA kit for measuring Human Vasodilator-stimulated phosphoprotein (VASP) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
|
Human Vasodilator-stimulated phosphoprotein(VASP) ELISA kit |
|
1-CSB-EL025797HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Quantitativesandwich ELISA kit for measuring Human Vasodilator-stimulated phosphoprotein(VASP) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
|
Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit |
|
SEC603Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasodilator Stimulated Phosphoprotein (VASP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inte
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vasodilator Stimulated Phosphoprotein (VASP) in tissue homogenates, cell lysates and other biological fluids. |
|
Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit |
|
SEC603Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasodilator Stimulated Phosphoprotein (VASP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inte
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vasodilator Stimulated Phosphoprotein (VASP) in tissue homogenates, cell lysates and other biological fluids. |
|
Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit |
|
SEC603Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasodilator Stimulated Phosphoprotein (VASP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inte
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vasodilator Stimulated Phosphoprotein (VASP) in tissue homogenates, cell lysates and other biological fluids. |
|
Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit |
|
SEC603Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasodilator Stimulated Phosphoprotein (VASP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inte
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vasodilator Stimulated Phosphoprotein (VASP) in tissue homogenates, cell lysates and other biological fluids. |
|
Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit |
|
4-SEC603Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Vasodilator Stimulated Phosphoprotein elisa. Alternative names of the recognized antigen: n/a
|
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Vasodilator Stimulated Phosphoprotein (VASP) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
ELISA Kit) Human Vasodilator Stimulated Phosphoprotein(VASP)ELISA Kit |
|
QY-E00688 |
Qayee Biotechnology |
96T |
EUR 361 |
) ELISA kit for Rat VASP (Vasodilator Stimulated Phosphoprotein) |
|
ELK7201 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Vasodilator Stimulated Phosphoprotein (VASP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody s
- Show more
|
|
Description: A sandwich ELISA kit for detection of Vasodilator Stimulated Phosphoprotein from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
|
ELISA kit for Rat VASP (Vasodilator Stimulated Phosphoprotein) |
|
E-EL-R1207 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's VASP ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat VASP. Standards or samples are added to the micro ELISA plate wells and combined with the
- Show more
|
|
Description: A sandwich ELISA kit for quantitative measurement of Rat VASP (Vasodilator Stimulated Phosphoprotein) in samples from Serum, Plasma, Cell supernatant |
 Protein) Human Vasodilator Stimulated Phosphoprotein (VASP) Protein |
|
20-abx655467 |
Abbexa |
-
EUR 690.00
-
EUR 286.00
-
EUR 2124.00
-
EUR 815.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
 Blocking Peptide) Vasodilator Stimulated Phosphoprotein (VASP) Blocking Peptide |
|
20-abx063408 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 CLIA Kit) Human Vasodilator Stimulated Phosphoprotein (VASP) CLIA Kit |
|
20-abx493791 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
|
) ELISA kit for Human VASP (Vasodilator Stimulated Phosphoprotein) |
|
E-EL-H2529 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's VASP ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human VASP. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
|
Description: A sandwich ELISA kit for quantitative measurement of Human VASP (Vasodilator Stimulated Phosphoprotein) in samples from Serum, Plasma, Cell supernatant |
 Vasp ELISA Kit| Mouse Vasodilator-stimulated phosphoprotein ELI |
|
EF016488 |
Lifescience Market |
96 Tests |
EUR 689 |
 VASP ELISA Kit| Bovine Vasodilator-stimulated phosphoprotein EL |
|
EF012017 |
Lifescience Market |
96 Tests |
EUR 689 |
|
ELISA kit for Human VASP (Vasodilator Stimulated Phosphoprotein) |
|
ELK3481 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Vasodilator Stimulated Phosphoprotein (VASP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody s
- Show more
|
|
Description: A sandwich ELISA kit for detection of Vasodilator Stimulated Phosphoprotein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
