Biotechnological Potential of Streptomyces Siderophores as New Antibiotics.

Siderophores are small molecule iron-chelators produced by microorganisms and vegetation rising principally beneath low iron situations. Siderophores permit iron seize and transport by way of cell membranes into the cytoplasm, the place iron is launched to be used in organic processes.

These bacterial iron uptake programs can be utilized for antibiotic conjugation or as targets for killing pathogenic micro organism. Siderophores have been explored not too long ago due to their potential functions in environmental and therapeutic analysis. They are current in Streptomyces, Gram-positive micro organism which can be an vital supply for locating new siderophores.

This evaluate summarizes siderophore molecules produced by the genus Streptomyces emphasizing their potential as biotechnological producers and likewise illustrating genomic instruments for locating siderophores helpful for treating bacterial infections.The literature search was carried out utilizing PUBMED and MEDLINE databases with key phrases siderophore, secondary metabolites, Trojan horse technique, sideromycin and Streptomyces.

The literature analysis targeted on bibliographic databases together with all siderophores recognized within the genus Streptomyces. In addition, reference genomes of Streptomyces from GenBank had been used to determine siderophore biosynthetic gene clusters by utilizing the antiSMASH platform.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EIF5A2 antibody

70R-3877 50 ug
EUR 467.00
Description: Rabbit polyclonal EIF5A2 antibody raised against the N terminal of EIF5A2

eIF5A2 antibody

70R-ER017 100 ug
EUR 300.00
Description: Affinity purified Rabbit polyclonal eIF5A2 antibody

EIF5A2 antibody

70R-17065 50 ul
EUR 435.00
Description: Rabbit polyclonal EIF5A2 antibody

EIF5A2 antibody

70R-13372 100 ul
EUR 457.00
Description: Affinity purified Rabbit polyclonal EIF5A2 antibody

eIF5A2 Antibody

ABD8538 100 ug
EUR 438.00

EIF5A2 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EIF5A2. Recognizes EIF5A2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

eIF5A2 Antibody

DF8538 200ul
EUR 304.00
Description: eIF5A2 Antibody detects endogenous levels of total eIF5A2.

EIF5A2 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EIF5A2. Recognizes EIF5A2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

EIF5A2 antibody

22904-100ul 100ul
EUR 390.00

EIF5A2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against EIF5A2. Recognizes EIF5A2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC


YF-PA20016 50 ug
EUR 363.00
Description: Mouse polyclonal to EIF5A2


YF-PA20017 100 ul
EUR 403.00
Description: Rabbit polyclonal to EIF5A2


YF-PA20018 100 ug
EUR 403.00
Description: Rabbit polyclonal to EIF5A2


YF-PA26427 50 ul
EUR 334.00
Description: Mouse polyclonal to EIF5A2

EIF5A2 Rabbit pAb

A4864-100ul 100 ul
EUR 308.00

EIF5A2 Rabbit pAb

A4864-200ul 200 ul
EUR 459.00

EIF5A2 Rabbit pAb

A4864-20ul 20 ul
EUR 183.00

EIF5A2 Rabbit pAb

A4864-50ul 50 ul
EUR 223.00

eIF5A2 Polyclonal Antibody

ABP51250-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human eIF5A2
  • Applications tips:
Description: A polyclonal antibody for detection of eIF5A2 from Human, Mouse. This eIF5A2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human eIF5A2

eIF5A2 Polyclonal Antibody

ABP51250-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human eIF5A2
  • Applications tips:
Description: A polyclonal antibody for detection of eIF5A2 from Human, Mouse. This eIF5A2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human eIF5A2

eIF5A2 Polyclonal Antibody

ABP51250-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human eIF5A2
  • Applications tips:
Description: A polyclonal antibody for detection of eIF5A2 from Human, Mouse. This eIF5A2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human eIF5A2

