Mouse MID1(Midline 1) ELISA Kit
To Order Contact us: Mark@operatiebrp.nl
Mouse Midline 1 (MID1) ELISA Kit |
RD-MID1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse Midline 1 (MID1) ELISA Kit |
RD-MID1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Mouse Midline 1 (MID1) ELISA Kit |
RDR-MID1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse Midline 1 (MID1) ELISA Kit |
RDR-MID1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
Mouse Midline 1 (MID1) ELISA Kit |
20-abx154383 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Midline-1(MID1) ELISA kit |
CSB-EL013819MO-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Midline-1 (MID1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Mouse Midline-1(MID1) ELISA kit |
1-CSB-EL013819MO |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Midline-1(MID1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Mouse Midline 1 (MID1) ELISA Kit |
SEC620Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4862.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Midline 1 (MID1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Midline 1 (MID1) in Tissue homogenates and other biological fluids. |
Mouse Midline 1 (MID1) ELISA Kit |
SEC620Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 488.08 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Midline 1 (MID1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Midline 1 (MID1) in Tissue homogenates and other biological fluids. |
Mouse Midline 1 (MID1) ELISA Kit |
SEC620Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 654.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Midline 1 (MID1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Midline 1 (MID1) in Tissue homogenates and other biological fluids. |
Mouse Midline 1 (MID1) ELISA Kit |
SEC620Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2644.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Midline 1 (MID1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Midline 1 (MID1) in Tissue homogenates and other biological fluids. |
Mouse Midline 1 (MID1) ELISA Kit |
4-SEC620Mu |
Cloud-Clone |
-
EUR 4913.00
-
EUR 2595.00
-
EUR 655.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Midline 1 elisa. Alternative names of the recognized antigen: BBBG1
- Midin
- FXY
- GBBB1
- OGS1
- OS
- OSX
- RNF59
- TRIM18
- XPRF
- ZNFXY
- Opitz/BBB Syndrome
- RING finger protein 59
- Tripartite motif-containing protein 18
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Midline 1 (MID1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Mouse Midline 1 (MID1) Protein |
20-abx167423 |
Abbexa |
-
EUR 704.00
-
EUR 286.00
-
EUR 2165.00
-
EUR 829.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
ELISA kit for Mouse MID1 (Midline 1) |
ELK7091 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Midline 1 (MID1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Midline 1 (MID1).
- Show more
|
Description: A sandwich ELISA kit for detection of Midline 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Mouse Midline-1 (MID1) |
KTE71030-48T |
Abbkine |
48T |
EUR 332 |
- The protein encoded by MID1 is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Midline-1 (MID1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Midline-1 (MID1) |
KTE71030-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- The protein encoded by MID1 is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Midline-1 (MID1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Midline-1 (MID1) |
KTE71030-96T |
Abbkine |
96T |
EUR 539 |
- The protein encoded by MID1 is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Midline-1 (MID1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Mouse Midline 1 (MID1) CLIA Kit |
20-abx493802 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Midline 1 (MID1) Antibody |
20-abx129420 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Midline 1 (MID1) Antibody |
abx146040-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Midline 1 (MID1) Antibody |
20-abx134929 |
Abbexa |
-
EUR 356.00
-
EUR 537.00
-
EUR 217.00
|
|
- Shipped within 5-10 working days.