) ELISA kit for Human Vasodilator-stimulated phosphoprotein (VASP) |
|
KTE60071-48T |
Abbkine |
48T |
EUR 332 |
- Synaptic vesicles are responsible for regulating the storage and release of neurotransmitters in the nerve terminal. Northern blot analysis revealed that a 5.8-kb transcript is expressed in electromotor neurons. Western blot analysis determined expre
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human Vasodilator-stimulated phosphoprotein (VASP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
|
ELISA kit for Human Vasodilator-stimulated phosphoprotein (VASP) |
|
KTE60071-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Synaptic vesicles are responsible for regulating the storage and release of neurotransmitters in the nerve terminal. Northern blot analysis revealed that a 5.8-kb transcript is expressed in electromotor neurons. Western blot analysis determined expre
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human Vasodilator-stimulated phosphoprotein (VASP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
|
ELISA kit for Human Vasodilator-stimulated phosphoprotein (VASP) |
|
KTE60071-96T |
Abbkine |
96T |
EUR 539 |
- Synaptic vesicles are responsible for regulating the storage and release of neurotransmitters in the nerve terminal. Northern blot analysis revealed that a 5.8-kb transcript is expressed in electromotor neurons. Western blot analysis determined expre
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human Vasodilator-stimulated phosphoprotein (VASP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
 VASP Vasodilator-Stimulated Phosphoprotein Human Recombinant Protein |
|
PROTP50552 |
BosterBio |
Regular: 10ug |
EUR 317 |
|
Description: VASP Human Recombinant fused with a 20 amino acid His tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 363 amino acids (1-343 a.a.) and having a molecular mass of 37.5kDa (Molecular weight on SDS-PAGE will appear higher). ;The VASP is purified by proprietary chromatographic techniques. |
 Antibody) Vasodilator Stimulated Phosphoprotein Phospho-Thr278 (VASP pT278) Antibody |
|
20-abx326549 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Antibody) Vasodilator Stimulated Phosphoprotein Phospho-Ser238 (VASP pS238) Antibody |
|
20-abx328568 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Antibody) Vasodilator Stimulated Phosphoprotein Phospho-Ser157 (VASP pS157) Antibody |
|
20-abx329102 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
|
Vasodilator Stimulated Phosphoprotein Phospho-Ser157 (VASP pS157) Antibody |
|
20-abx330021 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
|
Vasodilator Stimulated Phosphoprotein Phospho-Ser157 (VASP pS157) Antibody |
|
abx332983-100ul |
Abbexa |
100 ul |
EUR 467 |
- Shipped within 5-10 working days.
|
 Antibody) Vasodilator Stimulated Phosphoprotein Phospho-Ser239 (VASP pS239) Antibody |
|
abx332986-100ul |
Abbexa |
100 ul |
EUR 467 |
- Shipped within 5-10 working days.
|
 Vasodilator-Stimulated Phosphoprotein Antibody |
|
20-abx116593 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Recombinant Human Vasodilator-Stimulated Phosphoprotein |
|
7-06844 |
CHI Scientific |
2µg |
Ask for price |
|
Recombinant Human Vasodilator-Stimulated Phosphoprotein |
|
7-06845 |
CHI Scientific |
10µg |
Ask for price |
|
Recombinant Human Vasodilator-Stimulated Phosphoprotein |
|
7-06846 |
CHI Scientific |
1mg |
Ask for price |
 ELISA kit for Bovine Vasodilator-stimulated phosphoprotein |
|
EK4996 |
SAB |
96 tests |
EUR 670 |
|
Description: Enzyme-linked immunosorbent assay kit for quantification of Bovine Vasodilator-stimulated phosphoprotein in samples from serum, plasma, tissue homogenates and other biological fluids. |
 ELISA kit for Human Vasodilator-stimulated phosphoprotein |
|
EK4997 |
SAB |
96 tests |
EUR 670 |
|
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Vasodilator-stimulated phosphoprotein in samples from serum, plasma, tissue homogenates and other biological fluids. |
 Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
|
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
 Rat Secreted phosphoprotein 24 ELISA kit |
|
E02S0309-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rat Secreted phosphoprotein 24 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
|
Rat Secreted phosphoprotein 24 ELISA kit |
|
E02S0309-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rat Secreted phosphoprotein 24 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
|
Rat Secreted phosphoprotein 24 ELISA kit |
|
E02S0309-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rat Secreted phosphoprotein 24 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA Kit) Rat Ena/VASP-Like Protein (EVL) ELISA Kit |
|
abx391304-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Rat Golgi phosphoprotein 3 (GOLPH3) ELISA Kit |
|
abx556210-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 1-3 weeks.
