Mouse MID1(Midline 1) ELISA Kit

Mouse MID1(Midline 1) ELISA Kit

To Order Contact us:  Mark@operatiebrp.nl

Mouse Midline 1 (MID1) ELISA Kit
RDR-MID1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Midline 1 (MID1) ELISA Kit
RDR-MID1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Mouse Midline 1 (MID1) ELISA Kit
RD-MID1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Midline 1 (MID1) ELISA Kit
RD-MID1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Mouse Midline-1(MID1) ELISA kit
CSB-EL013819MO-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Midline-1 (MID1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Midline-1(MID1) ELISA kit
1-CSB-EL013819MO	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Midline-1(MID1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Midline 1 (MID1) ELISA Kit
20-abx154383	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Midline- 1, Mid1 ELISA KIT
ELI-51790m	Lifescience Market	96 Tests	EUR 865

Mouse Midline 1 (MID1) ELISA Kit
SEC620Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Midline 1 (MID1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Midline 1 (MID1) in Tissue homogenates and other biological fluids.

Mouse Midline 1 (MID1) ELISA Kit
SEC620Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Midline 1 (MID1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Midline 1 (MID1) in Tissue homogenates and other biological fluids.

Mouse Midline 1 (MID1) ELISA Kit
SEC620Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Midline 1 (MID1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Midline 1 (MID1) in Tissue homogenates and other biological fluids.

Mouse Midline 1 (MID1) ELISA Kit
SEC620Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Midline 1 (MID1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Midline 1 (MID1) in Tissue homogenates and other biological fluids.

Mouse Midline 1 (MID1) ELISA Kit
4-SEC620Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Midline 1 elisa. Alternative names of the recognized antigen: BBBG1 Midin FXY GBBB1 OGS1 OS OSX RNF59 TRIM18 XPRF ZNFXY Opitz/BBB Syndrome RING finger protein 59 Tripartite motif-containing protein 18
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Midline 1 (MID1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Midline 1 (MID1) Protein
20-abx167423	Abbexa	EUR 704.00 EUR 286.00 EUR 2165.00 EUR 829.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

ELISA kit for Mouse MID1 (Midline 1)
ELK7091	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Midline 1 (MID1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Midline 1 (MID1). Show more
Description: A sandwich ELISA kit for detection of Midline 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse Midline-1 (MID1)
KTE71030-48T	Abbkine	48T	EUR 332
The protein encoded by MID1 is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box Show more
Description: Quantitative sandwich ELISA for measuring Mouse Midline-1 (MID1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Midline-1 (MID1)
KTE71030-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
The protein encoded by MID1 is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box Show more
Description: Quantitative sandwich ELISA for measuring Mouse Midline-1 (MID1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Midline-1 (MID1)
KTE71030-96T	Abbkine	96T	EUR 539
The protein encoded by MID1 is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box Show more
Description: Quantitative sandwich ELISA for measuring Mouse Midline-1 (MID1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mouse Midline 1 (MID1) CLIA Kit
20-abx493802	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Midline-1(MID1) ELISA kit
CSB-EL013819HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Midline-1 (MID1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Midline-1(MID1) ELISA kit
1-CSB-EL013819HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Midline-1(MID1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Midline- 1, MID1 ELISA KIT
ELI-28917h	Lifescience Market	96 Tests	EUR 824

Human Midline 1(MID1)ELISA Kit
QY-E04797	Qayee Biotechnology	96T	EUR 394

Midline 1 (MID1) Antibody
20-abx005498	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Midline 1 (MID1) Antibody
abx027403-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Midline 1 (MID1) Antibody
abx027403-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Midline 1 (MID1) Antibody
20-abx177566	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Midline 1 (MID1) Antibody
20-abx129420	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Midline 1 (MID1) Antibody
20-abx134929	Abbexa	EUR 356.00 EUR 537.00 EUR 217.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Midline 1 (MID1) Antibody
abx146040-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Midline 1 (MID1) Antibody
20-abx320825	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Midline 1 (MID1) Antibody
20-abx329554	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Midline 1 (MID1) Antibody
abx332373-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

