Mouse MSMb(Microseminoprotein Beta) ELISA Kit

Mouse MSMb(Microseminoprotein Beta) ELISA Kit

To Order Contact us: Mark@operatiebrp.nl

Mouse Microseminoprotein Beta (MSMb) ELISA Kit
RDR-MSMb-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Microseminoprotein Beta (MSMb) ELISA Kit
RDR-MSMb-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Mouse Microseminoprotein Beta (MSMb) ELISA Kit
RD-MSMb-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Microseminoprotein Beta (MSMb) ELISA Kit
RD-MSMb-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Human Microseminoprotein Beta (MSMb) ELISA Kit
DLR-MSMb-Hu-48T	DL Develop	48T	EUR 517
Should the Human Microseminoprotein Beta (MSMb) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Microseminoprotein Beta (MSMb) in samples from serum, plasma, seminal plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Microseminoprotein Beta (MSMb) ELISA Kit
DLR-MSMb-Hu-96T	DL Develop	96T	EUR 673
Should the Human Microseminoprotein Beta (MSMb) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Microseminoprotein Beta (MSMb) in samples from serum, plasma, seminal plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Microseminoprotein Beta (MSMb) ELISA Kit
RDR-MSMb-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Microseminoprotein Beta (MSMb) ELISA Kit
RDR-MSMb-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Microseminoprotein Beta (MSMb) ELISA Kit
RD-MSMb-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Microseminoprotein Beta (MSMb) ELISA Kit
RD-MSMb-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Mouse Microseminoprotein beta (MSMb) ELISA Kit
20-abx154407	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Msmb/ Beta-microseminoprotein ELISA Kit
E0972Mo	Sunlong	1 Kit	EUR 632

Mouse Beta- microseminoprotein, Msmb ELISA KIT
ELI-07505m	Lifescience Market	96 Tests	EUR 865

Mouse Beta-Microseminoprotein (MSMB) ELISA Kit
abx571578-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Mouse Microseminoprotein Beta (MSMb) ELISA Kit
SEC628Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Microseminoprotein Beta (MSMb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Microseminoprotein Beta (MSMb) in serum, plasma and other biological fluids.

Mouse Microseminoprotein Beta (MSMb) ELISA Kit
SEC628Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Microseminoprotein Beta (MSMb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Microseminoprotein Beta (MSMb) in serum, plasma and other biological fluids.

Mouse Microseminoprotein Beta (MSMb) ELISA Kit
SEC628Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Microseminoprotein Beta (MSMb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Microseminoprotein Beta (MSMb) in serum, plasma and other biological fluids.

Mouse Microseminoprotein Beta (MSMb) ELISA Kit
SEC628Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Microseminoprotein Beta (MSMb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Microseminoprotein Beta (MSMb) in serum, plasma and other biological fluids.

Mouse Microseminoprotein Beta (MSMb) ELISA Kit
4-SEC628Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Microseminoprotein Beta elisa. Alternative names of the recognized antigen: MSM-B IGBF MSP MSPB PN44 PRPS PSP PSP57 PSP94 Immunoglobulin-binding factor Prostate secreted seminal plasma protein plasma beta-inhibin
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Microseminoprotein Beta (MSMb) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Microseminoprotein Beta (MSMb) Protein
20-abx167381	Abbexa	EUR 704.00 EUR 286.00 EUR 2151.00 EUR 829.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Microseminoprotein Beta (MSMb) Antibody
20-abx177557	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Microseminoprotein Beta (MSMB) Antibody
20-abx211136	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Microseminoprotein Beta (MSMB) Antibody
20-abx211250	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Microseminoprotein Beta (MSMb) Antibody
20-abx102392	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Microseminoprotein Beta (MSMB) Antibody
20-abx113736	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Microseminoprotein Beta (MSMb) Antibody
20-abx129875	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Microseminoprotein Beta (MSMB) Antibody
20-abx136010	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Microseminoprotein Beta (MSMb) Antibody
20-abx173566	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Microseminoprotein Beta (MSMB) Antibody
20-abx333960	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Microseminoprotein Beta (MSMB) Antibody
20-abx225295	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Microseminoprotein Beta (MSMB) Protein
20-abx263042	Abbexa	EUR 328.00 EUR 7358.00 EUR 230.00	10 ug 1 mg 2 µg
Shipped within 5-10 working days.

