Mouse MID1(Midline 1) ELISA Kit

Mouse MID1(Midline 1) ELISA Kit

To Order Contact us:  Mark@operatiebrp.nl

Mouse Midline 1 (MID1) ELISA Kit
RD-MID1-Mu-48Tests 48 Tests
EUR 533
Mouse Midline 1 (MID1) ELISA Kit
RD-MID1-Mu-96Tests 96 Tests
EUR 740
Mouse Midline 1 (MID1) ELISA Kit
RDR-MID1-Mu-48Tests 48 Tests
EUR 557
Mouse Midline 1 (MID1) ELISA Kit
RDR-MID1-Mu-96Tests 96 Tests
EUR 774
Mouse Midline- 1, Mid1 ELISA KIT
ELI-51790m 96 Tests
EUR 865
Mouse Midline 1 (MID1) ELISA Kit
20-abx154383
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Mouse Midline-1(MID1) ELISA kit
CSB-EL013819MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Midline-1 (MID1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Mouse Midline-1(MID1) ELISA kit
1-CSB-EL013819MO
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Midline-1(MID1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Mouse Midline 1 (MID1) ELISA Kit
SEC620Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Midline 1 (MID1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Midline 1 (MID1) in Tissue homogenates and other biological fluids.
Mouse Midline 1 (MID1) ELISA Kit
SEC620Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Midline 1 (MID1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Midline 1 (MID1) in Tissue homogenates and other biological fluids.
Mouse Midline 1 (MID1) ELISA Kit
SEC620Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Midline 1 (MID1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Midline 1 (MID1) in Tissue homogenates and other biological fluids.
Mouse Midline 1 (MID1) ELISA Kit
SEC620Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Midline 1 (MID1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Midline 1 (MID1) in Tissue homogenates and other biological fluids.
Mouse Midline 1 (MID1) ELISA Kit
4-SEC620Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Midline 1 elisa. Alternative names of the recognized antigen: BBBG1
  • Midin
  • FXY
  • GBBB1
  • OGS1
  • OS
  • OSX
  • RNF59
  • TRIM18
  • XPRF
  • ZNFXY
  • Opitz/BBB Syndrome
  • RING finger protein 59
  • Tripartite motif-containing protein 18
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Midline 1 (MID1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
ELISA kit for Mouse MID1 (Midline 1)
ELK7091 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Midline 1 (MID1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Midline 1 (MID1).
  • Show more
Description: A sandwich ELISA kit for detection of Midline 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Mouse Midline-1 (MID1)
KTE71030-48T 48T
EUR 332
  • The protein encoded by MID1 is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Midline-1 (MID1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Midline-1 (MID1)
KTE71030-5platesof96wells 5 plates of 96 wells
EUR 2115
  • The protein encoded by MID1 is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Midline-1 (MID1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Midline-1 (MID1)
KTE71030-96T 96T
EUR 539
  • The protein encoded by MID1 is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Midline-1 (MID1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Mouse Midline 1 (MID1) Protein
20-abx167423
  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Mouse Midline 1 (MID1) CLIA Kit
20-abx493802
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Human Midline- 1, MID1 ELISA KIT
ELI-28917h 96 Tests
EUR 824
Human Midline-1(MID1) ELISA kit
CSB-EL013819HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Midline-1 (MID1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Midline-1(MID1) ELISA kit
1-CSB-EL013819HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Midline-1(MID1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human Midline 1(MID1)ELISA Kit
QY-E04797 96T
EUR 394
Midline 1 (MID1) Antibody
20-abx129420
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Midline 1 (MID1) Antibody
abx146040-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Midline 1 (MID1) Antibody
20-abx134929
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Midline 1 (MID1) Antibody
20-abx005498
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Midline 1 (MID1) Antibody
abx027403-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Midline 1 (MID1) Antibody
abx027403-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Midline 1 (MID1) Antibody
20-abx177566
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.
Midline 1 (MID1) Antibody
20-abx320825
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Midline 1 (MID1) Antibody
20-abx329554
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Midline 1 (MID1) Antibody
abx332373-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.