|
Midline 1 (MID1) Antibody |
20-abx005498 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Midline 1 (MID1) Antibody |
abx027403-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Midline 1 (MID1) Antibody |
abx027403-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Midline 1 (MID1) Antibody |
20-abx177566 |
Abbexa |
|
|
|
Midline 1 (MID1) Antibody |
20-abx320825 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Midline 1 (MID1) Antibody |
20-abx329554 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Midline 1 (MID1) Antibody |
abx332373-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
Recombinant Midline 1 (MID1) |
4-RPC620Mu01 |
Cloud-Clone |
-
EUR 503.20
-
EUR 238.00
-
EUR 1612.00
-
EUR 604.00
-
EUR 1108.00
-
EUR 400.00
-
EUR 3880.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: O70583
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 27.5KDa
- Isoelectric Point: Inquire
|
Description: Recombinant Mouse Midline 1 expressed in: E.coli |
Human Midline-1(MID1) ELISA kit |
CSB-EL013819HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Midline-1 (MID1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Midline-1(MID1) ELISA kit |
1-CSB-EL013819HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Midline-1(MID1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Midline 1 (MID1) Polyclonal Antibody (Mouse) |
4-PAC620Mu01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MID1 (Met1~Leu212)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Midline 1 (MID1) |
ELISA kit for Rat Midline-1 (MID1) |
KTE100618-48T |
Abbkine |
48T |
EUR 332 |
- The protein encoded by MID1 is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Midline-1 (MID1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Midline-1 (MID1) |
KTE100618-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- The protein encoded by MID1 is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Midline-1 (MID1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Midline-1 (MID1) |
KTE100618-96T |
Abbkine |
96T |
EUR 539 |
- The protein encoded by MID1 is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Midline-1 (MID1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Midline-1 (MID1) |
KTE61623-48T |
Abbkine |
48T |
EUR 332 |
- Midline-1 encoded by MID1 is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box ty
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Midline-1 (MID1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Midline-1 (MID1) |
KTE61623-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Midline-1 encoded by MID1 is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box ty
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Midline-1 (MID1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Midline-1 (MID1) |
KTE61623-96T |
Abbkine |
96T |
EUR 539 |
- Midline-1 encoded by MID1 is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box ty
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Midline-1 (MID1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Midline 1 (MID1) polyclonal antibody |
ABP-PAB-11697 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Transcription Factors
- Brand:
|
Midline 1 (MID1) Polyclonal Antibody (Mouse), APC |
4-PAC620Mu01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MID1 (Met1~Leu212)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Midline 1 (MID1). This antibody is labeled with APC. |
Midline 1 (MID1) Polyclonal Antibody (Mouse), Biotinylated |
4-PAC620Mu01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MID1 (Met1~Leu212)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Midline 1 (MID1). This antibody is labeled with Biotin. |
Midline 1 (MID1) Polyclonal Antibody (Mouse), Cy3 |
4-PAC620Mu01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MID1 (Met1~Leu212)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Midline 1 (MID1). This antibody is labeled with Cy3. |
Midline 1 (MID1) Polyclonal Antibody (Mouse), FITC |
4-PAC620Mu01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MID1 (Met1~Leu212)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Midline 1 (MID1). This antibody is labeled with FITC. |
Midline 1 (MID1) Polyclonal Antibody (Mouse), HRP |
4-PAC620Mu01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MID1 (Met1~Leu212)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Midline 1 (MID1). This antibody is labeled with HRP. |