|
 ELISA kit) Rat Secreted phosphoprotein 24(SPP2) ELISA kit |
|
E02S0398-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rat Secreted phosphoprotein 24(SPP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
|
Rat Secreted phosphoprotein 24(SPP2) ELISA kit |
|
E02S0398-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rat Secreted phosphoprotein 24(SPP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
|
Rat Secreted phosphoprotein 24(SPP2) ELISA kit |
|
E02S0398-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rat Secreted phosphoprotein 24(SPP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Evl ELISA Kit| Rat Ena/VASP-like protein ELISA Kit |
|
EF018659 |
Lifescience Market |
96 Tests |
EUR 689 |
 ELISA Kit) Rat Lipolysis Stimulated Lipoprotein Receptor (LSR) ELISA Kit |
|
abx391555-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 Golph3 ELISA Kit| Rat Golgi phosphoprotein 3 ELISA Kit |
|
EF018765 |
Lifescience Market |
96 Tests |
EUR 689 |
) VASP Recombinant Protein (Rat) |
|
RP236285 |
ABM |
100 ug |
Ask for price |
 VASP Colorimetric Cell-Based ELISA Kit |
|
EKC1588 |
BosterBio |
100ul |
EUR 572 |
) Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol) |
|
RAT-5 |
Alpha Diagnostics |
1 |
EUR 1138 |
 Human interferon- stimulated protein ELISA Kit |
|
ELA-E1755h |
Lifescience Market |
96 Tests |
EUR 824 |
 Phosphoprotein Purification Kit |
|
AKR-105 |
Cell Biolabs |
2 preps |
EUR 299 |
|
Description: The Phosphoprotein Purification Kit provides an efficient system for quick purification/enrichment of phosphoproteins from various samples. Phosphorylated proteins are affinity purified from lysates with a single-step purification matrix. The entire procedure takes about 4 hours. Each preparation can handle 2.5 mg of total lysate protein (approx. one confluent 100 mm dish). |
|
Phosphoprotein Purification Kit |
|
AKR-106 |
Cell Biolabs |
5 preps |
EUR 485 |
|
Description: The Phosphoprotein Purification Kit provides an efficient system for quick purification/enrichment of phosphoproteins from various samples. Phosphorylated proteins are affinity purified from lysates with a single-step purification matrix. The entire procedure takes about 4 hours. Each preparation can handle 2.5 mg of total lysate protein (approx. one confluent 100 mm dish). |
 VASP Antibody |
|
AF6337 |
Affbiotech |
200ul |
EUR 304 |
|
Description: VASP Antibody detects endogenous levels of total VASP. |
|
VASP Antibody |
|
AF6338 |
Affbiotech |
200ul |
EUR 304 |
|
Description: VASP Antibody detects endogenous levels of total VASP. |
 VASP siRNA |
|
20-abx939342 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
|
VASP siRNA |
|
20-abx939343 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 VASP antibody |
|
70R-50533 |
Fitzgerald |
100 ul |
EUR 244 |
|
Description: Purified Polyclonal VASP antibody |
|
VASP antibody |
|
70R-50534 |
Fitzgerald |
100 ul |
EUR 244 |
|
Description: Purified Polyclonal VASP antibody |
|
VASP antibody |
|
70R-51671 |
Fitzgerald |
100 ul |
EUR 287 |
|
Description: Purified Polyclonal VASP antibody |
|
VASP antibody |
|
70R-34661 |
Fitzgerald |
100 ug |
EUR 327 |
|
Description: Purified Rabbit polyclonal VASP antibody |
|
VASP antibody |
|
70R-21241 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal VASP antibody |
|
VASP antibody |
|
70R-31071 |
Fitzgerald |
100 ug |
EUR 327 |
|
Description: Rabbit polyclonal VASP antibody |
|
VASP Antibody |
|
48793-100ul |
SAB |
100ul |
EUR 333 |
|
VASP Antibody |
|
48793-50ul |
SAB |
50ul |
EUR 239 |
|
VASP antibody |
|
10R-6259 |
Fitzgerald |
100 ul |
EUR 726 |
|
Description: Mouse monoclonal VASP antibody |
|
VASP antibody |
|
10R-6261 |
Fitzgerald |
100 ul |
EUR 691 |
|
Description: Mouse monoclonal VASP antibody |
|
VASP antibody |
|
10R-6262 |
Fitzgerald |
100 ul |
EUR 691 |
|
Description: Mouse monoclonal VASP antibody |
|
VASP antibody |
|
10R-7236 |
Fitzgerald |
100 ul |
EUR 691 |
|
Description: Mouse monoclonal VASP antibody |
|
VASP antibody |
|
20R-1715 |
Fitzgerald |
100 ug |
EUR 716 |
|
Description: Rabbit polyclonal VASP antibody |
|
VASP antibody |
|
20R-2008 |
Fitzgerald |
50 ug |
EUR 281 |
|
Description: Rabbit polyclonal VASP antibody |
|
VASP antibody |
|
20R-2056 |
Fitzgerald |
50 ug |
EUR 281 |
|
Description: Rabbit polyclonal VASP antibody |
|
VASP antibody |
|
20R-2339 |
Fitzgerald |
50 ug |
EUR 281 |
|
Description: Rabbit polyclonal VASP antibody |
|
VASP antibody |
|
20R-2370 |
Fitzgerald |
50 ug |
EUR 281 |
|