Recombinant Midline 1 (MID1)
4-RPC620Mu01
  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O70583
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 27.5KDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Midline 1 expressed in: E.coli
Midline 1 (MID1) Polyclonal Antibody (Mouse)
4-PAC620Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MID1 (Met1~Leu212)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Midline 1 (MID1)
ELISA kit for Rat Midline-1 (MID1)
KTE100618-48T 48T
EUR 332
  • The protein encoded by MID1 is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Midline-1 (MID1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Rat Midline-1 (MID1)
KTE100618-5platesof96wells 5 plates of 96 wells
EUR 2115
  • The protein encoded by MID1 is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Midline-1 (MID1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Rat Midline-1 (MID1)
KTE100618-96T 96T
EUR 539
  • The protein encoded by MID1 is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Midline-1 (MID1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Midline-1 (MID1)
KTE61623-48T 48T
EUR 332
  • Midline-1 encoded by MID1 is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box ty
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Midline-1 (MID1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Midline-1 (MID1)
KTE61623-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Midline-1 encoded by MID1 is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box ty
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Midline-1 (MID1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Midline-1 (MID1)
KTE61623-96T 96T
EUR 539
  • Midline-1 encoded by MID1 is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box ty
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Midline-1 (MID1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Midline 1 (MID1) polyclonal antibody
ABP-PAB-11697 100 ug Ask for price
    • Product line: Transcription Factors
    • Brand:
Midline 1 (MID1) Polyclonal Antibody (Mouse), APC
4-PAC620Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MID1 (Met1~Leu212)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Midline 1 (MID1). This antibody is labeled with APC.
Midline 1 (MID1) Polyclonal Antibody (Mouse), Biotinylated
4-PAC620Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MID1 (Met1~Leu212)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Midline 1 (MID1). This antibody is labeled with Biotin.
Midline 1 (MID1) Polyclonal Antibody (Mouse), Cy3
4-PAC620Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MID1 (Met1~Leu212)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Midline 1 (MID1). This antibody is labeled with Cy3.
Midline 1 (MID1) Polyclonal Antibody (Mouse), FITC
4-PAC620Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MID1 (Met1~Leu212)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Midline 1 (MID1). This antibody is labeled with FITC.
Midline 1 (MID1) Polyclonal Antibody (Mouse), HRP
4-PAC620Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MID1 (Met1~Leu212)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Midline 1 (MID1). This antibody is labeled with HRP.
Midline 1 (MID1) Polyclonal Antibody (Mouse), PE
4-PAC620Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MID1 (Met1~Leu212)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Midline 1 (MID1). This antibody is labeled with PE.
Midline 1 (MID1) Polyclonal Antibody (Mouse), APC-Cy7
4-PAC620Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MID1 (Met1~Leu212)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Midline 1 (MID1). This antibody is labeled with APC-Cy7.
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202
Mid1/ Rat Mid1 ELISA Kit
ELI-17080r 96 Tests
EUR 886
Anti-MID1 Antibody
A01774-1 100ug/vial
EUR 334
Mouse Mid1- interacting protein 1, Mid1ip1 ELISA KIT
ELI-43013m 96 Tests
EUR 865
Midline-1 Polyclonal Antibody
ES2789-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Midline-1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA
Midline-1 Polyclonal Antibody
ES2789-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Midline-1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA
Midline-1 Polyclonal Antibody
ABP51790-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human Midline-1 at AA range: 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of Midline-1 from Human, Mouse, Rat. This Midline-1 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human Midline-1 at AA range: 40-120
Midline-1 Polyclonal Antibody
ABP51790-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human Midline-1 at AA range: 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of Midline-1 from Human, Mouse, Rat. This Midline-1 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human Midline-1 at AA range: 40-120
Midline-1 Polyclonal Antibody
ABP51790-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human Midline-1 at AA range: 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of Midline-1 from Human, Mouse, Rat. This Midline-1 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human Midline-1 at AA range: 40-120
Anti-Midline-1 antibody
STJ94125 200 µl
EUR 197
Description: Rabbit polyclonal to Midline-1.