Recombinant Midline 1 (MID1)
4-RPC620Mu01	Cloud-Clone	EUR 503.20 EUR 238.00 EUR 1612.00 EUR 604.00 EUR 1108.00 EUR 400.00 EUR 3880.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O70583 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 27.5KDa Isoelectric Point: Inquire
Description: Recombinant Mouse Midline 1 expressed in: E.coli

Midline 1 (MID1) Polyclonal Antibody (Mouse)
4-PAC620Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MID1 (Met1~Leu212) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Midline 1 (MID1)

ELISA kit for Rat Midline-1 (MID1)
KTE100618-48T	Abbkine	48T	EUR 332
The protein encoded by MID1 is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box Show more
Description: Quantitative sandwich ELISA for measuring Rat Midline-1 (MID1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Midline-1 (MID1)
KTE100618-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
The protein encoded by MID1 is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box Show more
Description: Quantitative sandwich ELISA for measuring Rat Midline-1 (MID1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Midline-1 (MID1)
KTE100618-96T	Abbkine	96T	EUR 539
The protein encoded by MID1 is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box Show more
Description: Quantitative sandwich ELISA for measuring Rat Midline-1 (MID1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Midline-1 (MID1)
KTE61623-48T	Abbkine	48T	EUR 332
Midline-1 encoded by MID1 is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box ty Show more
Description: Quantitative sandwich ELISA for measuring Human Midline-1 (MID1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Midline-1 (MID1)
KTE61623-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Midline-1 encoded by MID1 is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box ty Show more
Description: Quantitative sandwich ELISA for measuring Human Midline-1 (MID1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Midline-1 (MID1)
KTE61623-96T	Abbkine	96T	EUR 539
Midline-1 encoded by MID1 is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box ty Show more
Description: Quantitative sandwich ELISA for measuring Human Midline-1 (MID1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Midline 1 (MID1) polyclonal antibody
ABP-PAB-11697	Allele Biotech	100 ug	Ask for price
Product line: Transcription Factors Brand:

Midline 1 (MID1) Polyclonal Antibody (Mouse), APC
4-PAC620Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MID1 (Met1~Leu212) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Midline 1 (MID1). This antibody is labeled with APC.

Midline 1 (MID1) Polyclonal Antibody (Mouse), Biotinylated
4-PAC620Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MID1 (Met1~Leu212) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Midline 1 (MID1). This antibody is labeled with Biotin.

Midline 1 (MID1) Polyclonal Antibody (Mouse), Cy3
4-PAC620Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MID1 (Met1~Leu212) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Midline 1 (MID1). This antibody is labeled with Cy3.

Midline 1 (MID1) Polyclonal Antibody (Mouse), FITC
4-PAC620Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MID1 (Met1~Leu212) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Midline 1 (MID1). This antibody is labeled with FITC.

Midline 1 (MID1) Polyclonal Antibody (Mouse), HRP
4-PAC620Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MID1 (Met1~Leu212) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Midline 1 (MID1). This antibody is labeled with HRP.

Midline 1 (MID1) Polyclonal Antibody (Mouse), PE
4-PAC620Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MID1 (Met1~Leu212) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Midline 1 (MID1). This antibody is labeled with PE.

Midline 1 (MID1) Polyclonal Antibody (Mouse), APC-Cy7
4-PAC620Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MID1 (Met1~Leu212) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Midline 1 (MID1). This antibody is labeled with APC-Cy7.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Mid1/ Rat Mid1 ELISA Kit
ELI-17080r	Lifescience Market	96 Tests	EUR 886

Anti-MID1 Antibody
A01774-1	BosterBio	100ug/vial	EUR 334

MID1 ELISA Kit (Mouse) (OKCD08207)
OKCD08207	Aviva Systems Biology	96 Wells	EUR 1001
Description: Description of target: Has e3 ubiquitin ligase activity towards igbp1, promoting its monoubiquitination, which results in deprotection of the catalytic subunit of protein phosphatase pp2a, and its subsequent degradation by polyubiquitination.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.052ng/mL

MID1 ELISA Kit (Mouse) (OKDD00847)
OKDD00847	Aviva Systems Biology	96 Wells	EUR 988
Description: Description of target: Has e3 ubiquitin ligase activity towards igbp1, promoting its monoubiquitination, which results in deprotection of the catalytic subunit of protein phosphatase pp2a, and its subsequent degradation by polyubiquitination.;Species reactivity: Mouse;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.052ng/mL

