Mouse CRYbA1(Crystallin Beta A1) ELISA Kit

Mouse CRYbA1(Crystallin Beta A1) ELISA Kit

To Order Contact us:  Mark@operatiebrp.nl

Mouse Crystallin Beta A1 (CRYbA1) ELISA Kit
SEF342Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta A1 (CRYbA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta A1 (CRYbA1) in Tissue homogenates, cell lysates and other biological fluids.
Mouse Crystallin Beta A1 (CRYbA1) ELISA Kit
SEF342Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta A1 (CRYbA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta A1 (CRYbA1) in Tissue homogenates, cell lysates and other biological fluids.
Mouse Crystallin Beta A1 (CRYbA1) ELISA Kit
SEF342Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta A1 (CRYbA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta A1 (CRYbA1) in Tissue homogenates, cell lysates and other biological fluids.
Mouse Crystallin Beta A1 (CRYbA1) ELISA Kit
SEF342Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta A1 (CRYbA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta A1 (CRYbA1) in Tissue homogenates, cell lysates and other biological fluids.
Mouse Crystallin Beta A1 (CRYbA1) ELISA Kit
4-SEF342Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Crystallin Beta A1 elisa. Alternative names of the recognized antigen: CRYB1
  • Eye Lens Structural Protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Crystallin Beta A1 (CRYbA1) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Crystallin Beta A1 (CRYbA1) Antibody
20-abx129439
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Crystallin Beta A1 (CRYBA1) Antibody
abx145287-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Crystallin Beta A1 (CRYBA1) Antibody
abx026765-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Crystallin Beta A1 (CRYBA1) Antibody
abx026765-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Crystallin Beta A1 (CRYBA1) Antibody
20-abx318504
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Recombinant Crystallin Beta A1 (CRYbA1)
4-RPF342Mu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P02525
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 28.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Crystallin Beta A1 expressed in: E.coli
Mouse Crystallin Beta A1 (CRYbA1) Protein
20-abx167367
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Mouse Crystallin Beta A1 (CRYbA1) CLIA Kit
20-abx494872
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
ELISA kit for Mouse CRYbA1 (Crystallin Beta A1)
ELK7341 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Crystallin Beta A1 (CRY?A1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Crysta
  • Show more
Description: A sandwich ELISA kit for detection of Crystallin Beta A1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Mouse Crystallin, beta A1 (CRYBA1)
KTE71401-48T 48T
EUR 332
  • Seven protein regions exist in crystallins: four homologous motifs, a connecting peptide, and N- and C-terminal extensions. Beta-crystallins, the most heterogeneous, differ by the presence of the C-terminal extension (present in the basic group, none
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Crystallin, beta A1 (CRYBA1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Crystallin, beta A1 (CRYBA1)
KTE71401-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Seven protein regions exist in crystallins: four homologous motifs, a connecting peptide, and N- and C-terminal extensions. Beta-crystallins, the most heterogeneous, differ by the presence of the C-terminal extension (present in the basic group, none
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Crystallin, beta A1 (CRYBA1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Crystallin, beta A1 (CRYBA1)
KTE71401-96T 96T
EUR 539
  • Seven protein regions exist in crystallins: four homologous motifs, a connecting peptide, and N- and C-terminal extensions. Beta-crystallins, the most heterogeneous, differ by the presence of the C-terminal extension (present in the basic group, none
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Crystallin, beta A1 (CRYBA1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Crystallin Beta A1 (CRYBA1) Antibody (HRP)
20-abx303503
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Crystallin Beta A1 (CRYBA1) Antibody (FITC)
20-abx303504
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Crystallin Beta A1 (CRYBA1) Antibody (Biotin)
20-abx303505
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Mouse crystallin, β A1 (CRYBA1) ELISA kit
E03C2086-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse crystallin, β A1 (CRYBA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse crystallin, β A1 (CRYBA1) ELISA kit
E03C2086-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse crystallin, β A1 (CRYBA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse crystallin, β A1 (CRYBA1) ELISA kit
E03C2086-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse crystallin, β A1 (CRYBA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat crystallin, β A1 (CRYBA1) ELISA kit
E06C2086-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat crystallin, β A1 (CRYBA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat crystallin, β A1 (CRYBA1) ELISA kit
E06C2086-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat crystallin, β A1 (CRYBA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat crystallin, β A1 (CRYBA1) ELISA kit
E06C2086-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat crystallin, β A1 (CRYBA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human crystallin, β A1 (CRYBA1) ELISA kit