Description: Rabbit polyclonal VASP antibody |
|
VASP antibody |
|
70R-12030 |
Fitzgerald |
100 ug |
EUR 403 |
|
Description: Rabbit polyclonal VASP antibody |
|
VASP antibody |
|
70R-10267 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Affinity purified rabbit polyclonal VASP antibody |
|
VASP antibody |
|
70R-10268 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Affinity purified rabbit polyclonal VASP antibody |
|
VASP Antibody |
|
1-CSB-PA004422 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
|
Description: A polyclonal antibody against VASP. Recognizes VASP from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000 |
|
VASP Antibody |
|
1-CSB-PA004424 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
|
Description: A polyclonal antibody against VASP. Recognizes VASP from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000 |
|
VASP Antibody |
|
1-CSB-PA010556 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
|
Description: A polyclonal antibody against VASP. Recognizes VASP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000 |
|
VASP Antibody |
|
1-CSB-PA060049 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
|
Description: A polyclonal antibody against VASP. Recognizes VASP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000 |
|
VASP Antibody |
|
1-CSB-PA025797GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
|
Description: A polyclonal antibody against VASP. Recognizes VASP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF |
 anti-VASP |
|
YF-PA15255 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to VASP |
|
anti-VASP |
|
YF-PA15256 |
Abfrontier |
100 ug |
EUR 403 |
|
Description: Rabbit polyclonal to VASP |
 ELISA Kit) Rat Stress-Induced-Phosphoprotein 1 (STIP1) ELISA Kit |
|
abx556233-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 1-3 weeks.
|
 ELISA kit) Rat Astrocytic phosphoprotein PEA 15(PEA15) ELISA kit |
|
E02A1941-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rat Astrocytic phosphoprotein PEA 15(PEA15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
|
Rat Astrocytic phosphoprotein PEA 15(PEA15) ELISA kit |
|
E02A1941-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rat Astrocytic phosphoprotein PEA 15(PEA15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
|
Rat Astrocytic phosphoprotein PEA 15(PEA15) ELISA kit |
|
E02A1941-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rat Astrocytic phosphoprotein PEA 15(PEA15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Rat Stress-induced-phosphoprotein 1, STI1 ELISA Kit |
|
ELI-23673r |
Lifescience Market |
96 Tests |
EUR 886 |
) ELISA kit for Rat Secreted phosphoprotein 24 (SPP2) |
|
KTE100125-48T |
Abbkine |
48T |
EUR 332 |
- Sphingosine-1-phosphate (S1P) is a bioactive sphingolipid metabolite that regulates diverse biologic processes. SGPP2 catalyzes the degradation of S1P.The deduced 399-amino acid protein has a calculated molecular mass of 44.7 kD and shares 39.3% amin
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Rat Secreted phosphoprotein 24 (SPP2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
|
ELISA kit for Rat Secreted phosphoprotein 24 (SPP2) |
|
KTE100125-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Sphingosine-1-phosphate (S1P) is a bioactive sphingolipid metabolite that regulates diverse biologic processes. SGPP2 catalyzes the degradation of S1P.The deduced 399-amino acid protein has a calculated molecular mass of 44.7 kD and shares 39.3% amin
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Rat Secreted phosphoprotein 24 (SPP2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
|
ELISA kit for Rat Secreted phosphoprotein 24 (SPP2) |
|
KTE100125-96T |
Abbkine |
96T |
EUR 539 |
- Sphingosine-1-phosphate (S1P) is a bioactive sphingolipid metabolite that regulates diverse biologic processes. SGPP2 catalyzes the degradation of S1P.The deduced 399-amino acid protein has a calculated molecular mass of 44.7 kD and shares 39.3% amin
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Rat Secreted phosphoprotein 24 (SPP2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
 Stip1 ELISA Kit| Rat Stress-induced-phosphoprotein 1 ELISA Kit |
|
EF019383 |
Lifescience Market |
96 Tests |
EUR 689 |
 Lsr ELISA Kit| Rat Lipolysis-stimulated lipoprotein receptor EL |
|
EF018913 |
Lifescience Market |
96 Tests |
EUR 689 |
 Frit Kit |
|
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
|
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
 (pORF)) Vasp ORF Vector (Rat) (pORF) |