Human Midline 2(MID2)ELISA Kit
QY-E04796 96T
EUR 394
Human Mid1- interacting protein 1, MID1IP1 ELISA KIT
ELI-31441h 96 Tests
EUR 824
Human MID1 Interacting Protein 1 (MID1IP1) ELISA Kit
abx381447-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Mouse MID1 shRNA Plasmid
20-abx971511
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
MID1 Recombinant Protein (Mouse)
RP150623 100 ug Ask for price
MID1 Recombinant Protein (Mouse)
RP150626 100 ug Ask for price
MID1 siRNA
20-abx903258
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
MID1 siRNA
20-abx924146
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
MID1 siRNA
20-abx924147
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
MID1 Antibody
1-CSB-PA003239
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against MID1. Recognizes MID1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/40000
MID1 Antibody
1-CSB-PA013819ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MID1. Recognizes MID1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
MID1 Antibody
CSB-PA188851-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against MID1. Recognizes MID1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500
MID1 Antibody
CSB-PA188851-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against MID1. Recognizes MID1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500
anti-MID1
YF-PA24154 50 ul
EUR 334
Description: Mouse polyclonal to MID1
mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools
Mid1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3974902 1.0 ug DNA
EUR 154
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools
ELISA kit for Rat Mid1-interacting protein 1 (MID1IP1)
KTE100617-48T 48T
EUR 332
  • MID1IP1 (MID1 Interacting Protein 1) is a Protein Coding gene. Among its related pathways are Metabolism and Import of palmitoyl-CoA into the mitochondrial matrix. GO annotations related to this gene include protein C-terminus binding. An important p
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Mid1-interacting protein 1 (MID1IP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Rat Mid1-interacting protein 1 (MID1IP1)
KTE100617-5platesof96wells 5 plates of 96 wells
EUR 2115
  • MID1IP1 (MID1 Interacting Protein 1) is a Protein Coding gene. Among its related pathways are Metabolism and Import of palmitoyl-CoA into the mitochondrial matrix. GO annotations related to this gene include protein C-terminus binding. An important p
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Mid1-interacting protein 1 (MID1IP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Rat Mid1-interacting protein 1 (MID1IP1)
KTE100617-96T 96T
EUR 539
  • MID1IP1 (MID1 Interacting Protein 1) is a Protein Coding gene. Among its related pathways are Metabolism and Import of palmitoyl-CoA into the mitochondrial matrix. GO annotations related to this gene include protein C-terminus binding. An important p
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Mid1-interacting protein 1 (MID1IP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Mid1-interacting protein 1 (MID1IP1)
KTE61622-48T 48T
EUR 332
  • MID1IP1 (MID1 Interacting Protein 1) is a Protein Coding gene. Among its related pathways are Metabolism and Import of palmitoyl-CoA into the mitochondrial matrix. GO annotations related to this gene include protein C-terminus binding. An important p
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Mid1-interacting protein 1 (MID1IP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Mid1-interacting protein 1 (MID1IP1)
KTE61622-5platesof96wells 5 plates of 96 wells
EUR 2115
  • MID1IP1 (MID1 Interacting Protein 1) is a Protein Coding gene. Among its related pathways are Metabolism and Import of palmitoyl-CoA into the mitochondrial matrix. GO annotations related to this gene include protein C-terminus binding. An important p
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Mid1-interacting protein 1 (MID1IP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Mid1-interacting protein 1 (MID1IP1)
KTE61622-96T 96T
EUR 539
  • MID1IP1 (MID1 Interacting Protein 1) is a Protein Coding gene. Among its related pathways are Metabolism and Import of palmitoyl-CoA into the mitochondrial matrix. GO annotations related to this gene include protein C-terminus binding. An important p
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Mid1-interacting protein 1 (MID1IP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Mid1 ORF Vector (Mouse) (pORF)
ORF050209 1.0 ug DNA
EUR 506
Mid1 ORF Vector (Mouse) (pORF)
ORF050210 1.0 ug DNA
EUR 506
ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9
MID1 cloning plasmid
CSB-CL013819HU-10ug 10ug
EUR 671
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2004
  • Sequence: atggaaacactggagtcagaactgacctgccctatttgtctggagctctttgaggaccctcttctactgccctgcgcacacagcctctgcttcaactgcgcccaccgcatcctagtatcacactgtgccaccaacgagtctgtggagtccatcaccgccttccagtgccccacct
  • Show more
Description: A cloning plasmid for the MID1 gene.