Recombinant Microseminoprotein Beta (MSMb)
4-RPC628Hu01	Cloud-Clone	EUR 458.40 EUR 226.00 EUR 1444.00 EUR 548.00 EUR 996.00 EUR 370.00 EUR 3460.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P08118 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 16.7kDa Isoelectric Point: 5.6
Description: Recombinant Human Microseminoprotein Beta expressed in: E.coli

Recombinant Microseminoprotein Beta (MSMb)
4-RPC628Mu01	Cloud-Clone	EUR 499.62 EUR 236.00 EUR 1598.56 EUR 599.52 EUR 1099.04 EUR 397.00 EUR 3846.40	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O08540 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 40.7kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Microseminoprotein Beta expressed in: E.coli

Mouse Microseminoprotein beta (MSMb) CLIA Kit
20-abx493808	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Mouse MSMb (Microseminoprotein Beta)
ELK6939	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Microseminoprotein Beta (MSM?). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Mic Show more
Description: A sandwich ELISA kit for detection of Microseminoprotein Beta from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Rat Msmb/ Beta-microseminoprotein ELISA Kit
E0637Ra	Sunlong	1 Kit	EUR 646

Human Microseminoprotein beta (MSMb) ELISA Kit
20-abx152383	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Microseminoprotein Beta (MSMb) ELISA Kit
abx251632-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Human MSMB(Beta-microseminoprotein) ELISA Kit
EH2282	FN Test	96T	EUR 524.1
Detection range: 15.625-1000 pg/ml Uniprot ID: P08118 Alias: MSMB/PSP94/IGBF/MSPB/PIP/PN44/PRPS/PSP57
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml

Human MSMB/ Beta-microseminoprotein ELISA Kit
E1638Hu	Sunlong	1 Kit	EUR 605

Porcine Beta- microseminoprotein, MSMB ELISA KIT
ELI-07504p	Lifescience Market	96 Tests	EUR 928

Human Beta- microseminoprotein, MSMB ELISA KIT
ELI-07506h	Lifescience Market	96 Tests	EUR 824

Monkey Microseminoprotein Beta (MSMb) ELISA Kit
abx359299-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Pig Microseminoprotein Beta (MSMb) ELISA Kit
abx361087-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Microseminoprotein Beta (MSMb) ELISA Kit
abx362965-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Chicken Microseminoprotein Beta (MSMb) ELISA Kit
abx356068-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Sheep Microseminoprotein Beta (MSMb) ELISA Kit
abx364138-96tests	Abbexa	96 tests	EUR 926
Shipped within 5-12 working days.

Human Beta-Microseminoprotein (MSMB) ELISA Kit
abx574902-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Pig Beta-Microseminoprotein (MSMB) ELISA Kit
abx520327-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rat Beta-Microseminoprotein (MSMB) ELISA Kit
abx520328-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Microseminoprotein Beta(MSMb)ELISA Kit
QY-E01085	Qayee Biotechnology	96T	EUR 361

Human Microseminoprotein Beta (MSMb) ELISA Kit
SEC628Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Microseminoprotein Beta (MSMb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Microseminoprotein Beta (MSMb) in serum, plasma, seminal plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Microseminoprotein Beta (MSMb) ELISA Kit
SEC628Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Microseminoprotein Beta (MSMb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Microseminoprotein Beta (MSMb) in serum, plasma, seminal plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Microseminoprotein Beta (MSMb) ELISA Kit
SEC628Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Microseminoprotein Beta (MSMb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Microseminoprotein Beta (MSMb) in serum, plasma, seminal plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Microseminoprotein Beta (MSMb) ELISA Kit
SEC628Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Microseminoprotein Beta (MSMb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Microseminoprotein Beta (MSMb) in serum, plasma, seminal plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Microseminoprotein Beta (MSMb) ELISA Kit
4-SEC628Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Microseminoprotein Beta elisa. Alternative names of the recognized antigen: MSM-B IGBF MSP MSPB PN44 PRPS PSP PSP57 PSP94 Immunoglobulin-binding factor Prostate secreted seminal plasma protein plasma beta-inhibin
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Microseminoprotein Beta (MSMb) in samples from Serum, plasma, seminal plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Microseminoprotein Beta (MSMb) Polyclonal Antibody (Mouse)
4-PAC628Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MSMb (Val21-Met113) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microseminoprotein Beta (MSMb)