Mouse Mid1- interacting protein 1, Mid1ip1 ELISA KIT
ELI-43013m	Lifescience Market	96 Tests	EUR 865

Midline-1 Polyclonal Antibody
ABP51790-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the N-terminal region of human Midline-1 at AA range: 40-120 Applications tips:
Description: A polyclonal antibody for detection of Midline-1 from Human, Mouse, Rat. This Midline-1 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human Midline-1 at AA range: 40-120

Midline-1 Polyclonal Antibody
ABP51790-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the N-terminal region of human Midline-1 at AA range: 40-120 Applications tips:
Description: A polyclonal antibody for detection of Midline-1 from Human, Mouse, Rat. This Midline-1 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human Midline-1 at AA range: 40-120

Midline-1 Polyclonal Antibody
ABP51790-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the N-terminal region of human Midline-1 at AA range: 40-120 Applications tips:
Description: A polyclonal antibody for detection of Midline-1 from Human, Mouse, Rat. This Midline-1 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human Midline-1 at AA range: 40-120

Midline-1 Polyclonal Antibody
ES2789-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Midline-1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

Midline-1 Polyclonal Antibody
ES2789-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Midline-1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

Anti-Midline-1 antibody
STJ94125	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to Midline-1.

Human Midline 2(MID2)ELISA Kit
QY-E04796	Qayee Biotechnology	96T	EUR 394

MID1 ELISA Kit (Human) (OKCA00727)
OKCA00727	Aviva Systems Biology	96 Wells	EUR 833
Description: Description of target: Has E3 ubiquitin ligase activity towards IGBP1, promoting its monoubiquitination, which results in deprotection of the catalytic subunit of protein phosphatase PP2A, and its subsequent degradation by polyubiquitination.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 5.86 pg/mL

Human Mid1- interacting protein 1, MID1IP1 ELISA KIT
ELI-31441h	Lifescience Market	96 Tests	EUR 824

Human MID1 Interacting Protein 1 (MID1IP1) ELISA Kit
abx381447-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse MID1 shRNA Plasmid
20-abx971511	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

MID1 Recombinant Protein (Mouse)
RP150623	ABM	100 ug	Ask for price

MID1 Recombinant Protein (Mouse)
RP150626	ABM	100 ug	Ask for price

MID1 Antibody
1-CSB-PA003239	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against MID1. Recognizes MID1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/40000

MID1 Antibody
CSB-PA188851-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against MID1. Recognizes MID1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500

MID1 Antibody
CSB-PA188851-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against MID1. Recognizes MID1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500

MID1 Antibody
1-CSB-PA013819ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MID1. Recognizes MID1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

MID1 siRNA
20-abx903258	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MID1 siRNA
20-abx924146	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MID1 siRNA
20-abx924147	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-MID1
YF-PA24154	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to MID1

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

Mid1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3974902	ABM	1.0 ug DNA	EUR 154