EIF5A2 Polyclonal Antibody

A67474 100 µg
EUR 570.55
Description: reagents widely cited

eIF5A2 Blocking Peptide

DF8538-BP 1mg
EUR 195.00

EIF5A2 Blocking Peptide

33R-5619 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EIF5A2 antibody, catalog no. 70R-3877

EIF5A2 Polyclonal Antibody

30619-100ul 100ul
EUR 252.00

EIF5A2 Polyclonal Antibody

30619-50ul 50ul
EUR 187.00

EIF5A2 Blocking Peptide

  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

EIF5A2 Polyclonal Antibody

E-AB-31301-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: EIF5A2 (Eukaryotic Translation Initiation Factor 5A2) is a Protein Coding gene. Among its re
  • Show more
Description: Rabbit antibody against Human,Mouse EIF5A2 for WB,ELISA applications.

EIF5A2 Polyclonal Antibody

E-AB-31301-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: EIF5A2 (Eukaryotic Translation Initiation Factor 5A2) is a Protein Coding gene. Among its re
  • Show more
Description: Rabbit antibody against Human,Mouse EIF5A2 for WB,ELISA applications.

EIF5A2 Polyclonal Antibody

E-AB-31301-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: EIF5A2 (Eukaryotic Translation Initiation Factor 5A2) is a Protein Coding gene. Among its re
  • Show more
Description: Rabbit antibody against Human,Mouse EIF5A2 for WB,ELISA applications.

EIF5A2 cloning plasmid

CSB-CL872418HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 462
  • Sequence: atggcagacgaaattgatttcactactggagatgccggggcttccagcacttaccctatgcagtgctcggccttgcgcaaaaacggcttcgtggtgctcaaaggacgaccatgcaaaatagtggagatgtcaacttccaaaactggaaagcatggtcatgccaaggttcaccttgt
  • Show more
Description: A cloning plasmid for the EIF5A2 gene.

Anti-EIF5A2 antibody

PAab02729 100 ug
EUR 355.00

anti- EIF5A2 antibody

FNab02729 100µg
EUR 505.25
  • Immunogen: eukaryotic translation initiation factor 5A2
  • Uniprot ID: Q9GZV4
  • Gene ID: 56648
  • Research Area: Metabolism
Description: Antibody raised against EIF5A2

eIF5A2 Polyclonal Antibody

ES2249-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against eIF5A2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

eIF5A2 Polyclonal Antibody

ES2249-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against eIF5A2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-EIF5A2 antibody

STJ26921 100 µl
EUR 277.00

Anti-eIF5A2 antibody

STJ92885 200 µl
EUR 197.00
Description: Rabbit polyclonal to eIF5A2.

Anti-EIF5A2 (1E7)

YF-MA11589 100 ug
EUR 363.00
Description: Mouse monoclonal to EIF5A2

Human EIF5A2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse EIF5A2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

EIF5A2 protein (His tag)

80R-1359 50 ug
EUR 397.00
Description: Purified recombinant Human EIF5A2 protein

EIF5A2 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EIF5A2. Recognizes EIF5A2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

EIF5A2 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EIF5A2. Recognizes EIF5A2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

EIF5A2 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EIF5A2. Recognizes EIF5A2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

EIF5A2 Polyclonal Conjugated Antibody

C30619 100ul
EUR 397.00


EF009360 96 Tests
EUR 689.00

eIF5A2 Recombinant Protein (Human)

RP010501 100 ug Ask for price

eIF5A2 Recombinant Protein (Rat)

RP199427 100 ug Ask for price

eIF5A2 Recombinant Protein (Mouse)

RP131426 100 ug Ask for price

EIF5A2 Polyclonal Antibody, HRP Conjugated

A67475 100 µg
EUR 570.55
Description: Ask the seller for details

EIF5A2 Polyclonal Antibody, FITC Conjugated

A67476 100 µg
EUR 570.55
Description: The best epigenetics products

EIF5A2 Polyclonal Antibody, Biotin Conjugated

A67477 100 µg
EUR 570.55
Description: kits suitable for this type of research

EIF5A2 ORF Vector (Human) (pORF)

