Biotechnological Potential of Streptomyces Siderophores as New Antibiotics.

Siderophores are small molecule iron-chelators produced by microorganisms and vegetation rising principally beneath low iron situations. Siderophores permit iron seize and transport by way of cell membranes into the cytoplasm, the place iron is launched to be used in organic processes.

These bacterial iron uptake programs can be utilized for antibiotic conjugation or as targets for killing pathogenic micro organism. Siderophores have been explored not too long ago due to their potential functions in environmental and therapeutic analysis. They are current in Streptomyces, Gram-positive micro organism which can be an vital supply for locating new siderophores.

This evaluate summarizes siderophore molecules produced by the genus Streptomyces emphasizing their potential as biotechnological producers and likewise illustrating genomic instruments for locating siderophores helpful for treating bacterial infections.The literature search was carried out utilizing PUBMED and MEDLINE databases with key phrases siderophore, secondary metabolites, Trojan horse technique, sideromycin and Streptomyces.

The literature analysis targeted on bibliographic databases together with all siderophores recognized within the genus Streptomyces. In addition, reference genomes of Streptomyces from GenBank had been used to determine siderophore biosynthetic gene clusters by utilizing the antiSMASH platform.

EIF5A2 siRNA
20-abx915222	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EIF5A2 antibody
22904-100ul	SAB	100ul	EUR 390.00

EIF5A2 antibody
70R-3877	Fitzgerald	50 ug	EUR 467.00
Description: Rabbit polyclonal EIF5A2 antibody raised against the N terminal of EIF5A2

eIF5A2 antibody
70R-ER017	Fitzgerald	100 ug	EUR 300.00
Description: Affinity purified Rabbit polyclonal eIF5A2 antibody

eIF5A2 Antibody
ABD8538	Lifescience Market	100 ug	EUR 438.00

EIF5A2 Antibody
1-CSB-PA872418LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EIF5A2. Recognizes EIF5A2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

EIF5A2 Antibody
1-CSB-PA002312	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EIF5A2. Recognizes EIF5A2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

EIF5A2 antibody
70R-13372	Fitzgerald	100 ul	EUR 457.00
Description: Affinity purified Rabbit polyclonal EIF5A2 antibody

EIF5A2 antibody
70R-17065	Fitzgerald	50 ul	EUR 435.00
Description: Rabbit polyclonal EIF5A2 antibody

EIF5A2 Antibody
1-CSB-PA007574GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against EIF5A2. Recognizes EIF5A2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

anti-EIF5A2
YF-PA26427	Abfrontier	50 ul	EUR 334.00
Description: Mouse polyclonal to EIF5A2

anti-EIF5A2
YF-PA20016	Abfrontier	50 ug	EUR 363.00
Description: Mouse polyclonal to EIF5A2

anti-EIF5A2
YF-PA20017	Abfrontier	100 ul	EUR 403.00
Description: Rabbit polyclonal to EIF5A2

anti-EIF5A2
YF-PA20018	Abfrontier	100 ug	EUR 403.00
Description: Rabbit polyclonal to EIF5A2

eIF5A2 Antibody
DF8538	Affbiotech	200ul	EUR 304.00
Description: eIF5A2 Antibody detects endogenous levels of total eIF5A2.

EIF5A2 Blocking Peptide
20-abx061994	Abbexa	EUR 258.00 EUR 384.00	1 mg 5 mg
Shipped within 5-10 working days.

eIF5A2 Polyclonal Antibody
ABP51250-003ml	Abbkine	0.03ml	EUR 158.00
Immunogen information: Synthesized peptide derived from the Internal region of human eIF5A2 Applications tips:
Description: A polyclonal antibody for detection of eIF5A2 from Human, Mouse. This eIF5A2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human eIF5A2

eIF5A2 Polyclonal Antibody
ABP51250-01ml	Abbkine	0.1ml	EUR 289.00
Immunogen information: Synthesized peptide derived from the Internal region of human eIF5A2 Applications tips:
Description: A polyclonal antibody for detection of eIF5A2 from Human, Mouse. This eIF5A2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human eIF5A2

eIF5A2 Polyclonal Antibody
ABP51250-02ml	Abbkine	0.2ml	EUR 414.00
Immunogen information: Synthesized peptide derived from the Internal region of human eIF5A2 Applications tips:
Description: A polyclonal antibody for detection of eIF5A2 from Human, Mouse. This eIF5A2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human eIF5A2