|
ORF078763 |
ABM |
1.0 ug DNA |
EUR 506 |
 Column Packing Kit |
|
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
|
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
 Mouse Secreted phosphoprotein 24 ELISA kit |
|
E03S0309-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Mouse Secreted phosphoprotein 24 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
|
Mouse Secreted phosphoprotein 24 ELISA kit |
|
E03S0309-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Mouse Secreted phosphoprotein 24 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
|
Mouse Secreted phosphoprotein 24 ELISA kit |
|
E03S0309-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Mouse Secreted phosphoprotein 24 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Rabbit Secreted phosphoprotein 24 ELISA kit |
|
E04S0309-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Secreted phosphoprotein 24 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
|
Rabbit Secreted phosphoprotein 24 ELISA kit |
|
E04S0309-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Secreted phosphoprotein 24 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
|
Rabbit Secreted phosphoprotein 24 ELISA kit |
|
E04S0309-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Secreted phosphoprotein 24 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Human Secreted phosphoprotein 24 ELISA kit |
|
E01S0309-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Secreted phosphoprotein 24 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
|
Human Secreted phosphoprotein 24 ELISA kit |
|
E01S0309-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Secreted phosphoprotein 24 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
|
Human Secreted phosphoprotein 24 ELISA kit |
|
E01S0309-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Secreted phosphoprotein 24 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Goat Secreted phosphoprotein 24 ELISA kit |
|
E06S0309-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Goat Secreted phosphoprotein 24 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
|
Goat Secreted phosphoprotein 24 ELISA kit |
|
E06S0309-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Goat Secreted phosphoprotein 24 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
|
Goat Secreted phosphoprotein 24 ELISA kit |
|
E06S0309-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Goat Secreted phosphoprotein 24 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Dog Secreted phosphoprotein 24 ELISA kit |
|
E08S0309-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Canine Secreted phosphoprotein 24 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
|
Dog Secreted phosphoprotein 24 ELISA kit |
|
E08S0309-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Canine Secreted phosphoprotein 24 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
|
Dog Secreted phosphoprotein 24 ELISA kit |
|
E08S0309-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Canine Secreted phosphoprotein 24 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Pig Secreted phosphoprotein 24 ELISA kit |
|
E07S0309-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Porcine Secreted phosphoprotein 24 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
|
Pig Secreted phosphoprotein 24 ELISA kit |
|
E07S0309-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Porcine Secreted phosphoprotein 24 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
|
Pig Secreted phosphoprotein 24 ELISA kit |
|
E07S0309-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Porcine Secreted phosphoprotein 24 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Monkey Secreted phosphoprotein 24 ELISA kit |
|
E09S0309-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Monkey Secreted phosphoprotein 24 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
|
Monkey Secreted phosphoprotein 24 ELISA kit |
|
E09S0309-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Monkey Secreted phosphoprotein 24 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
|
Monkey Secreted phosphoprotein 24 ELISA kit |
|
E09S0309-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Monkey Secreted phosphoprotein 24 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
ELISA Kit) Human interferon-stimulated protein(ISP)ELISA Kit |
|
GA-E0431HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
|
Human interferon-stimulated protein(ISP)ELISA Kit |
|
GA-E0431HM-96T |
GenAsia Biotech |