ORF003501 1.0 ug DNA
EUR 95.00

Eif5a2 ORF Vector (Rat) (pORF)

ORF066477 1.0 ug DNA
EUR 506.00

Eif5a2 ORF Vector (Mouse) (pORF)

ORF043810 1.0 ug DNA
EUR 506.00

Anti-Acetyl-eIF5A/eIF5A2 (K47) Antibody

A05688 100ul
EUR 397.00
Description: Rabbit Polyclonal Antibody for Acetyl-eIF5A/eIF5A2 (K47) Antibody (EIF5A2) detection.tested for WB in Human, Mouse, Rat.

Acetyl eIF5A/eIF5A2 (K47) Polyclonal Antibody

ABP50097-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from the human eIF5A/eIF5A2 around the acetylation site of K47
  • Applications tips:
Description: A polyclonal antibody for detection of Acetyl eIF5A/eIF5A2 K47) from Human, Mouse, Rat. This Acetyl eIF5A/eIF5A2 K47) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the human eIF5A/eIF5A2 around the acetylation site of K47

Acetyl eIF5A/eIF5A2 (K47) Polyclonal Antibody

ABP50097-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from the human eIF5A/eIF5A2 around the acetylation site of K47
  • Applications tips:
Description: A polyclonal antibody for detection of Acetyl eIF5A/eIF5A2 K47) from Human, Mouse, Rat. This Acetyl eIF5A/eIF5A2 K47) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the human eIF5A/eIF5A2 around the acetylation site of K47

Acetyl eIF5A/eIF5A2 (K47) Polyclonal Antibody

ABP50097-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from the human eIF5A/eIF5A2 around the acetylation site of K47
  • Applications tips:
Description: A polyclonal antibody for detection of Acetyl eIF5A/eIF5A2 K47) from Human, Mouse, Rat. This Acetyl eIF5A/eIF5A2 K47) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the human eIF5A/eIF5A2 around the acetylation site of K47

Acetyl eIF5A/eIF5A2 (K47) Polyclonal Antibody

ES1096-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against Acetyl eIF5A/eIF5A2 (K47) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Acetyl eIF5A/eIF5A2 (K47) Polyclonal Antibody

ES1096-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against Acetyl eIF5A/eIF5A2 (K47) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

EIF5A2 sgRNA CRISPR Lentivector set (Human)

K0671501 3 x 1.0 ug
EUR 339.00

Eif5a2 sgRNA CRISPR Lentivector set (Mouse)

K5022201 3 x 1.0 ug
EUR 339.00

Eif5a2 sgRNA CRISPR Lentivector set (Rat)

K6225801 3 x 1.0 ug
EUR 339.00

Anti-eIF5A/eIF5A2 (Acetyl K47) antibody

STJ90136 200 µl
EUR 197.00
Description: Rabbit polyclonal to Acetyl-eIF5A/eIF5A2 (K47).

Eukaryotic Translation Initiation Factor 5A2 (EIF5A2) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 5A2 (EIF5A2) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

eIF5A2 Protein Vector (Human) (pPB-C-His)

PV014001 500 ng
EUR 329.00

eIF5A2 Protein Vector (Human) (pPB-N-His)

PV014002 500 ng
EUR 329.00

eIF5A2 Protein Vector (Human) (pPM-C-HA)

PV014003 500 ng
EUR 329.00

eIF5A2 Protein Vector (Human) (pPM-C-His)

PV014004 500 ng
EUR 329.00

EIF5A2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0671502 1.0 ug DNA
EUR 154.00

EIF5A2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0671503 1.0 ug DNA
EUR 154.00

EIF5A2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0671504 1.0 ug DNA
EUR 154.00

Eif5a2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K5022202 1.0 ug DNA
EUR 154.00

Eif5a2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K5022203 1.0 ug DNA
EUR 154.00

Eif5a2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K5022204 1.0 ug DNA
EUR 154.00

Eif5a2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6225802 1.0 ug DNA
EUR 154.00