EIF5A2 Polyclonal Antibody
A67474	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

EIF5A2 Polyclonal Antibody
E-AB-31301-120uL	Elabscience Biotechnology	120uL	EUR 257.00
Conjugation: Unconjugated Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4 Purified by: Affinity purification Background: EIF5A2 (Eukaryotic Translation Initiation Factor 5A2) is a Protein Coding gene. Among its re Show more
Description: Rabbit antibody against Human,Mouse EIF5A2 for WB,ELISA applications.

EIF5A2 Polyclonal Antibody
E-AB-31301-20uL	Elabscience Biotechnology	20uL	EUR 130.00
Conjugation: Unconjugated Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4 Purified by: Affinity purification Background: EIF5A2 (Eukaryotic Translation Initiation Factor 5A2) is a Protein Coding gene. Among its re Show more
Description: Rabbit antibody against Human,Mouse EIF5A2 for WB,ELISA applications.

EIF5A2 Polyclonal Antibody
E-AB-31301-60uL	Elabscience Biotechnology	60uL	EUR 175.00
Conjugation: Unconjugated Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4 Purified by: Affinity purification Background: EIF5A2 (Eukaryotic Translation Initiation Factor 5A2) is a Protein Coding gene. Among its re Show more
Description: Rabbit antibody against Human,Mouse EIF5A2 for WB,ELISA applications.

eIF5A2 Polyclonal Antibody
ES2249-100ul	ELK Biotech	100ul	EUR 279.00
Description: A Rabbit Polyclonal antibody against eIF5A2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

eIF5A2 Polyclonal Antibody
ES2249-50ul	ELK Biotech	50ul	EUR 207.00
Description: A Rabbit Polyclonal antibody against eIF5A2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

EIF5A2 cloning plasmid
CSB-CL872418HU-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 462 Sequence: atggcagacgaaattgatttcactactggagatgccggggcttccagcacttaccctatgcagtgctcggccttgcgcaaaaacggcttcgtggtgctcaaaggacgaccatgcaaaatagtggagatgtcaacttccaaaactggaaagcatggtcatgccaaggttcaccttgt Show more
Description: A cloning plasmid for the EIF5A2 gene.

EIF5A2 Polyclonal Antibody
30619-100ul	SAB	100ul	EUR 252.00

EIF5A2 Polyclonal Antibody
30619-50ul	SAB	50ul	EUR 187.00

EIF5A2 Blocking Peptide
33R-5619	Fitzgerald	100 ug	EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EIF5A2 antibody, catalog no. 70R-3877

Anti-EIF5A2 (1E7)
YF-MA11589	Abfrontier	100 ug	EUR 363.00
Description: Mouse monoclonal to EIF5A2

Anti-EIF5A2 antibody
PAab02729	Lifescience Market	100 ug	EUR 355.00

EIF5A2 Rabbit pAb
A4864-100ul	Abclonal	100 ul	EUR 308.00

EIF5A2 Rabbit pAb
A4864-200ul	Abclonal	200 ul	EUR 459.00

EIF5A2 Rabbit pAb
A4864-20ul	Abclonal	20 ul	EUR 183.00

EIF5A2 Rabbit pAb
A4864-50ul	Abclonal	50 ul	EUR 223.00

eIF5A2 Blocking Peptide
DF8538-BP	Affbiotech	1mg	EUR 195.00

anti- EIF5A2 antibody
FNab02729	FN Test	100µg	EUR 505.25
Immunogen: eukaryotic translation initiation factor 5A2 Uniprot ID: Q9GZV4 Gene ID: 56648 Research Area: Metabolism
Description: Antibody raised against EIF5A2

Anti-EIF5A2 antibody
STJ26921	St John's Laboratory	100 µl	EUR 277.00

Anti-eIF5A2 antibody
STJ92885	St John's Laboratory	200 µl	EUR 197.00
Description: Rabbit polyclonal to eIF5A2.