Midline 1 (MID1) Polyclonal Antibody (Mouse), PE |
4-PAC620Mu01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MID1 (Met1~Leu212)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Midline 1 (MID1). This antibody is labeled with PE. |
Midline 1 (MID1) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAC620Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MID1 (Met1~Leu212)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Midline 1 (MID1). This antibody is labeled with APC-Cy7. |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Anti-MID1 Antibody |
A01774-1 |
BosterBio |
100ug/vial |
EUR 334 |
MID1 ELISA Kit (Mouse) (OKCD08207) |
OKCD08207 |
Aviva Systems Biology |
96 Wells |
EUR 1001 |
Description: Description of target: Has e3 ubiquitin ligase activity towards igbp1, promoting its monoubiquitination, which results in deprotection of the catalytic subunit of protein phosphatase pp2a, and its subsequent degradation by polyubiquitination.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.052ng/mL |
MID1 ELISA Kit (Mouse) (OKDD00847) |
OKDD00847 |
Aviva Systems Biology |
96 Wells |
EUR 988 |
Description: Description of target: Has e3 ubiquitin ligase activity towards igbp1, promoting its monoubiquitination, which results in deprotection of the catalytic subunit of protein phosphatase pp2a, and its subsequent degradation by polyubiquitination.;Species reactivity: Mouse;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.052ng/mL |
Mouse Mid1- interacting protein 1, Mid1ip1 ELISA KIT |
ELI-43013m |
Lifescience Market |
96 Tests |
EUR 865 |
Midline-1 Polyclonal Antibody |
ES2789-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Midline-1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA |
Midline-1 Polyclonal Antibody |
ES2789-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Midline-1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA |
Midline-1 Polyclonal Antibody |
ABP51790-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from the N-terminal region of human Midline-1 at AA range: 40-120
- Applications tips:
|
Description: A polyclonal antibody for detection of Midline-1 from Human, Mouse, Rat. This Midline-1 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human Midline-1 at AA range: 40-120 |
Midline-1 Polyclonal Antibody |
ABP51790-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the N-terminal region of human Midline-1 at AA range: 40-120
- Applications tips:
|
Description: A polyclonal antibody for detection of Midline-1 from Human, Mouse, Rat. This Midline-1 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human Midline-1 at AA range: 40-120 |
Midline-1 Polyclonal Antibody |
ABP51790-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the N-terminal region of human Midline-1 at AA range: 40-120
- Applications tips:
|
Description: A polyclonal antibody for detection of Midline-1 from Human, Mouse, Rat. This Midline-1 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human Midline-1 at AA range: 40-120 |
Anti-Midline-1 antibody |
STJ94125 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to Midline-1. |
MID1 ELISA Kit (Human) (OKCA00727) |
OKCA00727 |
Aviva Systems Biology |
96 Wells |
EUR 833 |
Description: Description of target: Has E3 ubiquitin ligase activity towards IGBP1, promoting its monoubiquitination, which results in deprotection of the catalytic subunit of protein phosphatase PP2A, and its subsequent degradation by polyubiquitination.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 5.86 pg/mL |
Human Mid1- interacting protein 1, MID1IP1 ELISA KIT |
ELI-31441h |
Lifescience Market |
96 Tests |
EUR 824 |
Human MID1 Interacting Protein 1 (MID1IP1) ELISA Kit |
abx381447-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse MID1 shRNA Plasmid |
20-abx971511 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
MID1 Recombinant Protein (Mouse) |
RP150623 |
ABM |
100 ug |
Ask for price |
MID1 Recombinant Protein (Mouse) |
RP150626 |
ABM |
100 ug |
Ask for price |
MID1 siRNA |
20-abx903258 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MID1 siRNA |
20-abx924146 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MID1 siRNA |
20-abx924147 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MID1 Antibody |