ELISA kit for Rat Mid1-interacting protein 1 (MID1IP1)
KTE100617-48T	Abbkine	48T	EUR 332
MID1IP1 (MID1 Interacting Protein 1) is a Protein Coding gene. Among its related pathways are Metabolism and Import of palmitoyl-CoA into the mitochondrial matrix. GO annotations related to this gene include protein C-terminus binding. An important p Show more
Description: Quantitative sandwich ELISA for measuring Rat Mid1-interacting protein 1 (MID1IP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Mid1-interacting protein 1 (MID1IP1)
KTE100617-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
MID1IP1 (MID1 Interacting Protein 1) is a Protein Coding gene. Among its related pathways are Metabolism and Import of palmitoyl-CoA into the mitochondrial matrix. GO annotations related to this gene include protein C-terminus binding. An important p Show more
Description: Quantitative sandwich ELISA for measuring Rat Mid1-interacting protein 1 (MID1IP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Mid1-interacting protein 1 (MID1IP1)
KTE100617-96T	Abbkine	96T	EUR 539
MID1IP1 (MID1 Interacting Protein 1) is a Protein Coding gene. Among its related pathways are Metabolism and Import of palmitoyl-CoA into the mitochondrial matrix. GO annotations related to this gene include protein C-terminus binding. An important p Show more
Description: Quantitative sandwich ELISA for measuring Rat Mid1-interacting protein 1 (MID1IP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Mid1-interacting protein 1 (MID1IP1)
KTE61622-48T	Abbkine	48T	EUR 332
MID1IP1 (MID1 Interacting Protein 1) is a Protein Coding gene. Among its related pathways are Metabolism and Import of palmitoyl-CoA into the mitochondrial matrix. GO annotations related to this gene include protein C-terminus binding. An important p Show more
Description: Quantitative sandwich ELISA for measuring Human Mid1-interacting protein 1 (MID1IP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Mid1-interacting protein 1 (MID1IP1)
KTE61622-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
MID1IP1 (MID1 Interacting Protein 1) is a Protein Coding gene. Among its related pathways are Metabolism and Import of palmitoyl-CoA into the mitochondrial matrix. GO annotations related to this gene include protein C-terminus binding. An important p Show more
Description: Quantitative sandwich ELISA for measuring Human Mid1-interacting protein 1 (MID1IP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Mid1-interacting protein 1 (MID1IP1)
KTE61622-96T	Abbkine	96T	EUR 539
MID1IP1 (MID1 Interacting Protein 1) is a Protein Coding gene. Among its related pathways are Metabolism and Import of palmitoyl-CoA into the mitochondrial matrix. GO annotations related to this gene include protein C-terminus binding. An important p Show more
Description: Quantitative sandwich ELISA for measuring Human Mid1-interacting protein 1 (MID1IP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mid1 ORF Vector (Mouse) (pORF)
ORF050209	ABM	1.0 ug DNA	EUR 506

Mid1 ORF Vector (Mouse) (pORF)
ORF050210	ABM	1.0 ug DNA	EUR 506

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

MID1 Polyclonal Antibody
30882-100ul	SAB	100ul	EUR 252

MID1 Polyclonal Antibody
30882-50ul	SAB	50ul	EUR 187

MID1 Blocking Peptide
20-abx061628	Abbexa	EUR 258.00 EUR 384.00	1 mg 5 mg
Shipped within 5-10 working days.

MID1 cloning plasmid
CSB-CL013819HU-10ug	Cusabio	10ug	EUR 671
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2004 Sequence: atggaaacactggagtcagaactgacctgccctatttgtctggagctctttgaggaccctcttctactgccctgcgcacacagcctctgcttcaactgcgcccaccgcatcctagtatcacactgtgccaccaacgagtctgtggagtccatcaccgccttccagtgccccacct Show more
Description: A cloning plasmid for the MID1 gene.

MID1 Rabbit pAb
A7291-100ul	Abclonal	100 ul	EUR 308

MID1 Rabbit pAb
A7291-200ul	Abclonal	200 ul	EUR 459

MID1 Rabbit pAb
A7291-20ul	Abclonal	20 ul	EUR 183

MID1 Rabbit pAb
A7291-50ul	Abclonal	50 ul	EUR 223

Anti-MID1 antibody
STJ29430	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein forms homodimers which associate with microtubules in the cytoplasm. The protein is likely involved in the formation of multiprotein structures acting as anchor points to microtubules. Mutations in this gene have been associated with the X-linked form of Opitz syndrome, which is characterized by midline abnormalities such as cleft lip, laryngeal cleft, heart defects, hypospadias, and agenesis of the corpus callosum. This gene was also the first example of a gene subject to X inactivation in human while escaping it in mouse. Alternative promoter use, alternative splicing and alternative polyadenylation result in multiple transcript variants that have different tissue specificities.

Anti-MID1 (2C11)
YF-MA14254	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to MID1

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

MID1 Interacting Protein 1 (MID1IP1) Antibody
20-abx216857	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

MID1 Interacting Protein 1 (MID1IP1) Antibody
20-abx121163	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

MID1 Interacting Protein 1 (MID1IP1) Antibody
abx146079-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

MID1 Interacting Protein 1 (MID1IP1) Antibody
abx235181-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

MID1 Interacting Protein 1 (MID1IP1) Antibody
20-abx334358	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-1	CORNING	1/pk	EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Mid1 sgRNA CRISPR Lentivector set (Mouse)
K3974901	ABM	3 x 1.0 ug	EUR 339