EIF5A2 protein (His tag)
80R-1359	Fitzgerald	50 ug	EUR 397.00
Description: Purified recombinant Human EIF5A2 protein

EIF5A2 Antibody, HRP conjugated
1-CSB-PA872418LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EIF5A2. Recognizes EIF5A2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

EIF5A2 Antibody, FITC conjugated
1-CSB-PA872418LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EIF5A2. Recognizes EIF5A2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

EIF5A2 Antibody, Biotin conjugated
1-CSB-PA872418LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EIF5A2. Recognizes EIF5A2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

EIF5A2 ELISA KIT|Human
EF009360	Lifescience Market	96 Tests	EUR 689.00

Human EIF5A2 shRNA Plasmid
20-abx961155	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse EIF5A2 shRNA Plasmid
20-abx980567	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

EIF5A2 Polyclonal Conjugated Antibody
C30619	SAB	100ul	EUR 397.00

eIF5A2 Recombinant Protein (Human)
RP010501	ABM	100 ug	Ask for price

eIF5A2 Recombinant Protein (Mouse)
RP131426	ABM	100 ug	Ask for price

eIF5A2 Recombinant Protein (Rat)
RP199427	ABM	100 ug	Ask for price

EIF5A2 Polyclonal Antibody, HRP Conjugated
A67475	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

EIF5A2 Polyclonal Antibody, FITC Conjugated
A67476	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

EIF5A2 Polyclonal Antibody, Biotin Conjugated
A67477	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

EIF5A2 ORF Vector (Human) (pORF)
ORF003501	ABM	1.0 ug DNA	EUR 95.00

Eif5a2 ORF Vector (Mouse) (pORF)
ORF043810	ABM	1.0 ug DNA	EUR 506.00

Eif5a2 ORF Vector (Rat) (pORF)
ORF066477	ABM	1.0 ug DNA	EUR 506.00

Anti-Acetyl-eIF5A/eIF5A2 (K47) Antibody
A05688	BosterBio	100ul	EUR 397.00
Description: Rabbit Polyclonal Antibody for Acetyl-eIF5A/eIF5A2 (K47) Antibody (EIF5A2) detection.tested for WB in Human, Mouse, Rat.

Acetyl eIF5A/eIF5A2 (K47) Polyclonal Antibody
ABP50097-003ml	Abbkine	0.03ml	EUR 158.00
Immunogen information: Synthesized peptide derived from the human eIF5A/eIF5A2 around the acetylation site of K47 Applications tips:
Description: A polyclonal antibody for detection of Acetyl eIF5A/eIF5A2 K47) from Human, Mouse, Rat. This Acetyl eIF5A/eIF5A2 K47) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the human eIF5A/eIF5A2 around the acetylation site of K47

Acetyl eIF5A/eIF5A2 (K47) Polyclonal Antibody
ABP50097-01ml	Abbkine	0.1ml	EUR 289.00
Immunogen information: Synthesized peptide derived from the human eIF5A/eIF5A2 around the acetylation site of K47 Applications tips:
Description: A polyclonal antibody for detection of Acetyl eIF5A/eIF5A2 K47) from Human, Mouse, Rat. This Acetyl eIF5A/eIF5A2 K47) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the human eIF5A/eIF5A2 around the acetylation site of K47

Acetyl eIF5A/eIF5A2 (K47) Polyclonal Antibody
ABP50097-02ml	Abbkine	0.2ml	EUR 414.00
Immunogen information: Synthesized peptide derived from the human eIF5A/eIF5A2 around the acetylation site of K47 Applications tips:
Description: A polyclonal antibody for detection of Acetyl eIF5A/eIF5A2 K47) from Human, Mouse, Rat. This Acetyl eIF5A/eIF5A2 K47) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the human eIF5A/eIF5A2 around the acetylation site of K47

