Mouse SGSH(N-Sulfoglucosamine Sulfohydrolase) ELISA Kit

Mouse SGSH(N-Sulfoglucosamine Sulfohydrolase) ELISA Kit

To Order Contact us:  Mark@operatiebrp.nl

Human N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit
RDR-SGSH-Hu-96Tests 96 Tests
EUR 756
Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit
20-abx154672
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit
SEH178Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-As
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) in Tissue homogenates, cell lysates and other biological fluids.
Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit
SEH178Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-As
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) in Tissue homogenates, cell lysates and other biological fluids.
Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit
SEH178Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-As
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) in Tissue homogenates, cell lysates and other biological fluids.
Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit
SEH178Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-As
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) in Tissue homogenates, cell lysates and other biological fluids.
Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit
4-SEH178Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as N-Sulfoglucosamine Sulfohydrolase elisa. Alternative names of the recognized antigen: HSS
  • MPS3A
  • SFMD
  • Sulfamidase
  • Sulfoglucosamine sulfamidase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.
N-Sulfoglucosamine Sulfohydrolase (SGSH) Antibody
20-abx131169
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
N-Sulfoglucosamine Sulfohydrolase (SGSH) Antibody
abx122214-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
N-Sulfoglucosamine Sulfohydrolase (SGSH) Antibody
20-abx005707
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
N-Sulfoglucosamine Sulfohydrolase (SGSH) Antibody
20-abx173851
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
N-Sulfoglucosamine Sulfohydrolase (SGSH) Antibody
20-abx177828
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.
N-Sulfoglucosamine Sulfohydrolase (SGSH) Antibody
20-abx177829
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.
N-Sulfoglucosamine Sulfohydrolase (SGSH) Antibody
20-abx320539
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
N-Sulfoglucosamine Sulfohydrolase (SGSH) Antibody
abx237813-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Recombinant N-Sulfoglucosamine Sulfohydrolase (SGSH)
4-RPH178Hu01
  • EUR 462.88
  • EUR 227.00
  • EUR 1460.80
  • EUR 553.60
  • EUR 1007.20
  • EUR 373.00
  • EUR 3502.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P51688
  • Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 71.1kDa
  • Isoelectric Point: 7.1
Description: Recombinant Human N-Sulfoglucosamine Sulfohydrolase expressed in: E.coli
Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) Protein
20-abx654581
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) Protein
20-abx654582
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) CLIA Kit
20-abx495399
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Human N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit
20-abx153076
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human N-Sulfoglucosamine Sulfohydrolase ELISA Kit (SGSH)
RK02280 96 Tests
EUR 521
Human N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit
SEH178Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Sulfoglucosamine Sulfohydrolase (SGSH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-As
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Sulfoglucosamine Sulfohydrolase (SGSH) in Tissue homogenates, cell lysates and other biological fluids.
Human N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit
SEH178Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Sulfoglucosamine Sulfohydrolase (SGSH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-As
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Sulfoglucosamine Sulfohydrolase (SGSH) in Tissue homogenates, cell lysates and other biological fluids.
Human N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit
SEH178Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Sulfoglucosamine Sulfohydrolase (SGSH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-As
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Sulfoglucosamine Sulfohydrolase (SGSH) in Tissue homogenates, cell lysates and other biological fluids.
Human N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit
SEH178Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Sulfoglucosamine Sulfohydrolase (SGSH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-As
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Sulfoglucosamine Sulfohydrolase (SGSH) in Tissue homogenates, cell lysates and other biological fluids.
Human N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit
4-SEH178Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as N-Sulfoglucosamine Sulfohydrolase elisa. Alternative names of the recognized antigen: HSS
  • MPS3A
  • SFMD
  • Sulfamidase
  • Sulfoglucosamine sulfamidase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human N-Sulfoglucosamine Sulfohydrolase (SGSH) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
ELISA kit for Mouse SGSH (N-Sulfoglucosamine Sulfohydrolase)
ELK7260 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to N-Sulfoglucosamine Sulfohydrolase (SGSH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody speci
  • Show more
Description: A sandwich ELISA kit for detection of N-Sulfoglucosamine Sulfohydrolase from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Human N-Sulfoglucosamine Sulfohydrolase (SGSH) Protein
20-abx650718
  • EUR 648.00
  • EUR 272.00
  • EUR 1970.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
N-Sulfoglucosamine Sulfohydrolase (SGSH) Antibody (Biotin)
20-abx274439
  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Human N-Sulfoglucosamine Sulfohydrolase (SGSH) CLIA Kit
20-abx495398
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