1-CSB-PA003239 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against MID1. Recognizes MID1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/40000 |
MID1 Antibody |
1-CSB-PA013819ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against MID1. Recognizes MID1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
MID1 Antibody |
CSB-PA188851- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against MID1. Recognizes MID1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500 |
MID1 Antibody |
CSB-PA188851-100ul |
Cusabio |
100ul |
EUR 316 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against MID1. Recognizes MID1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500 |
anti-MID1 |
YF-PA24154 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to MID1 |
mRNAExpress mRNA Synthesis kit (5 reactions) |
MR-KIT-1 |
SBI |
5 reactions |
EUR 1152 |
- Category: Stem Cell Products
|
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN320A-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
Mid1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3974902 |
ABM |
1.0 ug DNA |
EUR 154 |
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN340iPS-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
ELISA kit for Rat Mid1-interacting protein 1 (MID1IP1) |
KTE100617-48T |
Abbkine |
48T |
EUR 332 |
- MID1IP1 (MID1 Interacting Protein 1) is a Protein Coding gene. Among its related pathways are Metabolism and Import of palmitoyl-CoA into the mitochondrial matrix. GO annotations related to this gene include protein C-terminus binding. An important p
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Mid1-interacting protein 1 (MID1IP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Mid1-interacting protein 1 (MID1IP1) |
KTE100617-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- MID1IP1 (MID1 Interacting Protein 1) is a Protein Coding gene. Among its related pathways are Metabolism and Import of palmitoyl-CoA into the mitochondrial matrix. GO annotations related to this gene include protein C-terminus binding. An important p
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Mid1-interacting protein 1 (MID1IP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Mid1-interacting protein 1 (MID1IP1) |
KTE100617-96T |
Abbkine |
96T |
EUR 539 |
- MID1IP1 (MID1 Interacting Protein 1) is a Protein Coding gene. Among its related pathways are Metabolism and Import of palmitoyl-CoA into the mitochondrial matrix. GO annotations related to this gene include protein C-terminus binding. An important p
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Mid1-interacting protein 1 (MID1IP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Mid1-interacting protein 1 (MID1IP1) |
KTE61622-48T |
Abbkine |
48T |
EUR 332 |
- MID1IP1 (MID1 Interacting Protein 1) is a Protein Coding gene. Among its related pathways are Metabolism and Import of palmitoyl-CoA into the mitochondrial matrix. GO annotations related to this gene include protein C-terminus binding. An important p
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Mid1-interacting protein 1 (MID1IP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Mid1-interacting protein 1 (MID1IP1) |
KTE61622-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- MID1IP1 (MID1 Interacting Protein 1) is a Protein Coding gene. Among its related pathways are Metabolism and Import of palmitoyl-CoA into the mitochondrial matrix. GO annotations related to this gene include protein C-terminus binding. An important p
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Mid1-interacting protein 1 (MID1IP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Mid1-interacting protein 1 (MID1IP1) |
KTE61622-96T |
Abbkine |
96T |
EUR 539 |
- MID1IP1 (MID1 Interacting Protein 1) is a Protein Coding gene. Among its related pathways are Metabolism and Import of palmitoyl-CoA into the mitochondrial matrix. GO annotations related to this gene include protein C-terminus binding. An important p
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Mid1-interacting protein 1 (MID1IP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Mid1 ORF Vector (Mouse) (pORF) |
ORF050209 |
ABM |
1.0 ug DNA |
EUR 506 |
Mid1 ORF Vector (Mouse) (pORF) |
ORF050210 |
ABM |
1.0 ug DNA |
EUR 506 |
ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody |
EXOAB-KIT-1 |
SBI |
25 ul each |
EUR 627 |
|