96T |
EUR 466 |
 human interferon-stimulated protein,ISP ELISA Kit |
|
201-12-0415 |
SunredBio |
96 tests |
EUR 440 |
- This interferon-stimulated protein ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 PCR Mycoplasma Detection Kit |
|
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
 ELISA Kit) Rat Dentin Matrix Acidic Phosphoprotein 1 (DMP1) ELISA Kit |
|
abx519332-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Rat GAP-Associated Tyrosine Phosphoprotein P62 (KHDRBS1) ELISA Kit |
|
abx391526-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 ELISA kit) Rat Interferon stimulated gene 20 kDa protein(ISG20) ELISA kit |
|
E02I0441-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rat Interferon stimulated gene 20 kDa protein(ISG20) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
|
Rat Interferon stimulated gene 20 kDa protein(ISG20) ELISA kit |
|
E02I0441-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rat Interferon stimulated gene 20 kDa protein(ISG20) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
|
Rat Interferon stimulated gene 20 kDa protein(ISG20) ELISA kit |
|
E02I0441-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rat Interferon stimulated gene 20 kDa protein(ISG20) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 PhosphoSeek? Phosphoprotein Purification Kit |
|
K1401-2 |
Biovision |
|
EUR 512 |
|
PhosphoSeek? Phosphoprotein Purification Kit |
|
K1401-6 |
Biovision |
|
EUR 958 |
 PhosphoSeek? Phosphoprotein Enrichment Kit |
|
K1402-2 |
Biovision |
|
EUR 441 |
|
PhosphoSeek? Phosphoprotein Enrichment Kit |
|
K1402-6 |
Biovision |
|
EUR 784 |
 VASP Blocking Peptide |
|
AF6337-BP |
Affbiotech |
1mg |
EUR 195 |
|
VASP Blocking Peptide |
|
AF6338-BP |
Affbiotech |
1mg |
EUR 195 |
 Polyclonal VASP Antibody |
|
AMM08455G |
Leading Biology |
0.05mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human VASP . This antibody is tested and proven to work in the following applications: |
|
Polyclonal VASP Antibody |
|
AMM08456G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human VASP . This antibody is tested and proven to work in the following applications: |
 VASP Conjugated Antibody |
|
C48793 |
SAB |
100ul |
EUR 397 |
 VASP cloning plasmid |
|
CSB-CL025797HU1-10ug |
Cusabio |
10ug |
EUR 430 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1143
- Sequence: atgagcgagacggtcatctgttccagccgggccactgtgatgctttatgatgatggcaacaagcgatggctccctgctggcacgggtccccaggccttcagccgcgtccagatctaccacaaccccacggccaattcctttcgcgtcgtgggccggaagatgcagcccgaccagc
- Show more
|
|
Description: A cloning plasmid for the VASP gene. |
|
VASP cloning plasmid |
|
CSB-CL025797HU2-10ug |
Cusabio |
10ug |
EUR 430 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1143
- Sequence: atgagcagcgagacggtcatctgttccagccgggccactgtgatgctttatgatgatggcaacaagcgatggctccctgctggcacgggtccccaggccttcagccgcgtccagatctaccacaaccccacggccaattcctttcgcgtcgtgggccggaagatgcagcccgacc
- Show more
|
|
Description: A cloning plasmid for the VASP gene. |
 anti- VASP antibody |
|
FNab09375 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500-1:5000
- IHC: 1:20-1:200；IF: 1:20-1:200
- IP: 1:200-1:2000
- Immunogen: vasodilator-stimulated phosphoprotein
- Uniprot ID: P50552
- Gene ID: 7408
|
|
Description: Antibody raised against VASP |
 VASP Polyclonal Antibody |
|
ES7483-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VASP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
|
VASP Polyclonal Antibody |
|
ES7483-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VASP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
|
VASP Polyclonal Antibody |
|
ES7484-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VASP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
|
VASP Polyclonal Antibody |
|
ES7484-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VASP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
|
VASP Polyclonal Antibody |
|
ES3686-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VASP from Human/Mouse/Rat/Monkey. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA |
|
VASP Polyclonal Antibody |
|
ES3686-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VASP from Human/Mouse/Rat/Monkey. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA |
|
VASP Polyclonal Antibody |
|
ES3687-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VASP from Human/Mouse/Rat/Monkey. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA |
|
VASP Polyclonal Antibody |
|