E01C2086-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human crystallin, β A1 (CRYBA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human crystallin, β A1 (CRYBA1) ELISA kit
E01C2086-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human crystallin, β A1 (CRYBA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human crystallin, β A1 (CRYBA1) ELISA kit
E01C2086-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human crystallin, β A1 (CRYBA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat crystallin, β A1 (CRYBA1) ELISA kit
E02C2086-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat crystallin, β A1 (CRYBA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat crystallin, β A1 (CRYBA1) ELISA kit
E02C2086-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat crystallin, β A1 (CRYBA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat crystallin, β A1 (CRYBA1) ELISA kit
E02C2086-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat crystallin, β A1 (CRYBA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit crystallin, β A1 (CRYBA1) ELISA kit
E04C2086-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit crystallin, β A1 (CRYBA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit crystallin, β A1 (CRYBA1) ELISA kit
E04C2086-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit crystallin, β A1 (CRYBA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit crystallin, β A1 (CRYBA1) ELISA kit
E04C2086-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit crystallin, β A1 (CRYBA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog crystallin, β A1 (CRYBA1) ELISA kit
E08C2086-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine crystallin, β A1 (CRYBA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog crystallin, β A1 (CRYBA1) ELISA kit
E08C2086-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine crystallin, β A1 (CRYBA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog crystallin, β A1 (CRYBA1) ELISA kit
E08C2086-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine crystallin, β A1 (CRYBA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey crystallin, β A1 (CRYBA1) ELISA kit
E09C2086-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey crystallin, β A1 (CRYBA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey crystallin, β A1 (CRYBA1) ELISA kit
E09C2086-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey crystallin, β A1 (CRYBA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey crystallin, β A1 (CRYBA1) ELISA kit
E09C2086-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey crystallin, β A1 (CRYBA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig crystallin, β A1 (CRYBA1) ELISA kit
E07C2086-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine crystallin, β A1 (CRYBA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig crystallin, β A1 (CRYBA1) ELISA kit
E07C2086-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine crystallin, β A1 (CRYBA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig crystallin, β A1 (CRYBA1) ELISA kit
E07C2086-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine crystallin, β A1 (CRYBA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Crystallin Beta A1 (CRYbA1) Polyclonal Antibody (Mouse, Rat, Pig)
4-PAF342Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRYbA1 (Met1~Gln215)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat, Pig Crystallin Beta A1 (CRYbA1)
Guinea pig crystallin, β A1 (CRYBA1) ELISA kit
E05C2086-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig crystallin, β A1 (CRYBA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig crystallin, β A1 (CRYBA1) ELISA kit
E05C2086-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig crystallin, β A1 (CRYBA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig crystallin, β A1 (CRYBA1) ELISA kit
E05C2086-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig crystallin, β A1 (CRYBA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Crystallin Beta A1 (CRYbA1) Polyclonal Antibody (Mouse, Rat, Pig), APC
4-PAF342Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRYbA1 (Met1~Gln215)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat, Pig Crystallin Beta A1 (CRYbA1). This antibody is labeled with APC.
Crystallin Beta A1 (CRYbA1) Polyclonal Antibody (Mouse, Rat, Pig), Biotinylated
4-PAF342Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRYbA1 (Met1~Gln215)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat, Pig Crystallin Beta A1 (CRYbA1). This antibody is labeled with Biotin.
Crystallin Beta A1 (CRYbA1) Polyclonal Antibody (Mouse, Rat, Pig), Cy3
4-PAF342Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRYbA1 (Met1~Gln215)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat, Pig Crystallin Beta A1 (CRYbA1). This antibody is labeled with Cy3.
Crystallin Beta A1 (CRYbA1) Polyclonal Antibody (Mouse, Rat, Pig), FITC
4-PAF342Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRYbA1 (Met1~Gln215)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat, Pig Crystallin Beta A1 (CRYbA1). This antibody is labeled with FITC.
Crystallin Beta A1 (CRYbA1) Polyclonal Antibody (Mouse, Rat, Pig), HRP
4-PAF342Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRYbA1 (Met1~Gln215)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat, Pig Crystallin Beta A1 (CRYbA1). This antibody is labeled with HRP.
Crystallin Beta A1 (CRYbA1) Polyclonal Antibody (Mouse, Rat, Pig), PE
4-PAF342Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRYbA1 (Met1~Gln215)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat, Pig Crystallin Beta A1 (CRYbA1). This antibody is labeled with PE.