Eif5a2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6225803 1.0 ug DNA
EUR 154.00

Eif5a2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6225804 1.0 ug DNA
EUR 154.00

eIF5A2 Protein Vector (Mouse) (pPB-C-His)

PV175238 500 ng
EUR 603.00

eIF5A2 Protein Vector (Mouse) (pPB-N-His)

PV175239 500 ng
EUR 603.00

eIF5A2 Protein Vector (Mouse) (pPM-C-HA)

PV175240 500 ng
EUR 603.00

eIF5A2 Protein Vector (Mouse) (pPM-C-His)

PV175241 500 ng
EUR 603.00

Recombinant Human EIF5A2 Protein, His, E.coli-10ug

QP11776-10ug 10ug
EUR 201.00

Recombinant Human EIF5A2 Protein, His, E.coli-1mg

QP11776-1mg 1mg
EUR 5251.00

Recombinant Human EIF5A2 Protein, His, E.coli-2ug

QP11776-2ug 2ug
EUR 155.00

EIF5A2 3'UTR Luciferase Stable Cell Line

TU006798 1.0 ml
EUR 4617.00

EIF5A2 3'UTR GFP Stable Cell Line

TU056798 1.0 ml
EUR 4617.00

eIF5A2 Protein Vector (Rat) (pPB-C-His)

PV265906 500 ng
EUR 603.00

eIF5A2 Protein Vector (Rat) (pPB-N-His)

PV265907 500 ng
EUR 603.00

eIF5A2 Protein Vector (Rat) (pPM-C-HA)

PV265908 500 ng
EUR 603.00

eIF5A2 Protein Vector (Rat) (pPM-C-His)

PV265909 500 ng
EUR 603.00

Eif5a2 3'UTR GFP Stable Cell Line

TU253911 1.0 ml Ask for price

Eif5a2 3'UTR Luciferase Stable Cell Line

TU105744 1.0 ml Ask for price

Eif5a2 3'UTR Luciferase Stable Cell Line

TU203911 1.0 ml Ask for price

Eif5a2 3'UTR GFP Stable Cell Line

TU155744 1.0 ml Ask for price

Eukaryotic Translation Initiation Factor 5A-2 (eIF5A2) Antibody

abx215127-100ug 100 ug
EUR 439.00
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 5A-2 (EIF5A2) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 5A-2 (EIF5A2) Antibody

abx027767-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 5A-2 (EIF5A2) Antibody

abx027767-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 5A-2 (EIF5A2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 5A-2 (EIF5A2) Antibody

  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 5A-2 (EIF5A2) Antibody

abx232729-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

Human Eukaryotic Translation Initiation Factor 5A2 (EIF5A2) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Eukaryotic Translation Initiation Factor 5A-2 (EIF5A2) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 5A-2 (EIF5A2) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 5A-2 (EIF5A2) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

EIF5A2 Eukaryotic Translation Initiation Factor 5A2 Human Recombinant Protein

PROTQ9GZV4 Regular: 10ug
EUR 317.00
Description: EIF5A2 Recombinant E.coli produced in E.Coli is a single, non-glycosylated polypeptide chain containing 173 amino acids (1-153 a.a.) and having a molecular mass of 18.9 kDa. The EIF5A2 is fused to a 20 amino acid His-Tag at N-terminus and purified by proprietary chromatographic techniques.

Human Eukaryotic translation initiation factor 5A- 2, EIF5A2 ELI

ELI-13401h 96 Tests
EUR 824.00

Chicken Eukaryotic translation initiation factor 5A- 2, EIF5A2 E

ELI-20520c 96 Tests
EUR 928.00

Mouse Eukaryotic translation initiation factor 5A- 2, Eif5a2 ELI

ELI-43382m 96 Tests
EUR 865.00

Human Eukaryotic Translation Initiation Factor 5A2 (EIF5A2) ELISA Kit

SEL486Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Eukaryotic Translation Initiation Factor 5A2 (EIF5A2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Eukaryotic Translation Initiation Factor 5A2 (EIF5A2) in tissue homogenates, cell lysates and other biological fluids.