ELISA kit for Human SGSH (N-Sulfoglucosamine Sulfohydrolase)
ELK4165 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to N-Sulfoglucosamine Sulfohydrolase (SGSH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody speci
  • Show more
Description: A sandwich ELISA kit for detection of N-Sulfoglucosamine Sulfohydrolase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
N-Sulfoglucosamine Sulfohydrolase (SGSH) Polyclonal Antibody (Human)
4-PAH178Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SGSH (Arg21~Asn389)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human N-Sulfoglucosamine Sulfohydrolase (SGSH)
N-Sulfoglucosamine Sulfohydrolase (SGSH) Polyclonal Antibody (Human), APC
4-PAH178Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SGSH (Arg21~Asn389)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human N-Sulfoglucosamine Sulfohydrolase (SGSH). This antibody is labeled with APC.
N-Sulfoglucosamine Sulfohydrolase (SGSH) Polyclonal Antibody (Human), Biotinylated
4-PAH178Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SGSH (Arg21~Asn389)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human N-Sulfoglucosamine Sulfohydrolase (SGSH). This antibody is labeled with Biotin.
N-Sulfoglucosamine Sulfohydrolase (SGSH) Polyclonal Antibody (Human), Cy3
4-PAH178Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SGSH (Arg21~Asn389)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human N-Sulfoglucosamine Sulfohydrolase (SGSH). This antibody is labeled with Cy3.
N-Sulfoglucosamine Sulfohydrolase (SGSH) Polyclonal Antibody (Human), FITC
4-PAH178Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SGSH (Arg21~Asn389)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human N-Sulfoglucosamine Sulfohydrolase (SGSH). This antibody is labeled with FITC.
N-Sulfoglucosamine Sulfohydrolase (SGSH) Polyclonal Antibody (Human), HRP
4-PAH178Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SGSH (Arg21~Asn389)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human N-Sulfoglucosamine Sulfohydrolase (SGSH). This antibody is labeled with HRP.
N-Sulfoglucosamine Sulfohydrolase (SGSH) Polyclonal Antibody (Human), PE
4-PAH178Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SGSH (Arg21~Asn389)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human N-Sulfoglucosamine Sulfohydrolase (SGSH). This antibody is labeled with PE.
N-Sulfoglucosamine Sulfohydrolase (SGSH) Polyclonal Antibody (Human), APC-Cy7
4-PAH178Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SGSH (Arg21~Asn389)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human N-Sulfoglucosamine Sulfohydrolase (SGSH). This antibody is labeled with APC-Cy7.
N-Sulfoglucosamine Sulfohydrolase Antibody
20-abx114157
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Human N- sulphoglucosamine sulphohydrolase, SGSH ELISA KIT
ELI-39505h 96 Tests
EUR 824
Human N-sulphoglucosamine sulphohydrolase(SGSH) ELISA kit
CSB-EL021200HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human N-sulphoglucosamine sulphohydrolase (SGSH) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human N-sulphoglucosamine sulphohydrolase(SGSH) ELISA kit
1-CSB-EL021200HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human N-sulphoglucosamine sulphohydrolase(SGSH) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
SGSH ELISA KIT|Human
EF002885 96 Tests
EUR 689
SGSH Protein Vector (Mouse) (pPB-N-His)
PV228711 500 ng
EUR 603
SGSH Recombinant Protein (Mouse)
RP171530 100 ug Ask for price
SGSH antibody
22030-100ul 100ul
EUR 390
SGSH antibody
22031-100ul 100ul
EUR 390
SGSH antibody
70R-20229 50 ul
EUR 435
Description: Rabbit polyclonal SGSH antibody
SGSH antibody
70R-12598 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal SGSH antibody
SGSH antibody
70R-12599 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal SGSH antibody
SGSH siRNA
20-abx933183
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SGSH Antibody
1-CSB-PA021200ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SGSH. Recognizes SGSH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
SGSH Antibody
1-CSB-PA021200GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SGSH. Recognizes SGSH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC
anti-SGSH
YF-PA14622 50 ug
EUR 363
Description: Mouse polyclonal to SGSH
anti-SGSH
YF-PA14623 100 ul
EUR 403
Description: Rabbit polyclonal to SGSH
anti-SGSH
YF-PA14624 100 ug
EUR 403
Description: Rabbit polyclonal to SGSH
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202
Sgsh ORF Vector (Mouse) (pORF)
ORF057178 1.0 ug DNA
EUR 506
SGSH Protein Vector (Human) (pPB-N-His)
PV037862 500 ng
EUR 329
Polyclonal SGSH Antibody
APR13287G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SGSH . This antibody is tested and proven to work in the following applications:
SGSH cloning plasmid
CSB-CL021200HU-10ug 10ug
EUR 532
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1509
  • Sequence: atgagctgccccgtgcccgcctgctgcgcgctgctgctagtcctggggctctgccgggcgcgtccccggaacgcactgctgctcctcgcggatgacggaggctttgagagtggcgcgtacaacaacagcgccatcgccaccccgcacctggacgccttggcccgccgcagcctcc
  • Show more
Description: A cloning plasmid for the SGSH gene.
anti- SGSH antibody
FNab07813 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:100
  • Immunogen: N-sulfoglucosamine sulfohydrolase
  • Uniprot ID: P51688
  • Gene ID: 6448
  • Research Area: Metabolism
Description: Antibody raised against SGSH
SGSH Rabbit pAb
A8148-100ul 100 ul
EUR 308
SGSH Rabbit pAb
A8148-200ul 200 ul
EUR 459
SGSH Rabbit pAb
A8148-20ul 20 ul
EUR 183
SGSH Rabbit pAb
A8148-50ul 50 ul
EUR 223
SGSH Polyclonal Antibody
31452-100ul 100ul
EUR 252
SGSH Polyclonal Antibody
31452-50ul 50ul
EUR 187
Anti-SGSH antibody
PAab07813 100 ug
EUR 355
pCMV-SPORT6-SGSH
PVT19125 2 ug
EUR 231
Anti-SGSH antibody
STJ110447 100 µl
EUR 277
Description: This gene encodes one of several enzymes involved in the lysosomal degradation of heparan sulfate. Mutations in this gene are associated with Sanfilippo syndrome A, one type of the lysosomal storage disease mucopolysaccaridosis III, which results from impaired degradation of heparan sulfate. Transcripts of varying sizes have been reported but their biological validity has not been determined.