Human Beta- crystallin A3, CRYBA1 ELISA KIT
ELI-10438h 96 Tests
EUR 824
Chicken Beta- crystallin A3, CRYBA1 ELISA KIT
ELI-25556c 96 Tests
EUR 928
Bovine Beta- crystallin A3, CRYBA1 ELISA KIT
ELI-09074b 96 Tests
EUR 928
Crystallin Beta A1 (CRYbA1) Polyclonal Antibody (Mouse, Rat, Pig), APC-Cy7
4-PAF342Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRYbA1 (Met1~Gln215)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat, Pig Crystallin Beta A1 (CRYbA1). This antibody is labeled with APC-Cy7.
Crystallin Beta A1 antibody
70R-2029 50 ug
EUR 467
Description: Rabbit polyclonal Crystallin Beta A1 antibody raised against the N terminal of CRYBA1
Crystallin Beta A1 Blocking Peptide
33R-5973 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CRYBA1 antibody, catalog no. 70R-2029
Cryba1/ Rat Cryba1 ELISA Kit
ELI-46667r 96 Tests
EUR 886
Mouse Beta- crystallin A4, Cryba4 ELISA KIT
ELI-10490m 96 Tests
EUR 865
Mouse Beta- crystallin B2, Crybb2 ELISA KIT
ELI-26113m 96 Tests
EUR 865
Mouse Beta- crystallin B3, Crybb3 ELISA KIT
ELI-26438m 96 Tests
EUR 865
Mouse Beta- crystallin S, Crygs ELISA KIT
ELI-09076m 96 Tests
EUR 865
Mouse Beta- crystallin B1, Crybb1 ELISA KIT
ELI-33761m 96 Tests
EUR 865
Mouse Beta- crystallin A2, Cryba2 ELISA KIT
ELI-31972m 96 Tests
EUR 865
Mouse Crystallin Beta B1 (CRYBB1) ELISA Kit
20-abx156975
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Mouse Crystallin Beta B2 (CRYBB2) ELISA Kit
20-abx156976
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Mouse Crystallin Beta B2 ELISA Kit (CRYbB2)
RK02713 96 Tests
EUR 521
Mouse Crystallin Beta B1 (CRYbB1) ELISA Kit
SEF345Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta B1 (CRYbB1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta B1 (CRYbB1) in Tissue homogenates, cell lysates and other biological fluids.
Mouse Crystallin Beta B1 (CRYbB1) ELISA Kit
SEF345Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta B1 (CRYbB1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta B1 (CRYbB1) in Tissue homogenates, cell lysates and other biological fluids.
Mouse Crystallin Beta B1 (CRYbB1) ELISA Kit
SEF345Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta B1 (CRYbB1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta B1 (CRYbB1) in Tissue homogenates, cell lysates and other biological fluids.
Mouse Crystallin Beta B1 (CRYbB1) ELISA Kit
SEF345Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta B1 (CRYbB1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta B1 (CRYbB1) in Tissue homogenates, cell lysates and other biological fluids.
Mouse Crystallin Beta B1 (CRYbB1) ELISA Kit
4-SEF345Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Crystallin Beta B1 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Crystallin Beta B1 (CRYbB1) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Mouse Crystallin Beta B2 (CRYbB2) ELISA Kit
SEF346Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta B2 (CRYbB2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta B2 (CRYbB2) in tissue homogenates, cell lysates and other biological fluids.
Mouse Crystallin Beta B2 (CRYbB2) ELISA Kit
SEF346Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta B2 (CRYbB2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta B2 (CRYbB2) in tissue homogenates, cell lysates and other biological fluids.
Mouse Crystallin Beta B2 (CRYbB2) ELISA Kit
SEF346Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta B2 (CRYbB2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta B2 (CRYbB2) in tissue homogenates, cell lysates and other biological fluids.
Mouse Crystallin Beta B2 (CRYbB2) ELISA Kit
SEF346Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Crystallin Beta B2 (CRYbB2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Crystallin Beta B2 (CRYbB2) in tissue homogenates, cell lysates and other biological fluids.