ES3687-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VASP from Human/Mouse/Rat/Monkey. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA |
 Antibody) VASP (pS157) Antibody |
|
20-abx119337 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
 Antibody) VASP (pS238) Antibody |
|
20-abx119338 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
|
VASP Polyclonal Antibody |
|
ABP52687-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from human VASP around the non-phosphorylation site of S238
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VASP from Human, Mouse, Rat, Monkey. This VASP antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VASP around the non-phosphorylation site of S238 |
|
VASP Polyclonal Antibody |
|
ABP52687-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from human VASP around the non-phosphorylation site of S238
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VASP from Human, Mouse, Rat, Monkey. This VASP antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VASP around the non-phosphorylation site of S238 |
|
VASP Polyclonal Antibody |
|
ABP52687-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from human VASP around the non-phosphorylation site of S238
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VASP from Human, Mouse, Rat, Monkey. This VASP antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VASP around the non-phosphorylation site of S238 |
|
VASP Polyclonal Antibody |
|
ABP52688-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from human VASP around the non-phosphorylation site of S157
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VASP from Human, Mouse, Rat, Monkey. This VASP antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VASP around the non-phosphorylation site of S157 |
|
VASP Polyclonal Antibody |
|
ABP52688-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from human VASP around the non-phosphorylation site of S157
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VASP from Human, Mouse, Rat, Monkey. This VASP antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VASP around the non-phosphorylation site of S157 |
|
VASP Polyclonal Antibody |
|
ABP52688-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from human VASP around the non-phosphorylation site of S157
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VASP from Human, Mouse, Rat, Monkey. This VASP antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VASP around the non-phosphorylation site of S157 |
 Antibody) VASP (pS239) Antibody |
|
20-abx000239 |
Abbexa |
-
EUR 495.00
-
EUR 704.00
-
EUR 356.00
|
|
- Shipped within 5-10 working days.
|
|
VASP (pS157) Antibody |
|
20-abx000265 |
Abbexa |
-
EUR 495.00
-
EUR 704.00
-
EUR 356.00
|
|
- Shipped within 5-10 working days.
|
|
VASP (pS238) Antibody |
|
20-abx133046 |
Abbexa |
-
EUR 314.00
-
EUR 467.00
-
EUR 203.00
|
|
- Shipped within 5-10 working days.
|
|
VASP (pS157) Antibody |
|
20-abx134698 |
Abbexa |
-
EUR 314.00
-
EUR 467.00
-
EUR 203.00
|
|
- Shipped within 5-10 working days.
|
|
VASP Polyclonal Antibody |
|
ABP56484-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from human VASP around the non-phosphorylation site of T278
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VASP from Human, Mouse, Rat. This VASP antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VASP around the non-phosphorylation site of T278 |
|
VASP Polyclonal Antibody |
|
ABP56484-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from human VASP around the non-phosphorylation site of T278
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VASP from Human, Mouse, Rat. This VASP antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VASP around the non-phosphorylation site of T278 |
|
VASP Polyclonal Antibody |
|
ABP56484-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from human VASP around the non-phosphorylation site of T278
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VASP from Human, Mouse, Rat. This VASP antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VASP around the non-phosphorylation site of T278 |
|
VASP Polyclonal Antibody |
|
ABP56485-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from human VASP around the non-phosphorylation site of S157
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VASP from Human, Mouse, Rat. This VASP antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VASP around the non-phosphorylation site of S157 |
Human VASP ELISA Kit 
VASP ELISA KIT|Human ELISA kit)
Rat Stress Induced Phosphoprotein 1(STIP1)ELISA kit