MID1 Blocking Peptide
20-abx061628
  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
MID1 Rabbit pAb
A7291-100ul 100 ul
EUR 308
MID1 Rabbit pAb
A7291-200ul 200 ul
EUR 459
MID1 Rabbit pAb
A7291-20ul 20 ul
EUR 183
MID1 Rabbit pAb
A7291-50ul 50 ul
EUR 223
MID1 Polyclonal Antibody
30882-100ul 100ul
EUR 252
MID1 Polyclonal Antibody
30882-50ul 50ul
EUR 187
Anti-MID1 antibody
STJ29430 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein forms homodimers which associate with microtubules in the cytoplasm. The protein is likely involved in the formation of multiprotein structures acting as anchor points to microtubules. Mutations in this gene have been associated with the X-linked form of Opitz syndrome, which is characterized by midline abnormalities such as cleft lip, laryngeal cleft, heart defects, hypospadias, and agenesis of the corpus callosum. This gene was also the first example of a gene subject to X inactivation in human while escaping it in mouse. Alternative promoter use, alternative splicing and alternative polyadenylation result in multiple transcript variants that have different tissue specificities.
Anti-MID1 (2C11)
YF-MA14254 100 ug
EUR 363
Description: Mouse monoclonal to MID1
PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools
MID1 Interacting Protein 1 (MID1IP1) Antibody
20-abx121163
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
MID1 Interacting Protein 1 (MID1IP1) Antibody
abx146079-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
MID1 Interacting Protein 1 (MID1IP1) Antibody
20-abx216857
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
MID1 Interacting Protein 1 (MID1IP1) Antibody
20-abx334358
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
MID1 Interacting Protein 1 (MID1IP1) Antibody
abx235181-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller
Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
Mid1 sgRNA CRISPR Lentivector set (Mouse)
K3974901 3 x 1.0 ug
EUR 339
Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
PCR Mycoplasma Detection Kit
M034-Kit Kit
EUR 266
NUT Midline Carcinoma Family Member 1 (NUTM1) Antibody
20-abx324996
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Mouse Interleukin-1 beta (IL-1 beta) AssayMax ELISA Kit
EMI2200-1 96 Well Plate
EUR 477
AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing
MID1 Polyclonal Conjugated Antibody
C30882 100ul
EUR 397
Rat MID1 shRNA Plasmid
20-abx985797
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human MID1 shRNA Plasmid
20-abx952900
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
MID1 Recombinant Protein (Human)
RP019465 100 ug Ask for price
MID1 Recombinant Protein (Rat)
RP211739 100 ug Ask for price
AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing
AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing
MID1 Interacting Protein 1 (MID1IP1) Antibody (HRP)
20-abx336549
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
MID1 Interacting Protein 1 (MID1IP1) Antibody (FITC)
20-abx336550
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
MID1 Interacting Protein 1 (MID1IP1) Antibody (Biotin)
20-abx336551
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
MID1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1302402 1.0 ug DNA
EUR 154
Mid1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6795802 1.0 ug DNA
EUR 154