Mouse Crystallin Beta B2 (CRYbB2) ELISA Kit
4-SEF346Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Crystallin Beta B2 elisa. Alternative names of the recognized antigen: CCA2
  • CRYB2
  • CRYB2A
  • Beta-crystallin Bp
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Crystallin Beta B2 (CRYbB2) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
Crygs ELISA Kit| Mouse Beta-crystallin S ELISA Kit
EF014554 96 Tests
EUR 689
ELISA kit for Mouse CRYbB1 (Crystallin Beta B1)
ELK7342 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Crystallin Beta B1 (CRY?B1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Crysta
  • Show more
Description: A sandwich ELISA kit for detection of Crystallin Beta B1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Mouse CRYbB2 (Crystallin Beta B2)
ELK7343 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Crystallin Beta B2 (CRY?B2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Crysta
  • Show more
Description: A sandwich ELISA kit for detection of Crystallin Beta B2 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Mouse Crystallin Beta B1 (CRYbB1) CLIA Kit
20-abx494873
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Mouse Crystallin Beta B2 (CRYbB2) CLIA Kit
20-abx494874
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Chicken Beta- crystallin A2, CRYBA2 ELISA KIT
ELI-10439c 96 Tests
EUR 928
Porcine Beta- crystallin B1, CRYBB1 ELISA KIT
ELI-10440p 96 Tests
EUR 928
Human Beta- crystallin B3, CRYBB3 ELISA KIT
ELI-10492h 96 Tests
EUR 824
Human Beta- crystallin B2, CRYBB2 ELISA KIT
ELI-25689h 96 Tests
EUR 824
Bovine Beta- crystallin A4, CRYBA4 ELISA KIT
ELI-26111b 96 Tests
EUR 928
Human Beta- crystallin A2, CRYBA2 ELISA KIT
ELI-26435h 96 Tests
EUR 824
Bovine Beta- crystallin B2, CRYBB2 ELISA KIT
ELI-26436b 96 Tests
EUR 928
Chicken Beta- crystallin B2, CRYBB2 ELISA KIT
ELI-26437c 96 Tests
EUR 928
Human Beta- crystallin S, CRYGS ELISA KIT
ELI-26440h 96 Tests
EUR 824
Human Beta- crystallin A4, CRYBA4 ELISA KIT
ELI-09075h 96 Tests
EUR 824
Rabbit Beta- crystallin S, CRYGS ELISA KIT
ELI-09077Ra 96 Tests
EUR 928
Bovine Beta- crystallin B3, CRYBB3 ELISA KIT
ELI-09324b 96 Tests
EUR 928
Rabbit Beta- crystallin B2, CRYBB2 ELISA KIT
ELI-33745Ra 96 Tests
EUR 928
Human Beta- crystallin B1, CRYBB1 ELISA KIT
ELI-33760h 96 Tests
EUR 824
Rabbit Beta- crystallin A2, CRYBA2 ELISA KIT
ELI-46668Ra 96 Tests
EUR 928
Bovine Beta- crystallin A2, CRYBA2 ELISA KIT
ELI-31971b 96 Tests
EUR 928
Bovine Beta- crystallin B1, CRYBB1 ELISA KIT
ELI-31973b 96 Tests
EUR 928
Chicken Beta- crystallin B1, CRYBB1 ELISA KIT
ELI-31974c 96 Tests
EUR 928
Chicken Beta- crystallin B3, CRYBB3 ELISA KIT
ELI-31975c 96 Tests
EUR 928
Chicken Beta- crystallin A4, CRYBA4 ELISA KIT
ELI-50470c 96 Tests
EUR 928
Bovine Beta- crystallin S, CRYGS ELISA KIT
ELI-50472b 96 Tests
EUR 928
Rat Crystallin Beta B2 (CRYBB2) ELISA Kit
20-abx258828
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Crystallin Beta B2 (CRYBB2) ELISA Kit
20-abx258829
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Crystallin Beta A2 (CRYBA2) ELISA Kit
abx386685-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Crystallin Beta B1 (CRYBB1) ELISA Kit
abx386686-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Crystallin Beta B3 (CRYBB3) ELISA Kit
abx386688-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Crystallin Beta B2 (CRYbB2) ELISA Kit
SEF346Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Crystallin Beta B2 (CRYbB2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Crystallin Beta B2 (CRYbB2) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Crystallin Beta B2 (CRYbB2) ELISA Kit
SEF346Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Crystallin Beta B2 (CRYbB2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Crystallin Beta B2 (CRYbB2) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Crystallin Beta B2 (CRYbB2) ELISA Kit
SEF346Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Crystallin Beta B2 (CRYbB2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Crystallin Beta B2 (CRYbB2) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Crystallin Beta B2 (CRYbB2) ELISA Kit
SEF346Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Crystallin Beta B2 (CRYbB2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Crystallin Beta B2 (CRYbB2) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Crystallin Beta B2 (CRYbB2) ELISA Kit
4-SEF346Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Crystallin Beta B2 elisa. Alternative names of the recognized antigen: CCA2
  • CRYB2
  • CRYB2A
  • Beta-crystallin Bp
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Crystallin Beta B2 (CRYbB2) in samples from tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.