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

NUT Midline Carcinoma Family Member 1 (NUTM1) Antibody
20-abx324996	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Mouse Interleukin-1 beta (IL-1 beta) AssayMax ELISA Kit
EMI2200-1	AssayPro	96 Well Plate	EUR 477

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

Rat MID1 shRNA Plasmid
20-abx985797	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

MID1 Polyclonal Conjugated Antibody
C30882	SAB	100ul	EUR 397

Human MID1 shRNA Plasmid
20-abx952900	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

MID1 Recombinant Protein (Human)
RP019465	ABM	100 ug	Ask for price

MID1 Recombinant Protein (Rat)
RP211739	ABM	100 ug	Ask for price

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE622A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE624A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

MID1 Interacting Protein 1 (MID1IP1) Antibody (HRP)
20-abx336549	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

MID1 Interacting Protein 1 (MID1IP1) Antibody (FITC)
20-abx336550	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

MID1 Interacting Protein 1 (MID1IP1) Antibody (Biotin)
20-abx336551	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Mid1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6795802	ABM	1.0 ug DNA	EUR 154

MID1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1302402	ABM	1.0 ug DNA	EUR 154

Mouse Insulin-like Growth Factor 1 (IGF-1) AssayMax ELISA Kit
EMI1001-1	AssayPro	96 Well Plate	EUR 477

Mid1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3974903	ABM	1.0 ug DNA	EUR 154

Mid1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3974904	ABM	1.0 ug DNA	EUR 154

MID1 Protein Vector (Mouse) (pPB-C-His)
PV200834	ABM	500 ng	EUR 1065

MID1 Protein Vector (Mouse) (pPB-N-His)
PV200835	ABM	500 ng	EUR 1065

MID1 Protein Vector (Mouse) (pPM-C-HA)
PV200836	ABM	500 ng	EUR 1065

MID1 Protein Vector (Mouse) (pPM-C-His)
PV200837	ABM	500 ng	EUR 1065

MID1 Protein Vector (Mouse) (pPB-C-His)
PV200838	ABM	500 ng	EUR 1065

MID1 Protein Vector (Mouse) (pPB-N-His)
PV200839	ABM	500 ng	EUR 1065

MID1 Protein Vector (Mouse) (pPM-C-HA)
PV200840	ABM	500 ng	EUR 1065

MID1 Protein Vector (Mouse) (pPM-C-His)
PV200841	ABM	500 ng	EUR 1065

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT	SBI	1 Kit	EUR 153
Category: Cas9

Polyclonal MID1 Antibody (C-term)
APR03818G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MID1 (C-term). This antibody is tested and proven to work in the following applications:

Mid1 ORF Vector (Rat) (pORF)
ORF070581	ABM	1.0 ug DNA	EUR 506

MID1 ORF Vector (Human) (pORF)
ORF006489	ABM	1.0 ug DNA	EUR 95

Mid1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3974906	ABM	1.0 ug DNA	EUR 167

Mouse Albumin AssayMax ELISA Kit
EMA2201-1	AssayPro	96 Well Plate	EUR 396

Mouse Albumin AssayMax ELISA Kit
EMA3201-1	AssayPro	96 Well Plate	EUR 396

Mouse GOT1 AssayMax ELISA Kit
EMG7150-1	AssayPro	96 Well Plate	EUR 477

Mouse Hemopexin AssayMax ELISA Kit
EMH2001-1	AssayPro	96 Well Plate	EUR 417

Mouse Leptin AssayMax ELISA Kit
EML2001-1	AssayPro	96 Well Plate	EUR 477

Mouse Myoglobin AssayMax ELISA Kit
EMM8001-1	AssayPro	96 Well Plate	EUR 417

Mouse Prothrombin AssayMax ELISA Kit
EMP3022-1	AssayPro	96 Well Plate	EUR 417

Mouse Resistin AssayMax ELISA Kit
EMR1001-1	AssayPro	96 Well Plate	EUR 477

Mouse Transferrin AssayMax ELISA Kit
EMT2105-1	AssayPro	96 Well Plate	EUR 417

Mouse VCAM1 AssayMax ELISA Kit
EMV1801-1	AssayPro	96 Well Plate	EUR 477

Human Hexokinase-1 AssayMax ELISA Kit
EH3101-1	AssayPro	96 Well Plate	EUR 477

Human Complexin-1 AssayMax ELISA Kit
EC3505-1	AssayPro	96 Well Plate	EUR 417

Human Glutaredoxin-1 AssayMax ELISA Kit
EG2153-1	AssayPro	96 Well Plate	EUR 417

Rat TIMP-1 AssayMax ELISA Kit
ERT2538-1	AssayPro	96 Well Plate	EUR 477

RecombiVirus Mouse Norovirus 1 (MNV-1) IgG ELISA Kit, 96 tests
AE-300300-1	Alpha Diagnostics	1 kit	EUR 567