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN300A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
MID1 cloning plasmid |
CSB-CL013819HU-10ug |
Cusabio |
10ug |
EUR 671 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2004
- Sequence: atggaaacactggagtcagaactgacctgccctatttgtctggagctctttgaggaccctcttctactgccctgcgcacacagcctctgcttcaactgcgcccaccgcatcctagtatcacactgtgccaccaacgagtctgtggagtccatcaccgccttccagtgccccacct
- Show more
|
Description: A cloning plasmid for the MID1 gene. |
MID1 Blocking Peptide |
20-abx061628 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MID1 Rabbit pAb |
A7291-100ul |
Abclonal |
100 ul |
EUR 308 |
MID1 Rabbit pAb |
A7291-200ul |
Abclonal |
200 ul |
EUR 459 |
MID1 Rabbit pAb |
A7291-20ul |
Abclonal |
20 ul |
EUR 183 |
MID1 Rabbit pAb |
A7291-50ul |
Abclonal |
50 ul |
EUR 223 |
MID1 Polyclonal Antibody |
30882-100ul |
SAB |
100ul |
EUR 252 |
MID1 Polyclonal Antibody |
30882-50ul |
SAB |
50ul |
EUR 187 |
Anti-MID1 antibody |
STJ29430 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein forms homodimers which associate with microtubules in the cytoplasm. The protein is likely involved in the formation of multiprotein structures acting as anchor points to microtubules. Mutations in this gene have been associated with the X-linked form of Opitz syndrome, which is characterized by midline abnormalities such as cleft lip, laryngeal cleft, heart defects, hypospadias, and agenesis of the corpus callosum. This gene was also the first example of a gene subject to X inactivation in human while escaping it in mouse. Alternative promoter use, alternative splicing and alternative polyadenylation result in multiple transcript variants that have different tissue specificities. |
Anti-MID1 (2C11) |
YF-MA14254 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to MID1 |
PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN400A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN410A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN412A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
MID1 Interacting Protein 1 (MID1IP1) Antibody |
20-abx121163 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
MID1 Interacting Protein 1 (MID1IP1) Antibody |
abx146079-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
MID1 Interacting Protein 1 (MID1IP1) Antibody |
20-abx216857 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MID1 Interacting Protein 1 (MID1IP1) Antibody |
20-abx334358 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
MID1 Interacting Protein 1 (MID1IP1) Antibody |
abx235181-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS |
AP-STR-KIT-1 |
CORNING |
1/pk |
EUR 355 |
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller |
Mid1 sgRNA CRISPR Lentivector set (Mouse) |
K3974901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
NUT Midline Carcinoma Family Member 1 (NUTM1) Antibody |
20-abx324996 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
Mouse Interleukin-1 beta (IL-1 beta) AssayMax ELISA Kit |
EMI2200-1 |
AssayPro |
96 Well Plate |
EUR 477 |
AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE620A-KIT |
SBI |
1 kit |
EUR 2132 |
|
MID1 Polyclonal Conjugated Antibody |
C30882 |
SAB |
100ul |
EUR 397 |
Rat MID1 shRNA Plasmid |
20-abx985797 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human MID1 shRNA Plasmid |
20-abx952900 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
MID1 Recombinant Protein (Human) |
RP019465 |
ABM |
100 ug |
Ask for price |
MID1 Recombinant Protein (Rat) |
RP211739 |
ABM |
100 ug |
Ask for price |
AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE622A-KIT |
SBI |
1 kit |
EUR 2132 |
|
AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE624A-KIT |
SBI |
1 kit |
EUR 2132 |
|
MID1 Interacting Protein 1 (MID1IP1) Antibody (HRP) |
20-abx336549 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
MID1 Interacting Protein 1 (MID1IP1) Antibody (FITC) |
20-abx336550 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
MID1 Interacting Protein 1 (MID1IP1) Antibody (Biotin) |
20-abx336551 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
MID1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1302402 |
ABM |
1.0 ug DNA |
EUR 154 |
Mid1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6795802 |
ABM |
1.0 ug DNA |
EUR 154 |
Mouse Insulin-like Growth Factor 1 (IGF-1) AssayMax ELISA Kit |