Rat Crystallin Beta B2 (CRYbB2) ELISA Kit
SEF346Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Crystallin Beta B2 (CRYbB2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Crystallin Beta B2 (CRYbB2) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Rat Crystallin Beta B2 (CRYbB2) ELISA Kit
SEF346Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Crystallin Beta B2 (CRYbB2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Crystallin Beta B2 (CRYbB2) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Rat Crystallin Beta B2 (CRYbB2) ELISA Kit
SEF346Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Crystallin Beta B2 (CRYbB2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Crystallin Beta B2 (CRYbB2) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Rat Crystallin Beta B2 (CRYbB2) ELISA Kit
SEF346Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Crystallin Beta B2 (CRYbB2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Crystallin Beta B2 (CRYbB2) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Rat Crystallin Beta B2 (CRYbB2) ELISA Kit
4-SEF346Ra
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Crystallin Beta B2 elisa. Alternative names of the recognized antigen: CCA2
  • CRYB2
  • CRYB2A
  • Beta-crystallin Bp
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Crystallin Beta B2 (CRYbB2) in samples from tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.
Crygs ELISA Kit| Rat Beta-crystallin S ELISA Kit
EF018509 96 Tests
EUR 689
CRYGS ELISA Kit| Bovine Beta-crystallin S ELISA Kit
EF011257 96 Tests
EUR 689
Mouse Crystallin Beta B2 (CRYbB2) Protein
20-abx066156
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Mouse Crystallin Beta B1 (CRYbB1) Protein
20-abx167368
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Crystallin beta B1 Protein
20-abx260553
  • EUR 2861.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 25 ug
  • 5 ug
  • Shipped within 5-10 working days.
Crystallin beta A4 Protein
20-abx260794
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
Crystallin Beta B3 antibody
70R-2830 50 ug
EUR 467
Description: Rabbit polyclonal Crystallin Beta B3 antibody raised against the middle region of CRYBB3
Beta-crystallin A4 antibody
22987-100ul 100ul
EUR 390
beta A4 Crystallin antibody
70R-13284 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal beta A4 Crystallin antibody
anti-Beta crystallin S
YF-PA11110 50 ul
EUR 363
Description: Mouse polyclonal to Beta crystallin S
anti-Beta crystallin S
YF-PA11111 50 ug
EUR 363
Description: Mouse polyclonal to Beta crystallin S
anti-beta Crystallin A3
YF-PA23513 50 ul
EUR 334
Description: Mouse polyclonal to beta Crystallin A3
anti-beta B1 Crystallin
YF-PA23515 50 ul
EUR 334
Description: Mouse polyclonal to beta B1 Crystallin
ELISA kit for Human CRYbB2 (Crystallin Beta B2)
ELK5598 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Crystallin Beta B2 (CRY?B2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Crysta
  • Show more
Description: A sandwich ELISA kit for detection of Crystallin Beta B2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Rat CRYbB2 (Crystallin Beta B2)
ELK7809 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Crystallin Beta B2 (CRY?B2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Crysta
  • Show more
Description: A sandwich ELISA kit for detection of Crystallin Beta B2 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
CRYBA1 Recombinant Protein (Mouse)
RP126149 100 ug Ask for price
Mouse apolipoprotein A1(Apo-A1) ELISA Kit
CSB-E08104m-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse apolipoprotein A1 (Apo-A1) in samples from serum, plasma, cell culture supernates, urine, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Mouse apolipoprotein A1(Apo-A1) ELISA Kit
1-CSB-E08104m
  • EUR 946.00
  • EUR 5782.00
  • EUR 3060.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse apolipoprotein A1(Apo-A1) in samples from serum, plasma, cell culture supernates, urine, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Mouse apoprotein A1(apo-A1)ELISA Kit
QY-E20155 96T
EUR 361
Mouse a1-MG(a1-Microglobulin)ELISA Kit
STJ150328 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of a1-MG in Mouse serum, plasma and other biological fluids
CRYBA1 siRNA
20-abx912866
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CRYBA1 siRNA
20-abx912867
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CRYBA1 Antibody
1-CSB-PA006009LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CRYBA1. Recognizes CRYBA1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:1000-1:5000, IF:1:50-1:200
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202
Crystallin Beta B1 (CRYBB1) Antibody
20-abx111823
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Crystallin Beta B3 (CRYBB3) Antibody
20-abx111824
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Crystallin Beta B1 (CRYbB1) Antibody
20-abx129440
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Crystallin Beta B2 (CRYBB2) Antibody
20-abx000083
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Crystallin Beta B3 (CRYBB3) Antibody
abx145035-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Crystallin Beta B1 (CRYBB1) Antibody
abx145066-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Crystallin Beta A2 (CRYBA2) Antibody
abx145550-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Crystallin Beta B2 (CRYbB2) Antibody
20-abx132152
  • EUR 356.00
  • EUR 133.00
  • EUR 1024.00
  • EUR 509.00
  • EUR 300.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.