Mouse Insulin-like Growth Factor 1 (IGF-1) AssayMax ELISA Kit
EMI1001-1 96 Well Plate
EUR 477
Mid1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3974903 1.0 ug DNA
EUR 154
Mid1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3974904 1.0 ug DNA
EUR 154
MID1 Protein Vector (Mouse) (pPB-C-His)
PV200834 500 ng
EUR 1065
MID1 Protein Vector (Mouse) (pPB-N-His)
PV200835 500 ng
EUR 1065
MID1 Protein Vector (Mouse) (pPM-C-HA)
PV200836 500 ng
EUR 1065
MID1 Protein Vector (Mouse) (pPM-C-His)
PV200837 500 ng
EUR 1065
MID1 Protein Vector (Mouse) (pPB-C-His)
PV200838 500 ng
EUR 1065
MID1 Protein Vector (Mouse) (pPB-N-His)
PV200839 500 ng
EUR 1065
MID1 Protein Vector (Mouse) (pPM-C-HA)
PV200840 500 ng
EUR 1065
MID1 Protein Vector (Mouse) (pPM-C-His)
PV200841 500 ng
EUR 1065
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT 1 Kit
EUR 153
  • Category: Cas9
Polyclonal MID1 Antibody (C-term)
APR03818G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MID1 (C-term). This antibody is tested and proven to work in the following applications:
MID1 ORF Vector (Human) (pORF)
ORF006489 1.0 ug DNA
EUR 95
Mid1 ORF Vector (Rat) (pORF)
ORF070581 1.0 ug DNA
EUR 506
Mid1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3974906 1.0 ug DNA
EUR 167
Mouse Albumin AssayMax ELISA Kit
EMA2201-1 96 Well Plate
EUR 396
Mouse Albumin AssayMax ELISA Kit
EMA3201-1 96 Well Plate
EUR 396
Mouse GOT1 AssayMax ELISA Kit
EMG7150-1 96 Well Plate
EUR 477
Mouse Hemopexin AssayMax ELISA Kit
EMH2001-1 96 Well Plate
EUR 417
Mouse Leptin AssayMax ELISA Kit
EML2001-1 96 Well Plate
EUR 477
Mouse Myoglobin AssayMax ELISA Kit
EMM8001-1 96 Well Plate
EUR 417
Mouse Prothrombin AssayMax ELISA Kit
EMP3022-1 96 Well Plate
EUR 417
Mouse Resistin AssayMax ELISA Kit
EMR1001-1 96 Well Plate
EUR 477
Mouse Transferrin AssayMax ELISA Kit
EMT2105-1 96 Well Plate
EUR 417
Mouse VCAM1 AssayMax ELISA Kit
EMV1801-1 96 Well Plate
EUR 477
Human Glutaredoxin-1 AssayMax ELISA Kit
EG2153-1 96 Well Plate
EUR 417
Human Complexin-1 AssayMax ELISA Kit
EC3505-1 96 Well Plate
EUR 417
Human Hexokinase-1 AssayMax ELISA Kit
EH3101-1 96 Well Plate
EUR 477
Rat TIMP-1 AssayMax ELISA Kit
ERT2538-1 96 Well Plate
EUR 477
RecombiVirus Mouse Norovirus 1 (MNV-1) IgG ELISA Kit, 96 tests
AE-300300-1 1 kit
EUR 567
Mouse Adiponectin (ACRP30) AssayMax ELISA Kit
EMA2500-1 96 Well Plate
EUR 396
Mouse Fibrinogen (FBG) AssayMax ELISA Kit
EMF1040-1 96 Well Plate
EUR 396
Mouse Fibronectin (FN) AssayMax ELISA Kit
EMF1045-1 96 Well Plate
EUR 396
Mouse Fibrinogen (FBG) AssayMax ELISA Kit
EMF2040-1 96 Well Plate
EUR 396
Mouse Plasminogen (PLG) AssayMax ELISA Kit
EMP1200-1 96 Well Plate
EUR 396
Mouse Plasminogen (PLG) AssayMax ELISA Kit
EMP2211-1 96 Well Plate
EUR 396
Mouse S100-A4 AssayMax ELISA Kit
EMS2735-1 96 Well Plate
EUR 477
Mouse TNF-alpha AssayMax ELISA Kit
EMT2010-1 96 Well Plate
EUR 477
Human Lipocalin-1 (LCN1) AssayMax ELISA Kit
EL3502-1 96 Well Plate
EUR 477
Human TGF-beta-1 AssayMax ELISA Kit
ET3102-1 96 Well Plate
EUR 477
Human PAI-1/tPA AssayMax ELISA Kit
EP1105-1 96 Well Plate
EUR 417
Human KRAB-associated Protein 1 (KAP-1) AssayMax ELISA Kit
EK2802-1 96 Well Plate
EUR 477
Human Interleukin-1 beta (IL-1 beta) AssayMax ELISA Kit
EI2200-1 96 Well Plate
EUR 477
Human Interleukin-1-alpha (IL-1-alpha) AssayMax ELISA Kit
EI2301-1 96 Well Plate
EUR 477
Human Plasminogen Activator Inhibitor-1 (PAI-1) AssayMax ELISA Kit