Acetyl eIF5A/eIF5A2 (K47) Polyclonal Antibody
ES1096-100ul	ELK Biotech	100ul	EUR 279.00
Description: A Rabbit Polyclonal antibody against Acetyl eIF5A/eIF5A2 (K47) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Acetyl eIF5A/eIF5A2 (K47) Polyclonal Antibody
ES1096-50ul	ELK Biotech	50ul	EUR 207.00
Description: A Rabbit Polyclonal antibody against Acetyl eIF5A/eIF5A2 (K47) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

EIF5A2 sgRNA CRISPR Lentivector set (Human)
K0671501	ABM	3 x 1.0 ug	EUR 339.00

Eif5a2 sgRNA CRISPR Lentivector set (Rat)
K6225801	ABM	3 x 1.0 ug	EUR 339.00

Eif5a2 sgRNA CRISPR Lentivector set (Mouse)
K5022201	ABM	3 x 1.0 ug	EUR 339.00

Anti-eIF5A/eIF5A2 (Acetyl K47) antibody
STJ90136	St John's Laboratory	200 µl	EUR 197.00
Description: Rabbit polyclonal to Acetyl-eIF5A/eIF5A2 (K47).

Eukaryotic Translation Initiation Factor 5A2 (EIF5A2) Antibody
20-abx325418	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 5A2 (EIF5A2) Antibody
20-abx112391	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

EIF5A2 sgRNA CRISPR Lentivector (Human) (Target 1)
K0671502	ABM	1.0 ug DNA	EUR 154.00

EIF5A2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0671503	ABM	1.0 ug DNA	EUR 154.00

EIF5A2 sgRNA CRISPR Lentivector (Human) (Target 3)
K0671504	ABM	1.0 ug DNA	EUR 154.00

eIF5A2 Protein Vector (Rat) (pPB-C-His)
PV265906	ABM	500 ng	EUR 603.00

eIF5A2 Protein Vector (Rat) (pPB-N-His)
PV265907	ABM	500 ng	EUR 603.00

eIF5A2 Protein Vector (Rat) (pPM-C-HA)
PV265908	ABM	500 ng	EUR 603.00

eIF5A2 Protein Vector (Rat) (pPM-C-His)
PV265909	ABM	500 ng	EUR 603.00

EIF5A2 3'UTR Luciferase Stable Cell Line
TU006798	ABM	1.0 ml	EUR 4617.00

EIF5A2 3'UTR GFP Stable Cell Line
TU056798	ABM	1.0 ml	EUR 4617.00

Eif5a2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6225802	ABM	1.0 ug DNA	EUR 154.00

Eif5a2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6225803	ABM	1.0 ug DNA	EUR 154.00

Eif5a2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6225804	ABM	1.0 ug DNA	EUR 154.00

Eif5a2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K5022202	ABM	1.0 ug DNA	EUR 154.00

Eif5a2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K5022203	ABM	1.0 ug DNA	EUR 154.00

Eif5a2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K5022204	ABM	1.0 ug DNA	EUR 154.00