Crystallin Beta B1 (CRYbB1) Antibody
20-abx102005
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Crystallin Beta B2 (CRYbB2) Antibody
20-abx102006
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Crystallin Beta B2 (CRYbB2) Antibody
20-abx102007
  • EUR 356.00
  • EUR 913.00
  • EUR 467.00
  • EUR 154.00
  • EUR 272.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.
Crystallin Beta B1 (CRYBB1) Antibody
20-abx322355
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Crystallin Beta A2 (CRYBA2) Antibody
abx232000-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Crystallin Beta B1 (CRYBB1) Antibody
abx232001-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Crystallin Beta B1 (CRYBB1) Antibody
abx232002-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Crystallin Beta B2 (CRYBB2) Antibody
abx232003-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Crystallin Beta B3 (CRYBB3) Antibody
abx232004-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Recombinant Human Crystallin Beta B1
7-06919 5µg Ask for price
Recombinant Human Crystallin Beta B1
7-06920 25µg Ask for price
Recombinant Human Crystallin Beta B1
7-06921 1mg Ask for price
Recombinant Human Crystallin Beta A4
7-06922 5µg Ask for price
Recombinant Human Crystallin Beta A4
7-06923 20µg Ask for price
Recombinant Human Crystallin Beta A4
7-06924 1mg Ask for price
Crystallin Beta B3 Blocking Peptide
33R-5223 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CRYBB3 antibody, catalog no. 70R-2830
Human beta B1 Crystallin Antibody
33007-05111 150 ug
EUR 261
Human Beta-crystallin S (CRYGS
1-CSB-EP006025HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 47.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Beta-crystallin S(CRYGS expressed in E.coli
Recombinant Crystallin Beta B1 (CRYbB1)
4-RPF345Mu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9WVJ5
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 49.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Crystallin Beta B1 expressed in: E.coli
Recombinant Crystallin Beta B1 (CRYbB1)
4-RPF345Ra01
  • EUR 404.64
  • EUR 211.00
  • EUR 1242.40
  • EUR 480.80
  • EUR 861.60
  • EUR 334.00
  • EUR 2956.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 21.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Crystallin Beta B1 expressed in: E.coli
Recombinant Crystallin Beta B2 (CRYbB2)
4-RPF346Mu01
  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P62696
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 21.3kDa
  • Isoelectric Point: 6.6
Description: Recombinant Mouse Crystallin Beta B2 expressed in: E.coli
Recombinant Crystallin Beta B2 (CRYbB2)
4-RPF346Ra01
  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 21.3kDa
  • Isoelectric Point: 6.4
Description: Recombinant Rat Crystallin Beta B2 expressed in: E.coli
Anti-Beta crystallin S Antibody
STJ500306 100 µg
EUR 476
Anti-Beta crystallin S Antibody
STJ500307 100 µg
EUR 476
Anti-beta B1 Crystallin (2B2)
YF-MA12542 100 ug
EUR 363
Description: Mouse monoclonal to beta B1 Crystallin
Anti-beta B1 Crystallin (3D9)
YF-MA12543 100 ug
EUR 363
Description: Mouse monoclonal to beta B1 Crystallin
Human Crystallin Beta B2 (CRYbB2) CLIA Kit
20-abx496401
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Rat Crystallin Beta B2 (CRYbB2) CLIA Kit
20-abx496506
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Mouse Alpha B Crystallin ELISA kit
E03C0343-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Alpha B Crystallin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Alpha B Crystallin ELISA kit
E03C0343-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Alpha B Crystallin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Alpha B Crystallin ELISA kit
E03C0343-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Alpha B Crystallin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Cryba1 ORF Vector (Mouse) (pORF)
ORF042051 1.0 ug DNA
EUR 506
Mouse Ephrin A1 ELISA kit
E03E0042-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Ephrin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Ephrin A1 ELISA kit
E03E0042-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Ephrin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Ephrin A1 ELISA kit
E03E0042-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Ephrin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Immunoglobulin A1 ELISA kit
E03I0016-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Immunoglobulin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Immunoglobulin A1 ELISA kit
E03I0016-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Immunoglobulin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Immunoglobulin A1 ELISA kit