EP1100-1 96 Well Plate
EUR 417
MID1 interacting G12-like protein antibody
23147-100ul 100ul
EUR 390
MID1 sgRNA CRISPR Lentivector set (Human)
K1302401 3 x 1.0 ug
EUR 339
Mid1 sgRNA CRISPR Lentivector set (Rat)
K6795801 3 x 1.0 ug
EUR 339
vWF Acty. Kit
ABP-ACT-KIT 12 x 8 microwells
EUR 428
vWF Ant. Kit
ABP-TOT-KIT 12 x 8 microwells
EUR 394
Mouse Antithrombin III (AT3) AssayMax ELISA Kit
EMA3301-1 96 Well Plate
EUR 417
Mouse alpha-2-Antiplasmin AssayMax ELISA Kit
EMA3477-1 96 Well Plate
EUR 477
Mouse Cystatin C (Cst3) AssayMax ELISA Kit
EMC2501-1 96 Well Plate
EUR 477
Mouse Complement Factor D AssayMax ELISA Kit
EMF7701-1 96 Well Plate
EUR 417
Mouse Immunoglobulin M (IgM) AssayMax ELISA Kit
EMI3001-1 96 Well Plate
EUR 396
Mouse Lipocalin-2 (NGAL) AssayMax ELISA Kit
EML3510-1 96 Well Plate
EUR 477
Mouse Alpha-2-Macroglobulin AssayMax ELISA Kit
EMM1115-1 96 Well Plate
EUR 417
Hemokinin 1 (mouse)
B5127-1 1 mg
EUR 321
Human Insulin-like Growth Factor 1 (IGF-1) AssayMax ELISA Kit
EI1001-1 96 Well Plate
EUR 477
Human Heat Shock Factor Protein 1 (HSF 1) AssayMax ELISA kit
EH5215-1 96 Well Plate
EUR 417
Human Glutathione Transferase zeta 1 AssayMax ELISA Kit
EG2350-1 96 Well Plate
EUR 477
Human Glutathione Peroxidase 1 (GPX1) AssayMax ELISA Kit
EG3928-1 96 Well Plate
EUR 477
Human Carbonic Anhydrase 1 (CA1) AssayMax ELISA Kit
EC5752-1 96 Well Plate
EUR 477
Human Alpha-1-Antitrypsin (A1AT) AssayMax ELISA Kit
EA5001-1 96 Well Plate
EUR 417
Human Alpha-1-Antitrypsin (A1AT) AssayMax ELISA Kit
EA5101-1 96 Well Plate
EUR 417
Human Alpha-1-Antichymotrypsin (AACT) AssayMax ELISA Kit
EA5501-1 96 Well Plate
EUR 417
Human Estrogen Sulfotransferase (EST-1) AssayMax ELISA Kit
EE2702-1 96 Well Plate
EUR 477
Human Alpha-1-Microglobulin (A1M) AssayMax ELISA Kit
EM5110-1 96 Well Plate
EUR 396
hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)
CAS620A-KIT 1 kit
EUR 2152
  • Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)
PrecisionX Multiplex gRNA Cloning Kit
CAS9-GRNA-KIT 10 rxn
EUR 445
  • Category: Cas9
Mouse Sendai/(SeV/Parainfluenza virus 1) IgG ELISA Kit, 96 tests
AE-300600-1 1 kit
EUR 567
Mouse C-Reactive Protein (CRP) AssayMax ELISA Kit
EMC1001-1 96 Well Plate
EUR 396
Mouse Epidermal Growth Factor (EGF) AssayMax ELISA Kit
EME2011-1 96 Well Plate
EUR 396
Mouse Interleukin-6 (IL-6) AssayMax ELISA Kit
EMI1006-1 96 Well Plate
EUR 477
Mouse Interferon-gamma (IFN-gamma) AssayMax ELISA Kit
EMI1023-1 96 Well Plate
EUR 477
Mouse Interleukin-10 (IL-10) AssayMax ELISA Kit
EMI3010-1 96 Well Plate
EUR 477
Mouse Stem Cell Factor (SCF) AssayMax ELISA Kit
EMS1001-1 96 Well Plate
EUR 396
Mouse Thrombin-Antithrombin (TAT) Complex AssayMax ELISA Kit
EMT1020-1 96 Well Plate
EUR 417
Mid1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3974905 3 x 1.0 ug
EUR 376
Monoclonal MID1 Antibody (monoclonal) (M06), Clone: 2C11
AMM03797G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human MID1 (monoclonal) (M06). The antibodies are raised in mouse and are from clone 2C11. This antibody is applicable in WB
MID1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1302403 1.0 ug DNA
EUR 154
MID1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1302404 1.0 ug DNA
EUR 154
Mid1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6795803 1.0 ug DNA
EUR 154
Mid1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6795804 1.0 ug DNA