Mouse Adiponectin (ACRP30) AssayMax ELISA Kit
EMA2500-1	AssayPro	96 Well Plate	EUR 396

Mouse Fibrinogen (FBG) AssayMax ELISA Kit
EMF1040-1	AssayPro	96 Well Plate	EUR 396

Mouse Fibronectin (FN) AssayMax ELISA Kit
EMF1045-1	AssayPro	96 Well Plate	EUR 396

Mouse Fibrinogen (FBG) AssayMax ELISA Kit
EMF2040-1	AssayPro	96 Well Plate	EUR 396

Mouse Plasminogen (PLG) AssayMax ELISA Kit
EMP1200-1	AssayPro	96 Well Plate	EUR 396

Mouse Plasminogen (PLG) AssayMax ELISA Kit
EMP2211-1	AssayPro	96 Well Plate	EUR 396

Mouse S100-A4 AssayMax ELISA Kit
EMS2735-1	AssayPro	96 Well Plate	EUR 477

Mouse TNF-alpha AssayMax ELISA Kit
EMT2010-1	AssayPro	96 Well Plate	EUR 477

Human Lipocalin-1 (LCN1) AssayMax ELISA Kit
EL3502-1	AssayPro	96 Well Plate	EUR 477

Human TGF-beta-1 AssayMax ELISA Kit
ET3102-1	AssayPro	96 Well Plate	EUR 477

Human PAI-1/tPA AssayMax ELISA Kit
EP1105-1	AssayPro	96 Well Plate	EUR 417

Human KRAB-associated Protein 1 (KAP-1) AssayMax ELISA Kit
EK2802-1	AssayPro	96 Well Plate	EUR 477

Human Interleukin-1 beta (IL-1 beta) AssayMax ELISA Kit
EI2200-1	AssayPro	96 Well Plate	EUR 477

Human Interleukin-1-alpha (IL-1-alpha) AssayMax ELISA Kit
EI2301-1	AssayPro	96 Well Plate	EUR 477

Human Plasminogen Activator Inhibitor-1 (PAI-1) AssayMax ELISA Kit
EP1100-1	AssayPro	96 Well Plate	EUR 417

MID1 interacting G12-like protein antibody
23147-100ul	SAB	100ul	EUR 390

Mid1 sgRNA CRISPR Lentivector set (Rat)
K6795801	ABM	3 x 1.0 ug	EUR 339

MID1 sgRNA CRISPR Lentivector set (Human)
K1302401	ABM	3 x 1.0 ug	EUR 339

vWF Acty. Kit
ABP-ACT-KIT	Abpcorp	12 x 8 microwells	EUR 428

vWF Ant. Kit
ABP-TOT-KIT	Abpcorp	12 x 8 microwells	EUR 394

Hemokinin 1 (mouse)
B5127-1	ApexBio	1 mg	EUR 321

Mouse Antithrombin III (AT3) AssayMax ELISA Kit
EMA3301-1	AssayPro	96 Well Plate	EUR 417

Mouse alpha-2-Antiplasmin AssayMax ELISA Kit
EMA3477-1	AssayPro	96 Well Plate	EUR 477

Mouse Cystatin C (Cst3) AssayMax ELISA Kit
EMC2501-1	AssayPro	96 Well Plate	EUR 477

Mouse Complement Factor D AssayMax ELISA Kit
EMF7701-1	AssayPro	96 Well Plate	EUR 417

Mouse Immunoglobulin M (IgM) AssayMax ELISA Kit
EMI3001-1	AssayPro	96 Well Plate	EUR 396

Mouse Lipocalin-2 (NGAL) AssayMax ELISA Kit
EML3510-1	AssayPro	96 Well Plate	EUR 477