E03I0016-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Immunoglobulin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Annexin A1 ELISA kit
E03A0208-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Annexin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Annexin A1 ELISA kit
E03A0208-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Annexin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Annexin A1 ELISA kit
E03A0208-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Annexin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Apolipoprotein A1 ELISA kit
E03A0509-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Apolipoprotein A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Apolipoprotein A1 ELISA kit
E03A0509-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Apolipoprotein A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Apolipoprotein A1 ELISA kit
E03A0509-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Apolipoprotein A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse a1 microglobulin ELISA kit
E03A0689-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse a1 microglobulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse a1 microglobulin ELISA kit
E03A0689-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse a1 microglobulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse a1 microglobulin ELISA kit
E03A0689-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse a1 microglobulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Phospholipase A1 ELISA kit
E03P0124-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Phospholipase A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Phospholipase A1 ELISA kit
E03P0124-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Phospholipase A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Phospholipase A1 ELISA kit
E03P0124-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Phospholipase A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse A1-AGP ELISA Kit
EMA0695 96Tests
EUR 521
Mouse A1-MG ELISA Kit
EMA0696 96Tests
EUR 521
Mouse Apo-A1 ELISA Kit
EMA0851 96Tests
EUR 521
Crystallin Beta B1 (CRYbB1) Polyclonal Antibody (Mouse, Rat)
4-PAF345Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRYbB1 (Lys6~Val186)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Crystallin Beta B1 (CRYbB1)
Crystallin Beta B2 (CRYbB2) Polyclonal Antibody (Mouse, Rat)
4-PAF346Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRYbB2 (Pro17~Arg191)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Crystallin Beta B2 (CRYbB2)
CRYBA1 cloning plasmid
CSB-CL006009HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 648
  • Sequence: atggagacccaggctgagcagcaggagctggaaacccttccaaccaccaagatggctcagaccaaccctacgccggggtccctggggccatggaagataaccatctatgatcaggagaactttcagggcaagaggatggagttcaccagctcctgtccaaatgtctctgagcgcag
  • Show more
Description: A cloning plasmid for the CRYBA1 gene.
CRYBA1 Polyclonal Antibody
A62338 100 µg
EUR 570.55
Description: reagents widely cited
CRYBA1 Rabbit pAb
A15267-100ul 100 ul
EUR 308
CRYBA1 Rabbit pAb
A15267-200ul 200 ul
EUR 459
CRYBA1 Rabbit pAb
A15267-20ul 20 ul
EUR 183
CRYBA1 Rabbit pAb
A15267-50ul 50 ul
EUR 223
CRYBA1 Polyclonal Antibody
28894-100ul 100ul
EUR 252
CRYBA1 Polyclonal Antibody
28894-50ul 50ul
EUR 187
Anti-CRYBA1 antibody
STJ117462 100 µl
EUR 277
Description: Crystallins are separated into two classes: taxon-specific, or enzyme, and ubiquitous. The latter class constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. Since lens central fiber cells lose their nuclei during development, these crystallins are made and then retained throughout life, making them extremely stable proteins. Mammalian lens crystallins are divided into alpha, beta, and gamma families; beta and gamma crystallins are also considered as a superfamily. Alpha and beta families are further divided into acidic and basic groups. Seven protein regions exist in crystallins: four homologous motifs, a connecting peptide, and N- and C-terminal extensions. Beta-crystallins, the most heterogeneous, differ by the presence of the C-terminal extension (present in the basic group, none in the acidic group). Beta-crystallins form aggregates of different sizes and are able to self-associate to form dimers or to form heterodimers with other beta-crystallins. This gene, a beta acidic group member, encodes two proteins (crystallin, beta A3 and crystallin, beta A1) from a single mRNA, the latter protein is 17 aa shorter than crystallin, beta A3 and is generated by use of an alternate translation initiation site. Deletion of exons 3 and 4 causes the autosomal dominant disease 'zonular cataract with sutural opacities'.