EUR 154
MID1 Protein Vector (Rat) (pPB-C-His)
PV282322 500 ng
EUR 1166
MID1 Protein Vector (Rat) (pPB-N-His)
PV282323 500 ng
EUR 1166
MID1 Protein Vector (Rat) (pPM-C-HA)
PV282324 500 ng
EUR 1166
MID1 Protein Vector (Rat) (pPM-C-His)
PV282325 500 ng
EUR 1166
MID1 Protein Vector (Human) (pPB-C-His)
PV025953 500 ng
EUR 329
MID1 Protein Vector (Human) (pPB-N-His)
PV025954 500 ng
EUR 329
MID1 Protein Vector (Human) (pPM-C-HA)
PV025955 500 ng
EUR 329
MID1 Protein Vector (Human) (pPM-C-His)
PV025956 500 ng
EUR 329
Mid1 3'UTR GFP Stable Cell Line
TU163196 1.0 ml Ask for price
Mid1 3'UTR Luciferase Stable Cell Line
TU213186 1.0 ml Ask for price
MID1 3'UTR Luciferase Stable Cell Line
TU013356 1.0 ml
EUR 4617
Mid1 3'UTR Luciferase Stable Cell Line
TU113196 1.0 ml Ask for price
MID1 3'UTR GFP Stable Cell Line
TU063356 1.0 ml
EUR 4617
Mid1 3'UTR GFP Stable Cell Line
TU263186 1.0 ml Ask for price
Mouse Apolipoprotein A-I (Apo-A1) AssayMax ELISA Kit
EMA5301-1 96 Well Plate
EUR 477
Mouse Serum Amyloid P Component (SAP) AssayMax ELISA Kit
EMA8201-1 96 Well Plate
EUR 417
Mouse Glutathione S-Transferase A1 (GSTA1) AssayMax ELISA Kit
EMG2758-1 96 Well Plate
EUR 477
Mouse Retinol-Binding Protein 4 (RBP4) AssayMax ELISA Kit
EMR3005-1 96 Well Plate
EUR 417
Human Inhibitor of Growth Protein 1 (ING1) AssayMax ELISA Kit
EI1770-1 96 Well Plate
EUR 477
Human Alpha-1-Acid Glycoprotein (Orosomucoid, AGP) AssayMax ELISA Kit
EG5001-1 96 Well Plate
EUR 396
Human Alpha-1-Acid Glycoprotein (Orosomucoid, AGP) AssayMax ELISA Kit
EG5101-1 96 Well Plate
EUR 396
Rabbit Albumin AssayMax ELISA Kit (Discontinued, replaced by ETA2202-1)
ETA2201-1 96 Well Plate
EUR 396
Human NEDD4 Family-Interacting Protein 1 (NDFIP1) AssayMax ELISA Kit
EN2550-1 96 Well Plate
EUR 477
MID1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K1302406 1.0 ug DNA
EUR 167
Mid1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6795806 1.0 ug DNA
EUR 167
Galanin (1-29) (rat, mouse)
B5325-1 1 mg
EUR 399
Mouse anti-dsDNA IgG1-specific ELISA Kit, 96 tests, Quantitative
5120-1 1 Kit
EUR 712
Human Alpha-1-Acid Glycoprotein 2 (ORM2, AGP2) AssayMax ELISA Kit
EG2713-1 96 Well Plate
EUR 417
Mid1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3974907 1.0 ug DNA
EUR 167
Mid1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3974908 1.0 ug DNA
EUR 167
Mouse Complete SeraMir Exosome RNA Amplification and Profiling Kit (contains cat# RA800A-1, RA805A-1, RA811A-1 components) 20 profiles
RA821A-1 20 profiles
EUR 1297
  • Category: MicroRNA Tools
PGAM1 Mouse, Phosphoglycerate Mutase 1 Mouse Recombinant Protein, Active
PROTQ9DBJ1-1 Regular: 10ug
EUR 317
Description: PGAM1 Mouse Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 278 amino acids (1-254) and having a molecular mass of 31.4kDa.;PGAM1 is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
Nesfatin-1 (mouse)
SP-100055-1 1 mg
EUR 773
Dr. P Kit-Solution 1
K2021010-1 50 ml
EUR 204
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.
Recombivirus Mouse Anti-Cytomegalovirus (MCMV/MuHV-1) gB IgG ELISA Kit, 96 tests, Quantitative
AE-301000-1 1 Kit
EUR 567
MID1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV660751 1.0 ug DNA
EUR 1355
MID1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV660755 1.0 ug DNA
EUR 1355
MID1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV660756 1.0 ug DNA
EUR 1355