ELISA kit for Human MSMb (Microseminoprotein Beta)
ELK3501	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Microseminoprotein Beta (MSM?). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Mic Show more
Description: A sandwich ELISA kit for detection of Microseminoprotein Beta from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Beta-microseminoprotein (MSMB/PRSP) ELISA kit
CSB-E17126h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Beta-microseminoprotein (MSMB/PRSP) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Beta-microseminoprotein (MSMB/PRSP) ELISA kit
1-CSB-E17126h	Cusabio	EUR 900.00 EUR 5476.00 EUR 2900.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Beta-microseminoprotein (MSMB/PRSP) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Guinea pig Microseminoprotein Beta (MSMb) ELISA Kit
abx358166-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Microseminoprotein Beta (MSMb) Protein
20-abx068011	Abbexa	EUR 648.00 EUR 272.00 EUR 1943.00 EUR 759.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Microseminoprotein Beta (MSMb) Antibody (Biotin)
20-abx272286	Abbexa	EUR 453.00 EUR 244.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Microseminoprotein Beta (MSMB) Antibody (HRP)
20-abx334839	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Microseminoprotein Beta (MSMB) Antibody (FITC)
20-abx334840	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Microseminoprotein Beta (MSMB) Antibody (Biotin)
20-abx334841	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Microseminoprotein Beta (MSMb) Antibody Pair
20-abx370275	Abbexa	EUR 1748.00 EUR 1121.00	10 × 96 tests 5 × 96 tests
Shipped within 5-15 working days.

Microseminoprotein Beta (MSMb) Antibody (FITC)
20-abx273626	Abbexa	EUR 481.00 EUR 244.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Human Microseminoprotein Beta (MSMb) CLIA Kit
abx197287-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Microseminoprotein beta (MSMb) CLIA Kit
20-abx493807	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Mouse Î² microseminoprotein(MSMB) ELISA kit
E03B0949-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Î² microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Î² microseminoprotein(MSMB) ELISA kit
E03B0949-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Î² microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Î² microseminoprotein(MSMB) ELISA kit
E03B0949-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Î² microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Microseminoprotein Beta (MSMb) Polyclonal Antibody (Mouse), APC
4-PAC628Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MSMb (Val21-Met113) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microseminoprotein Beta (MSMb). This antibody is labeled with APC.

Microseminoprotein Beta (MSMb) Polyclonal Antibody (Mouse), Biotinylated
4-PAC628Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MSMb (Val21-Met113) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microseminoprotein Beta (MSMb). This antibody is labeled with Biotin.

Microseminoprotein Beta (MSMb) Polyclonal Antibody (Mouse), Cy3
4-PAC628Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MSMb (Val21-Met113) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microseminoprotein Beta (MSMb). This antibody is labeled with Cy3.

Microseminoprotein Beta (MSMb) Polyclonal Antibody (Mouse), FITC
4-PAC628Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MSMb (Val21-Met113) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microseminoprotein Beta (MSMb). This antibody is labeled with FITC.

Microseminoprotein Beta (MSMb) Polyclonal Antibody (Mouse), HRP
4-PAC628Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MSMb (Val21-Met113) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microseminoprotein Beta (MSMb). This antibody is labeled with HRP.

Microseminoprotein Beta (MSMb) Polyclonal Antibody (Mouse), PE
4-PAC628Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MSMb (Val21-Met113) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microseminoprotein Beta (MSMb). This antibody is labeled with PE.

Microseminoprotein Beta (MSMb) Polyclonal Antibody (Human)
4-PAC628Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MSMb (Asn19~Ile114) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Microseminoprotein Beta (MSMb)

MSMB Beta-Microseminoprotein Human Recombinant Protein
PROTP08118	BosterBio	Regular: 10ug	EUR 317
Description: MSMB Recombinant Human produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 104 amino acids and having a molecular mass of 12 kDa. ;The MSMB is fused to His tag at N-Terminus.;The Human MSMB is purified by proprietary chromatographic techniques.

Microseminoprotein Beta (MSMb) Polyclonal Antibody (Mouse), APC-Cy7
4-PAC628Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MSMb (Val21-Met113) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microseminoprotein Beta (MSMb). This antibody is labeled with APC-Cy7.