Mouse Alpha-2-Macroglobulin AssayMax ELISA Kit
EMM1115-1	AssayPro	96 Well Plate	EUR 417

Human Heat Shock Factor Protein 1 (HSF 1) AssayMax ELISA kit
EH5215-1	AssayPro	96 Well Plate	EUR 417

Human Insulin-like Growth Factor 1 (IGF-1) AssayMax ELISA Kit
EI1001-1	AssayPro	96 Well Plate	EUR 477

Human Carbonic Anhydrase 1 (CA1) AssayMax ELISA Kit
EC5752-1	AssayPro	96 Well Plate	EUR 477

Human Alpha-1-Antitrypsin (A1AT) AssayMax ELISA Kit
EA5001-1	AssayPro	96 Well Plate	EUR 417

Human Alpha-1-Antitrypsin (A1AT) AssayMax ELISA Kit
EA5101-1	AssayPro	96 Well Plate	EUR 417

Human Alpha-1-Antichymotrypsin (AACT) AssayMax ELISA Kit
EA5501-1	AssayPro	96 Well Plate	EUR 417

Human Estrogen Sulfotransferase (EST-1) AssayMax ELISA Kit
EE2702-1	AssayPro	96 Well Plate	EUR 477

Human Glutathione Transferase zeta 1 AssayMax ELISA Kit
EG2350-1	AssayPro	96 Well Plate	EUR 477

Human Glutathione Peroxidase 1 (GPX1) AssayMax ELISA Kit
EG3928-1	AssayPro	96 Well Plate	EUR 477

Human Alpha-1-Microglobulin (A1M) AssayMax ELISA Kit
EM5110-1	AssayPro	96 Well Plate	EUR 396

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)
CAS620A-KIT	SBI	1 kit	EUR 2152
Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

PrecisionX Multiplex gRNA Cloning Kit
CAS9-GRNA-KIT	SBI	10 rxn	EUR 445
Category: Cas9

Mouse Sendai/(SeV/Parainfluenza virus 1) IgG ELISA Kit, 96 tests
AE-300600-1	Alpha Diagnostics	1 kit	EUR 567

Mouse C-Reactive Protein (CRP) AssayMax ELISA Kit
EMC1001-1	AssayPro	96 Well Plate	EUR 396

Mouse Epidermal Growth Factor (EGF) AssayMax ELISA Kit
EME2011-1	AssayPro	96 Well Plate	EUR 396

Mouse Interleukin-6 (IL-6) AssayMax ELISA Kit
EMI1006-1	AssayPro	96 Well Plate	EUR 477

Mouse Interferon-gamma (IFN-gamma) AssayMax ELISA Kit
EMI1023-1	AssayPro	96 Well Plate	EUR 477

Mouse Interleukin-10 (IL-10) AssayMax ELISA Kit
EMI3010-1	AssayPro	96 Well Plate	EUR 477

Mouse Stem Cell Factor (SCF) AssayMax ELISA Kit
EMS1001-1	AssayPro	96 Well Plate	EUR 396

Mouse Thrombin-Antithrombin (TAT) Complex AssayMax ELISA Kit
EMT1020-1	AssayPro	96 Well Plate	EUR 417

Mid1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3974905	ABM	3 x 1.0 ug	EUR 376

Monoclonal MID1 Antibody (monoclonal) (M06), Clone: 2C11
AMM03797G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human MID1 (monoclonal) (M06). The antibodies are raised in mouse and are from clone 2C11. This antibody is applicable in WB

Mid1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6795803	ABM	1.0 ug DNA	EUR 154

Mid1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6795804	ABM	1.0 ug DNA	EUR 154

MID1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1302403	ABM	1.0 ug DNA	EUR 154

MID1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1302404	ABM	1.0 ug DNA	EUR 154