eIF5A2 Protein Vector (Mouse) (pPB-C-His)
PV175238	ABM	500 ng	EUR 603.00

eIF5A2 Protein Vector (Mouse) (pPB-N-His)
PV175239	ABM	500 ng	EUR 603.00

eIF5A2 Protein Vector (Mouse) (pPM-C-HA)
PV175240	ABM	500 ng	EUR 603.00

eIF5A2 Protein Vector (Mouse) (pPM-C-His)
PV175241	ABM	500 ng	EUR 603.00

Eif5a2 3'UTR GFP Stable Cell Line
TU155744	ABM	1.0 ml	Ask for price

Eif5a2 3'UTR GFP Stable Cell Line
TU253911	ABM	1.0 ml	Ask for price

Eif5a2 3'UTR Luciferase Stable Cell Line
TU203911	ABM	1.0 ml	Ask for price

Eif5a2 3'UTR Luciferase Stable Cell Line
TU105744	ABM	1.0 ml	Ask for price

eIF5A2 Protein Vector (Human) (pPB-C-His)
PV014001	ABM	500 ng	EUR 329.00

eIF5A2 Protein Vector (Human) (pPB-N-His)
PV014002	ABM	500 ng	EUR 329.00

eIF5A2 Protein Vector (Human) (pPM-C-HA)
PV014003	ABM	500 ng	EUR 329.00

eIF5A2 Protein Vector (Human) (pPM-C-His)
PV014004	ABM	500 ng	EUR 329.00

Recombinant Human EIF5A2 Protein, His, E.coli-10ug
QP11776-10ug	EnQuireBio	10ug	EUR 201.00

Recombinant Human EIF5A2 Protein, His, E.coli-1mg
QP11776-1mg	EnQuireBio	1mg	EUR 5251.00

Recombinant Human EIF5A2 Protein, His, E.coli-2ug
QP11776-2ug	EnQuireBio	2ug	EUR 155.00

Eukaryotic Translation Initiation Factor 5A-2 (eIF5A2) Antibody
abx215127-100ug	Abbexa	100 ug	EUR 439.00
Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 5A-2 (EIF5A2) Antibody
abx232729-100ug	Abbexa	100 ug	EUR 481.00
Shipped within 5-12 working days.

Eukaryotic Translation Initiation Factor 5A-2 (EIF5A2) Antibody
abx027767-400ul	Abbexa	400 ul	EUR 523.00
Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 5A-2 (EIF5A2) Antibody
abx027767-80l	Abbexa	80 µl	EUR 286.00
Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 5A-2 (EIF5A2) Antibody
20-abx003689	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 5A-2 (EIF5A2) Antibody
20-abx301687	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 5A-2 (EIF5A2) Antibody
20-abx141296	Abbexa	EUR 356.00 EUR 537.00 EUR 217.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 5A-2 (EIF5A2) Antibody (HRP)
20-abx311145	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 5A-2 (EIF5A2) Antibody (FITC)
20-abx311146	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 5A-2 (EIF5A2) Antibody (Biotin)
20-abx311147	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Chicken Eukaryotic translation initiation factor 5A- 2, EIF5A2 E
ELI-20520c	Lifescience Market	96 Tests	EUR 928.00

Human Eukaryotic translation initiation factor 5A- 2, EIF5A2 ELI
ELI-13401h	Lifescience Market	96 Tests	EUR 824.00

Mouse Eukaryotic translation initiation factor 5A- 2, Eif5a2 ELI
ELI-43382m	Lifescience Market	96 Tests	EUR 865.00

Human Eukaryotic Translation Initiation Factor 5A2 (EIF5A2) ELISA Kit
20-abx585135	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Eukaryotic Translation Initiation Factor 5A2 (EIF5A2) ELISA Kit
SEL486Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5189.65
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Eukaryotic Translation Initiation Factor 5A2 (EIF5A2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Eukaryotic Translation Initiation Factor 5A2 (EIF5A2) in tissue homogenates, cell lysates and other biological fluids.

Human Eukaryotic Translation Initiation Factor 5A2 (EIF5A2) ELISA Kit
SEL486Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 515.03
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Eukaryotic Translation Initiation Factor 5A2 (EIF5A2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Eukaryotic Translation Initiation Factor 5A2 (EIF5A2) in tissue homogenates, cell lysates and other biological fluids.

Human Eukaryotic Translation Initiation Factor 5A2 (EIF5A2) ELISA Kit
SEL486Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 692.90
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Eukaryotic Translation Initiation Factor 5A2 (EIF5A2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Eukaryotic Translation Initiation Factor 5A2 (EIF5A2) in tissue homogenates, cell lysates and other biological fluids.