EMI1001-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Mid1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3974903 |
ABM |
1.0 ug DNA |
EUR 154 |
Mid1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3974904 |
ABM |
1.0 ug DNA |
EUR 154 |
MID1 Protein Vector (Mouse) (pPB-C-His) |
PV200834 |
ABM |
500 ng |
EUR 1065 |
MID1 Protein Vector (Mouse) (pPB-N-His) |
PV200835 |
ABM |
500 ng |
EUR 1065 |
MID1 Protein Vector (Mouse) (pPM-C-HA) |
PV200836 |
ABM |
500 ng |
EUR 1065 |
MID1 Protein Vector (Mouse) (pPM-C-His) |
PV200837 |
ABM |
500 ng |
EUR 1065 |
MID1 Protein Vector (Mouse) (pPB-C-His) |
PV200838 |
ABM |
500 ng |
EUR 1065 |
MID1 Protein Vector (Mouse) (pPB-N-His) |
PV200839 |
ABM |
500 ng |
EUR 1065 |
MID1 Protein Vector (Mouse) (pPM-C-HA) |
PV200840 |
ABM |
500 ng |
EUR 1065 |
MID1 Protein Vector (Mouse) (pPM-C-His) |
PV200841 |
ABM |
500 ng |
EUR 1065 |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV100PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV105PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV120PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV125PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS700A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS720A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS740A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV200PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV205PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV220PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV225PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS750A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS770A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS790A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)] |
CAS9LIG-KIT |
SBI |
1 Kit |
EUR 153 |
|
Polyclonal MID1 Antibody (C-term) |
APR03818G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MID1 (C-term). This antibody is tested and proven to work in the following applications: |
MID1 ORF Vector (Human) (pORF) |
ORF006489 |
ABM |
1.0 ug DNA |
EUR 95 |
Mid1 ORF Vector (Rat) (pORF) |
ORF070581 |
ABM |
1.0 ug DNA |
EUR 506 |
Mid1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1) |
K3974906 |
ABM |
1.0 ug DNA |
EUR 167 |
Mouse Albumin AssayMax ELISA Kit |
EMA2201-1 |
AssayPro |
96 Well Plate |
EUR 396 |
Mouse Albumin AssayMax ELISA Kit |
EMA3201-1 |
AssayPro |
96 Well Plate |
EUR 396 |
Mouse GOT1 AssayMax ELISA Kit |
EMG7150-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Mouse Hemopexin AssayMax ELISA Kit |
EMH2001-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Mouse Leptin AssayMax ELISA Kit |
EML2001-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Mouse Myoglobin AssayMax ELISA Kit |
EMM8001-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Mouse Prothrombin AssayMax ELISA Kit |
EMP3022-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Mouse Resistin AssayMax ELISA Kit |
EMR1001-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Mouse Transferrin AssayMax ELISA Kit |
EMT2105-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Mouse VCAM1 AssayMax ELISA Kit |
EMV1801-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human Glutaredoxin-1 AssayMax ELISA Kit |
EG2153-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Human Complexin-1 AssayMax ELISA Kit |
EC3505-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Human Hexokinase-1 AssayMax ELISA Kit |
EH3101-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Rat TIMP-1 AssayMax ELISA Kit |
ERT2538-1 |
AssayPro |
96 Well Plate |
EUR 477 |
RecombiVirus Mouse Norovirus 1 (MNV-1) IgG ELISA Kit, 96 tests |
AE-300300-1 |
Alpha Diagnostics |
1 kit |
EUR 567 |
Mouse Adiponectin (ACRP30) AssayMax ELISA Kit |
EMA2500-1 |
AssayPro |
96 Well Plate |
EUR 396 |
Mouse Fibrinogen (FBG) AssayMax ELISA Kit |
EMF1040-1 |
AssayPro |
96 Well Plate |
EUR 396 |
Mouse Fibronectin (FN) AssayMax ELISA Kit |
EMF1045-1 |
AssayPro |
96 Well Plate |
EUR 396 |
Mouse Fibrinogen (FBG) AssayMax ELISA Kit |
EMF2040-1 |
AssayPro |
96 Well Plate |
EUR 396 |
Mouse Plasminogen (PLG) AssayMax ELISA Kit |
EMP1200-1 |
AssayPro |
96 Well Plate |
EUR 396 |
Mouse Plasminogen (PLG) AssayMax ELISA Kit |
EMP2211-1 |
AssayPro |
96 Well Plate |
EUR 396 |
Mouse S100-A4 AssayMax ELISA Kit |
EMS2735-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Mouse TNF-alpha AssayMax ELISA Kit |