Human Eukaryotic Translation Initiation Factor 5A2 (EIF5A2) ELISA Kit

SEL486Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Eukaryotic Translation Initiation Factor 5A2 (EIF5A2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Eukaryotic Translation Initiation Factor 5A2 (EIF5A2) in tissue homogenates, cell lysates and other biological fluids.

Human Eukaryotic Translation Initiation Factor 5A2 (EIF5A2) ELISA Kit

SEL486Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.90
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Eukaryotic Translation Initiation Factor 5A2 (EIF5A2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Eukaryotic Translation Initiation Factor 5A2 (EIF5A2) in tissue homogenates, cell lysates and other biological fluids.

Human Eukaryotic Translation Initiation Factor 5A2 (EIF5A2) ELISA Kit

SEL486Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Eukaryotic Translation Initiation Factor 5A2 (EIF5A2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Eukaryotic Translation Initiation Factor 5A2 (EIF5A2) in tissue homogenates, cell lysates and other biological fluids.

Human Eukaryotic Translation Initiation Factor 5A2 (EIF5A2) ELISA Kit

  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Eukaryotic Translation Initiation Factor 5A2 elisa. Alternative names of the recognized antigen: EIF-5A2
  • eIF5AII
  • Eukaryotic initiation factor 5A isoform 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Eukaryotic Translation Initiation Factor 5A2 (EIF5A2) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

EIF5A2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0671505 3 x 1.0 ug
EUR 376.00

Eif5a2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K5022205 3 x 1.0 ug
EUR 376.00

Eif5a2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6225805 3 x 1.0 ug
EUR 376.00

Recombinant Human Eukaryotic Translation Initiation Factor 5A-2/EIF5A2 (N-6His)

CG95-10ug 10ug
EUR 146.00
Description: Lyophilized from a 0.2 μm filtered solution of 20mM Tris,150mM NaCl, pH 8.0.

Recombinant Human Eukaryotic Translation Initiation Factor 5A-2/EIF5A2 (N-6His)

CG95-1mg 1mg
EUR 2283.00
Description: Lyophilized from a 0.2 μm filtered solution of 20mM Tris,150mM NaCl, pH 8.0.

Recombinant Human Eukaryotic Translation Initiation Factor 5A-2/EIF5A2 (N-6His)

CG95-500ug 500ug
EUR 1613.00
Description: Lyophilized from a 0.2 μm filtered solution of 20mM Tris,150mM NaCl, pH 8.0.

Recombinant Human Eukaryotic Translation Initiation Factor 5A-2/EIF5A2 (N-6His)

CG95-50ug 50ug
EUR 339.00
Description: Lyophilized from a 0.2 μm filtered solution of 20mM Tris,150mM NaCl, pH 8.0.

EIF5A2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0671506 1.0 ug DNA
EUR 167.00

EIF5A2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0671507 1.0 ug DNA
EUR 167.00

EIF5A2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0671508 1.0 ug DNA
EUR 167.00

Eif5a2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K5022206 1.0 ug DNA
EUR 167.00

Eif5a2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K5022207 1.0 ug DNA
EUR 167.00

Eif5a2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K5022208 1.0 ug DNA
EUR 167.00

Eif5a2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6225806 1.0 ug DNA
EUR 167.00

Eif5a2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6225807 1.0 ug DNA
EUR 167.00

Eif5a2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6225808 1.0 ug DNA
EUR 167.00

This evaluate has highlighted a number of the many siderophore molecules produced by Streptomyces, illustrating the variety of their chemical buildings and broad spectrum of bioactivities towards pathogenic micro organism.

Furthermore, the potential for utilizing siderophores conjugated with antibiotics may very well be a substitute for overcome bacterial resistance to medicine and will enhance their therapeutic efficacy.This evaluate confirms the significance of Streptomyces as a wealthy supply of siderophores, and underlines their potential as antibacterial brokers.