MID1 Protein Vector (Rat) (pPB-C-His)
PV282322	ABM	500 ng	EUR 1166

MID1 Protein Vector (Rat) (pPB-N-His)
PV282323	ABM	500 ng	EUR 1166

MID1 Protein Vector (Rat) (pPM-C-HA)
PV282324	ABM	500 ng	EUR 1166

MID1 Protein Vector (Rat) (pPM-C-His)
PV282325	ABM	500 ng	EUR 1166

MID1 Protein Vector (Human) (pPB-C-His)
PV025953	ABM	500 ng	EUR 329

MID1 Protein Vector (Human) (pPB-N-His)
PV025954	ABM	500 ng	EUR 329

MID1 Protein Vector (Human) (pPM-C-HA)
PV025955	ABM	500 ng	EUR 329

MID1 Protein Vector (Human) (pPM-C-His)
PV025956	ABM	500 ng	EUR 329

Mid1 3'UTR Luciferase Stable Cell Line
TU113196	ABM	1.0 ml	Ask for price

Mid1 3'UTR GFP Stable Cell Line
TU163196	ABM	1.0 ml	Ask for price

Mid1 3'UTR Luciferase Stable Cell Line
TU213186	ABM	1.0 ml	Ask for price

Mid1 3'UTR GFP Stable Cell Line
TU263186	ABM	1.0 ml	Ask for price

MID1 3'UTR GFP Stable Cell Line
TU063356	ABM	1.0 ml	EUR 4617

MID1 3'UTR Luciferase Stable Cell Line
TU013356	ABM	1.0 ml	EUR 4617

Mouse Apolipoprotein A-I (Apo-A1) AssayMax ELISA Kit
EMA5301-1	AssayPro	96 Well Plate	EUR 477

Mouse Serum Amyloid P Component (SAP) AssayMax ELISA Kit
EMA8201-1	AssayPro	96 Well Plate	EUR 417

Mouse Glutathione S-Transferase A1 (GSTA1) AssayMax ELISA Kit
EMG2758-1	AssayPro	96 Well Plate	EUR 477

Mouse Retinol-Binding Protein 4 (RBP4) AssayMax ELISA Kit
EMR3005-1	AssayPro	96 Well Plate	EUR 417

Human Inhibitor of Growth Protein 1 (ING1) AssayMax ELISA Kit
EI1770-1	AssayPro	96 Well Plate	EUR 477

Human Alpha-1-Acid Glycoprotein (Orosomucoid, AGP) AssayMax ELISA Kit
EG5001-1	AssayPro	96 Well Plate	EUR 396

Human Alpha-1-Acid Glycoprotein (Orosomucoid, AGP) AssayMax ELISA Kit
EG5101-1	AssayPro	96 Well Plate	EUR 396

Rabbit Albumin AssayMax ELISA Kit (Discontinued, replaced by ETA2202-1)
ETA2201-1	AssayPro	96 Well Plate	EUR 396

Human NEDD4 Family-Interacting Protein 1 (NDFIP1) AssayMax ELISA Kit
EN2550-1	AssayPro	96 Well Plate	EUR 477

Mid1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6795806	ABM	1.0 ug DNA	EUR 167

MID1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K1302406	ABM	1.0 ug DNA	EUR 167

Galanin (1-29) (rat, mouse)
B5325-1	ApexBio	1 mg	EUR 399

Mouse anti-dsDNA IgG1-specific ELISA Kit, 96 tests, Quantitative
5120-1	Alpha Diagnostics	1 Kit	EUR 712

Human Alpha-1-Acid Glycoprotein 2 (ORM2, AGP2) AssayMax ELISA Kit
EG2713-1	AssayPro	96 Well Plate	EUR 417

Mid1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3974907	ABM	1.0 ug DNA	EUR 167

Mid1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3974908	ABM	1.0 ug DNA	EUR 167

Mouse Complete SeraMir Exosome RNA Amplification and Profiling Kit (contains cat# RA800A-1, RA805A-1, RA811A-1 components) 20 profiles
RA821A-1	SBI	20 profiles	EUR 1297
Category: MicroRNA Tools

Nesfatin-1 (mouse)
SP-100055-1	Alpha Diagnostics	1 mg	EUR 773

PGAM1 Mouse, Phosphoglycerate Mutase 1 Mouse Recombinant Protein, Active
PROTQ9DBJ1-1	BosterBio	Regular: 10ug	EUR 317
Description: PGAM1 Mouse Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 278 amino acids (1-254) and having a molecular mass of 31.4kDa.;PGAM1 is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Dr. P Kit-Solution 1
K2021010-1	Biochain	50 ml	EUR 204
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

MID1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV660751	ABM	1.0 ug DNA	EUR 1355