EMT2010-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human Lipocalin-1 (LCN1) AssayMax ELISA Kit |
EL3502-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human TGF-beta-1 AssayMax ELISA Kit |
ET3102-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human PAI-1/tPA AssayMax ELISA Kit |
EP1105-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Human KRAB-associated Protein 1 (KAP-1) AssayMax ELISA Kit |
EK2802-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human Interleukin-1 beta (IL-1 beta) AssayMax ELISA Kit |
EI2200-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human Interleukin-1-alpha (IL-1-alpha) AssayMax ELISA Kit |
EI2301-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human Plasminogen Activator Inhibitor-1 (PAI-1) AssayMax ELISA Kit |
EP1100-1 |
AssayPro |
96 Well Plate |
EUR 417 |
MID1 interacting G12-like protein antibody |
23147-100ul |
SAB |
100ul |
EUR 390 |
MID1 sgRNA CRISPR Lentivector set (Human) |
K1302401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Mid1 sgRNA CRISPR Lentivector set (Rat) |
K6795801 |
ABM |
3 x 1.0 ug |
EUR 339 |
vWF Acty. Kit |
ABP-ACT-KIT |
Abpcorp |
12 x 8 microwells |
EUR 428 |
vWF Ant. Kit |
ABP-TOT-KIT |
Abpcorp |
12 x 8 microwells |
EUR 394 |
Hemokinin 1 (mouse) |
B5127-1 |
ApexBio |
1 mg |
EUR 321 |
Mouse Antithrombin III (AT3) AssayMax ELISA Kit |
EMA3301-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Mouse alpha-2-Antiplasmin AssayMax ELISA Kit |
EMA3477-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Mouse Cystatin C (Cst3) AssayMax ELISA Kit |
EMC2501-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Mouse Complement Factor D AssayMax ELISA Kit |
EMF7701-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Mouse Immunoglobulin M (IgM) AssayMax ELISA Kit |
EMI3001-1 |
AssayPro |
96 Well Plate |
EUR 396 |
Mouse Lipocalin-2 (NGAL) AssayMax ELISA Kit |
EML3510-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Mouse Alpha-2-Macroglobulin AssayMax ELISA Kit |
EMM1115-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Human Insulin-like Growth Factor 1 (IGF-1) AssayMax ELISA Kit |
EI1001-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human Heat Shock Factor Protein 1 (HSF 1) AssayMax ELISA kit |
EH5215-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Human Glutathione Transferase zeta 1 AssayMax ELISA Kit |
EG2350-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human Glutathione Peroxidase 1 (GPX1) AssayMax ELISA Kit |
EG3928-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human Carbonic Anhydrase 1 (CA1) AssayMax ELISA Kit |
EC5752-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human Alpha-1-Antitrypsin (A1AT) AssayMax ELISA Kit |
EA5001-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Human Alpha-1-Antitrypsin (A1AT) AssayMax ELISA Kit |
EA5101-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Human Alpha-1-Antichymotrypsin (AACT) AssayMax ELISA Kit |
EA5501-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Human Estrogen Sulfotransferase (EST-1) AssayMax ELISA Kit |
EE2702-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human Alpha-1-Microglobulin (A1M) AssayMax ELISA Kit |
EM5110-1 |
AssayPro |
96 Well Plate |
EUR 396 |
hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9) |
CAS620A-KIT |
SBI |
1 kit |
EUR 2152 |
|
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression) |
PrecisionX Multiplex gRNA Cloning Kit |
CAS9-GRNA-KIT |
SBI |
10 rxn |
EUR 445 |
|
Mouse Sendai/(SeV/Parainfluenza virus 1) IgG ELISA Kit, 96 tests |
AE-300600-1 |
Alpha Diagnostics |
1 kit |
EUR 567 |
Mouse C-Reactive Protein (CRP) AssayMax ELISA Kit |
EMC1001-1 |
AssayPro |
96 Well Plate |
EUR 396 |
Mouse Epidermal Growth Factor (EGF) AssayMax ELISA Kit |
EME2011-1 |
AssayPro |
96 Well Plate |
EUR 396 |
Mouse Interleukin-6 (IL-6) AssayMax ELISA Kit |
EMI1006-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Mouse Interferon-gamma (IFN-gamma) AssayMax ELISA Kit |
EMI1023-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Mouse Interleukin-10 (IL-10) AssayMax ELISA Kit |
EMI3010-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Mouse Stem Cell Factor (SCF) AssayMax ELISA Kit |
EMS1001-1 |
AssayPro |
96 Well Plate |
EUR 396 |
Mouse Thrombin-Antithrombin (TAT) Complex AssayMax ELISA Kit |
EMT1020-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Mid1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse) |