Human Î² microseminoprotein(MSMB) ELISA kit
E01B0949-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Î² microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Î² microseminoprotein(MSMB) ELISA kit
E01B0949-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Î² microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Î² microseminoprotein(MSMB) ELISA kit
E01B0949-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Î² microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Î² microseminoprotein(MSMB) ELISA kit
E06B0949-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Î² microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Î² microseminoprotein(MSMB) ELISA kit
E06B0949-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Î² microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Î² microseminoprotein(MSMB) ELISA kit
E06B0949-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Î² microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Î² microseminoprotein(MSMB) ELISA kit
E04B0949-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Î² microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Î² microseminoprotein(MSMB) ELISA kit
E04B0949-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Î² microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Î² microseminoprotein(MSMB) ELISA kit
E04B0949-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Î² microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Î² microseminoprotein(MSMB) ELISA kit
E02B0949-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Î² microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Î² microseminoprotein(MSMB) ELISA kit
E02B0949-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Î² microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Î² microseminoprotein(MSMB) ELISA kit
E02B0949-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Î² microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Î² microseminoprotein(MSMB) ELISA kit
E09B0949-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Î² microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Î² microseminoprotein(MSMB) ELISA kit
E09B0949-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Î² microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Î² microseminoprotein(MSMB) ELISA kit
E09B0949-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Î² microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Î² microseminoprotein(MSMB) ELISA kit
E08B0949-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Î² microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Î² microseminoprotein(MSMB) ELISA kit
E08B0949-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Î² microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Î² microseminoprotein(MSMB) ELISA kit
E08B0949-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Î² microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Î² microseminoprotein(MSMB) ELISA kit
E07B0949-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Î² microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Î² microseminoprotein(MSMB) ELISA kit
E07B0949-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Î² microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Î² microseminoprotein(MSMB) ELISA kit
E07B0949-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Î² microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Microseminoprotein Beta (MSMb) Polyclonal Antibody (Human), APC
4-PAC628Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MSMb (Asn19~Ile114) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Microseminoprotein Beta (MSMb). This antibody is labeled with APC.

Microseminoprotein Beta (MSMb) Polyclonal Antibody (Human), Biotinylated
4-PAC628Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MSMb (Asn19~Ile114) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Microseminoprotein Beta (MSMb). This antibody is labeled with Biotin.

Microseminoprotein Beta (MSMb) Polyclonal Antibody (Human), Cy3
4-PAC628Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MSMb (Asn19~Ile114) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Microseminoprotein Beta (MSMb). This antibody is labeled with Cy3.

Microseminoprotein Beta (MSMb) Polyclonal Antibody (Human), FITC
4-PAC628Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MSMb (Asn19~Ile114) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Microseminoprotein Beta (MSMb). This antibody is labeled with FITC.

Microseminoprotein Beta (MSMb) Polyclonal Antibody (Human), HRP
4-PAC628Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MSMb (Asn19~Ile114) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Microseminoprotein Beta (MSMb). This antibody is labeled with HRP.

Microseminoprotein Beta (MSMb) Polyclonal Antibody (Human), PE
4-PAC628Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MSMb (Asn19~Ile114) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Microseminoprotein Beta (MSMb). This antibody is labeled with PE.

Guinea pig Î² microseminoprotein(MSMB) ELISA kit
E05B0949-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Î² microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Î² microseminoprotein(MSMB) ELISA kit
E05B0949-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Î² microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Î² microseminoprotein(MSMB) ELISA kit
E05B0949-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Î² microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Microseminoprotein Beta (MSMb) Polyclonal Antibody (Human), APC-Cy7
4-PAC628Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MSMb (Asn19~Ile114) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Microseminoprotein Beta (MSMb). This antibody is labeled with APC-Cy7.

ELISA kit for Human Beta-microseminoprotein
EK4612	SAB	96 tests	EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Beta-microseminoprotein in samples from serum, plasma, tissue homogenates and other biological fluids.

Msmb/ Rat Msmb ELISA Kit
ELI-07507r	Lifescience Market	96 Tests	EUR 886

ELISA kit for Human MSM? (Microseminoprotein Beta)
E-EL-H0599	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's MSM? ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human MSM?. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human MSM? (Microseminoprotein Beta) in samples from Serum, Plasma, Cell supernatant

Recombinant Human Beta-Microseminoprotein
7-05953	CHI Scientific	2µg	Ask for price

Recombinant Human Beta-Microseminoprotein
7-05954	CHI Scientific	10µg	Ask for price

Recombinant Human Beta-Microseminoprotein
7-05955	CHI Scientific	1mg	Ask for price

MSMB ELISA Kit (Mouse) (OKCD02734)
OKCD02734	Aviva Systems Biology	96 Wells	EUR 857
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.072 ng/mL

MSMB ELISA Kit (Mouse) (OKEH07071)
OKEH07071	Aviva Systems Biology	96 Wells	EUR 727
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.16 ng/mL