Human Eukaryotic Translation Initiation Factor 5A2 (EIF5A2) ELISA Kit
SEL486Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2818.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Eukaryotic Translation Initiation Factor 5A2 (EIF5A2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Eukaryotic Translation Initiation Factor 5A2 (EIF5A2) in tissue homogenates, cell lysates and other biological fluids.

Human Eukaryotic Translation Initiation Factor 5A2 (EIF5A2) ELISA Kit
4-SEL486Hu	Cloud-Clone	EUR 5240.00 EUR 2769.00 EUR 693.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Eukaryotic Translation Initiation Factor 5A2 elisa. Alternative names of the recognized antigen: EIF-5A2 eIF5AII Eukaryotic initiation factor 5A isoform 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Eukaryotic Translation Initiation Factor 5A2 (EIF5A2) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

EIF5A2 Eukaryotic Translation Initiation Factor 5A2 Human Recombinant Protein
PROTQ9GZV4	BosterBio	Regular: 10ug	EUR 317.00
Description: EIF5A2 Recombinant E.coli produced in E.Coli is a single, non-glycosylated polypeptide chain containing 173 amino acids (1-153 a.a.) and having a molecular mass of 18.9 kDa. The EIF5A2 is fused to a 20 amino acid His-Tag at N-terminus and purified by proprietary chromatographic techniques.

EIF5A2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0671505	ABM	3 x 1.0 ug	EUR 376.00

Eif5a2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6225805	ABM	3 x 1.0 ug	EUR 376.00

Eif5a2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K5022205	ABM	3 x 1.0 ug	EUR 376.00

EIF5A2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K0671506	ABM	1.0 ug DNA	EUR 167.00

EIF5A2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K0671507	ABM	1.0 ug DNA	EUR 167.00

EIF5A2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K0671508	ABM	1.0 ug DNA	EUR 167.00

Eif5a2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6225806	ABM	1.0 ug DNA	EUR 167.00

Eif5a2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6225807	ABM	1.0 ug DNA	EUR 167.00

Eif5a2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6225808	ABM	1.0 ug DNA	EUR 167.00

Eif5a2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K5022206	ABM	1.0 ug DNA	EUR 167.00

Eif5a2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K5022207	ABM	1.0 ug DNA	EUR 167.00

Eif5a2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K5022208	ABM	1.0 ug DNA	EUR 167.00

Recombinant Human Eukaryotic Translation Initiation Factor 5A-2/EIF5A2 (N-6His)
CG95-10ug	Novoprotein	10ug	EUR 146.00
Description: Lyophilized from a 0.2 μm filtered solution of 20mM Tris,150mM NaCl, pH 8.0.

Recombinant Human Eukaryotic Translation Initiation Factor 5A-2/EIF5A2 (N-6His)
CG95-1mg	Novoprotein	1mg	EUR 2283.00
Description: Lyophilized from a 0.2 μm filtered solution of 20mM Tris,150mM NaCl, pH 8.0.

Recombinant Human Eukaryotic Translation Initiation Factor 5A-2/EIF5A2 (N-6His)
CG95-500ug	Novoprotein	500ug	EUR 1613.00
Description: Lyophilized from a 0.2 μm filtered solution of 20mM Tris,150mM NaCl, pH 8.0.

Recombinant Human Eukaryotic Translation Initiation Factor 5A-2/EIF5A2 (N-6His)
CG95-50ug	Novoprotein	50ug	EUR 339.00
Description: Lyophilized from a 0.2 μm filtered solution of 20mM Tris,150mM NaCl, pH 8.0.

This evaluate has highlighted a number of the many siderophore molecules produced by Streptomyces, illustrating the variety of their chemical buildings and broad spectrum of bioactivities towards pathogenic micro organism.

Furthermore, the potential for utilizing siderophores conjugated with antibiotics may very well be a substitute for overcome bacterial resistance to medicine and will enhance their therapeutic efficacy.This evaluate confirms the significance of Streptomyces as a wealthy supply of siderophores, and underlines their potential as antibacterial brokers.