K3974905 |
ABM |
3 x 1.0 ug |
EUR 376 |
Monoclonal MID1 Antibody (monoclonal) (M06), Clone: 2C11 |
AMM03797G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human MID1 (monoclonal) (M06). The antibodies are raised in mouse and are from clone 2C11. This antibody is applicable in WB |
MID1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1302403 |
ABM |
1.0 ug DNA |
EUR 154 |
MID1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1302404 |
ABM |
1.0 ug DNA |
EUR 154 |
Mid1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6795803 |
ABM |
1.0 ug DNA |
EUR 154 |
Mid1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6795804 |
ABM |
1.0 ug DNA |
EUR 154 |
MID1 Protein Vector (Rat) (pPB-C-His) |
PV282322 |
ABM |
500 ng |
EUR 1166 |
MID1 Protein Vector (Rat) (pPB-N-His) |
PV282323 |
ABM |
500 ng |
EUR 1166 |
MID1 Protein Vector (Rat) (pPM-C-HA) |
PV282324 |
ABM |
500 ng |
EUR 1166 |
MID1 Protein Vector (Rat) (pPM-C-His) |
PV282325 |
ABM |
500 ng |
EUR 1166 |
MID1 Protein Vector (Human) (pPB-C-His) |
PV025953 |
ABM |
500 ng |
EUR 329 |
MID1 Protein Vector (Human) (pPB-N-His) |
PV025954 |
ABM |
500 ng |
EUR 329 |
MID1 Protein Vector (Human) (pPM-C-HA) |
PV025955 |
ABM |
500 ng |
EUR 329 |
MID1 Protein Vector (Human) (pPM-C-His) |
PV025956 |
ABM |
500 ng |
EUR 329 |
Mid1 3'UTR GFP Stable Cell Line |
TU163196 |
ABM |
1.0 ml |
Ask for price |
Mid1 3'UTR Luciferase Stable Cell Line |
TU213186 |
ABM |
1.0 ml |
Ask for price |
MID1 3'UTR Luciferase Stable Cell Line |
TU013356 |
ABM |
1.0 ml |
EUR 4617 |
Mid1 3'UTR Luciferase Stable Cell Line |
TU113196 |
ABM |
1.0 ml |
Ask for price |
MID1 3'UTR GFP Stable Cell Line |
TU063356 |
ABM |
1.0 ml |
EUR 4617 |
Mid1 3'UTR GFP Stable Cell Line |
TU263186 |
ABM |
1.0 ml |
Ask for price |
Mouse Apolipoprotein A-I (Apo-A1) AssayMax ELISA Kit |
EMA5301-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Mouse Serum Amyloid P Component (SAP) AssayMax ELISA Kit |
EMA8201-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Mouse Glutathione S-Transferase A1 (GSTA1) AssayMax ELISA Kit |
EMG2758-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Mouse Retinol-Binding Protein 4 (RBP4) AssayMax ELISA Kit |
EMR3005-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Human Inhibitor of Growth Protein 1 (ING1) AssayMax ELISA Kit |
EI1770-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human Alpha-1-Acid Glycoprotein (Orosomucoid, AGP) AssayMax ELISA Kit |
EG5001-1 |
AssayPro |
96 Well Plate |
EUR 396 |
Human Alpha-1-Acid Glycoprotein (Orosomucoid, AGP) AssayMax ELISA Kit |
EG5101-1 |
AssayPro |
96 Well Plate |
EUR 396 |
Rabbit Albumin AssayMax ELISA Kit (Discontinued, replaced by ETA2202-1) |
ETA2201-1 |
AssayPro |
96 Well Plate |
EUR 396 |
Human NEDD4 Family-Interacting Protein 1 (NDFIP1) AssayMax ELISA Kit |
EN2550-1 |
AssayPro |
96 Well Plate |
EUR 477 |
MID1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1) |
K1302406 |
ABM |
1.0 ug DNA |
EUR 167 |
Mid1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1) |
K6795806 |
ABM |
1.0 ug DNA |
EUR 167 |
Galanin (1-29) (rat, mouse) |
B5325-1 |
ApexBio |
1 mg |
EUR 399 |
Mouse anti-dsDNA IgG1-specific ELISA Kit, 96 tests, Quantitative |
5120-1 |
Alpha Diagnostics |
1 Kit |
EUR 712 |
Mid1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2) |
K3974907 |
ABM |
1.0 ug DNA |
EUR 167 |
Mid1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3) |
K3974908 |
ABM |
1.0 ug DNA |
EUR 167 |
Human Alpha-1-Acid Glycoprotein 2 (ORM2, AGP2) AssayMax ELISA Kit |
EG2713-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Mouse Complete SeraMir Exosome RNA Amplification and Profiling Kit (contains cat# RA800A-1, RA805A-1, RA811A-1 components) 20 profiles |
RA821A-1 |
SBI |
20 profiles |
EUR 1297 |
|
PGAM1 Mouse, Phosphoglycerate Mutase 1 Mouse Recombinant Protein, Active |
PROTQ9DBJ1-1 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: PGAM1 Mouse Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 278 amino acids (1-254) and having a molecular mass of 31.4kDa.;PGAM1 is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
Dr. P Kit-Solution 1 |
K2021010-1 |
Biochain |
50 ml |
EUR 204 |
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation. |
MID1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV660751 |
ABM |
1.0 ug DNA |
EUR 1355 |