Mouse anti-apolipoprotein A1(Apo-A1)antibody ELISA kit
E03A2043-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse anti-apolipoprotein A1(Apo-A1)antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse anti-apolipoprotein A1(Apo-A1)antibody ELISA kit
E03A2043-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse anti-apolipoprotein A1(Apo-A1)antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse anti-apolipoprotein A1(Apo-A1)antibody ELISA kit
E03A2043-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse anti-apolipoprotein A1(Apo-A1)antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Crystallin Beta B2 (CRYbB2) Protein
20-abx652230
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Rat Crystallin Beta B1 (CRYbB1) Protein
20-abx066155
  • EUR 578.00
  • EUR 258.00
  • EUR 1678.00
  • EUR 676.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Crystallin Beta B2 (CRYbB2) Antibody (Biotin)
20-abx273014
  • EUR 467.00
  • EUR 244.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Crystallin Beta B1 (CRYbB1) Antibody (Biotin)
20-abx273350
  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Anti-Beta crystallin S Antibody BIOTIN
STJ500308 100 µg
EUR 586
Anti-Beta crystallin S Antibody FITC
STJ500309 100 µg
EUR 586
Anti-Beta crystallin S Antibody BIOTIN
STJ500310 100 µg
EUR 586
Anti-Beta crystallin S Antibody FITC
STJ500311 100 µg
EUR 586
Mouse Gamma-crystallin D (Crygd) ELISA Kit
abx556044-96tests 96 tests
EUR 668
  • Shipped within 1-3 weeks.
Mouse Lambda crystallin homolog(CRYL1) ELISA kit
E03L0316-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Lambda crystallin homolog(CRYL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Lambda crystallin homolog(CRYL1) ELISA kit
E03L0316-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Lambda crystallin homolog(CRYL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Lambda crystallin homolog(CRYL1) ELISA kit
E03L0316-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Lambda crystallin homolog(CRYL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse β crystallin A2(CRYBA2) ELISA kit
E03B0889-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin A2(CRYBA2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse β crystallin A2(CRYBA2) ELISA kit
E03B0889-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin A2(CRYBA2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse β crystallin A2(CRYBA2) ELISA kit
E03B0889-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin A2(CRYBA2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse β crystallin A4(CRYBA4) ELISA kit
E03B0890-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin A4(CRYBA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse β crystallin A4(CRYBA4) ELISA kit
E03B0890-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin A4(CRYBA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse β crystallin A4(CRYBA4) ELISA kit
E03B0890-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin A4(CRYBA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse β crystallin B1(CRYBB1) ELISA kit
E03B0891-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin B1(CRYBB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse β crystallin B1(CRYBB1) ELISA kit
E03B0891-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin B1(CRYBB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse β crystallin B1(CRYBB1) ELISA kit
E03B0891-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin B1(CRYBB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse β crystallin B2(CRYBB2) ELISA kit
E03B0892-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin B2(CRYBB2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse β crystallin B2(CRYBB2) ELISA kit
E03B0892-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin B2(CRYBB2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse β crystallin B2(CRYBB2) ELISA kit
E03B0892-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin B2(CRYBB2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse β crystallin B3(CRYBB3) ELISA kit
E03B0893-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin B3(CRYBB3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse β crystallin B3(CRYBB3) ELISA kit
E03B0893-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin B3(CRYBB3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse β crystallin B3(CRYBB3) ELISA kit
E03B0893-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin B3(CRYBB3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse β crystallin S(CRYGS) ELISA kit
E03B0895-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse β crystallin S(CRYGS) ELISA kit
E03B0895-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse β crystallin S(CRYGS) ELISA kit
E03B0895-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β crystallin S(CRYGS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Gamma- crystallin E, Cryge ELISA KIT
ELI-10114m 96 Tests
EUR 865
Mouse Gamma- crystallin A, Cryga ELISA KIT
ELI-25517m 96 Tests
EUR 865
Mouse Gamma- crystallin B, Crygb ELISA KIT
ELI-25694m 96 Tests
EUR 865
Mouse Gamma- crystallin D, Crygd ELISA KIT
ELI-26464m 96 Tests
EUR 865
Mouse Lambda- crystallin homolog, Cryl1 ELISA KIT
ELI-26469m 96 Tests
EUR 865
Mouse Gamma- crystallin C, Crygc ELISA KIT
ELI-46664m 96 Tests
EUR 865
Mouse Gamma- crystallin F, Crygf ELISA KIT
ELI-31981m 96 Tests
EUR 865
Mouse Gamma- crystallin N, Crygn ELISA KIT
ELI-32335m 96 Tests
EUR 865
Mouse Crystallin Gamma S (CRYGS) ELISA Kit
20-abx156977
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Mouse Crystallin Gamma F (CRYGF) ELISA Kit
20-abx156978
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Mouse Crystallin alpha B (CRYaB) ELISA Kit
20-abx153876