CLIA kit for Human MSM? (Microseminoprotein Beta)
E-CL-H0462	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's MSM? CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human MSM? . Standards or samples are added to the micro CLIA plate wells and combined with the Show more
Description: A sandwich CLIA kit for quantitative measurement of Human MSM? (Microseminoprotein Beta) in samples from Serum, Plasma, Cell supernatant

Human MSMB ELISA Kit
ELA-E3728h	Lifescience Market	96 Tests	EUR 824

MSMB ELISA KIT\|Human
EF006345	Lifescience Market	96 Tests	EUR 689

Mouse Prostate-associated microseminoprotein (MSMP) ELISA Kit
abx389885-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Prostate- associated microseminoprotein, Msmp ELISA KIT
ELI-39235m	Lifescience Market	96 Tests	EUR 865

MSMB ELISA Kit (Monkey) (OKCA01603)
OKCA01603	Aviva Systems Biology	96 Wells	EUR 930
Description: Description of target: ;Species reactivity: Monkey;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 0.195 ug/mL

MSMB ELISA Kit (Human) (OKCD00344)
OKCD00344	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.065ng/m

MSMB ELISA Kit (Rat) (OKEH05993)
OKEH05993	Aviva Systems Biology	96 Wells	EUR 727
Description: Description of target: small protein found in secretions on mucosal surfaces [RGD, Feb 2006];Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.161 ng/mL

Msmp ELISA Kit\| Mouse Prostate-associated microseminoprotein EL
EF015522	Lifescience Market	96 Tests	EUR 689

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Mouse MSMB shRNA Plasmid
20-abx971579	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

MSMB Recombinant Protein (Mouse)
RP151835	ABM	100 ug	Ask for price

MSMB antibody
70R-18647	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal MSMB antibody

MSMB Antibody
32522-100ul	SAB	100ul	EUR 252

MSMB Antibody
DF6720	Affbiotech	200ul	EUR 304
Description: MSMB Antibody detects endogenous levels of total MSMB.

MSMB Antibody
1-CSB-PA301850	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20Â°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MSMB. Recognizes MSMB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

MSMB Antibody
1-CSB-PA164416	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20Â°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MSMB. Recognizes MSMB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

MSMB Antibody
1-CSB-PA015046GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20â„ƒ, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against MSMB. Recognizes MSMB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

MSMB Antibody
1-CSB-PA015046LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MSMB. Recognizes MSMB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

MSMB siRNA
20-abx903360	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MSMB siRNA
20-abx924797	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MSMB siRNA
20-abx924798	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MSMB Antibody
ABD6720	Lifescience Market	100 ug	EUR 438

Human MSMP(Prostate-associated microseminoprotein) ELISA Kit
EH14901	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Alias: MSMP/PC3-secreted microprotein/PSMP
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Prostate- associated microseminoprotein, MSMP ELISA KIT
ELI-16574h	Lifescience Market	96 Tests	EUR 824

Human Prostate-associated microseminoprotein (MSMP) ELISA Kit
abx385156-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Msmb ORF Vector (Mouse) (pORF)
ORF050613	ABM	1.0 ug DNA	EUR 506

MSMB ELISA Kit (Human) : 96 Wells (OKEH02836)
OKEH02836	Aviva Systems Biology	96 Wells	EUR 727
Description: Description of target: The protein encoded by this gene is a member of the immunoglobulin binding factor family. It is synthesized by the epithelial cells of the prostate gland and secreted into the seminal plasma. This protein has inhibin-like activity. It may have a role as an autocrine paracrine factor in uterine, breast and other female reproductive tissues. The expression of the encoded protein is found to be decreased in prostate cancer. Two alternatively spliced transcript variants encoding different isoforms are described for this gene. The use of alternate polyadenylation sites has been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.082 ng/mL

MSMB Rabbit pAb
A10092-100ul	Abclonal	100 ul	EUR 308

MSMB Rabbit pAb
A10092-200ul	Abclonal	200 ul	EUR 459

MSMB Rabbit pAb
A10092-20ul	Abclonal	20 ul	EUR 183

MSMB Rabbit pAb
A10092-50ul	Abclonal	50 ul	EUR 223

MSMB Rabbit pAb
A13625-100ul	Abclonal	100 ul	EUR 308

MSMB Rabbit pAb
A13625-200ul	Abclonal	200 ul	EUR 459

MSMB Rabbit pAb
A13625-20ul	Abclonal	20 ul	EUR 183

MSMB Rabbit pAb
A13625-50ul	Abclonal	50 ul	EUR 223

MSMB Blocking Peptide
DF6720-BP	Affbiotech	1mg	EUR 195

MSMB Conjugated Antibody
C32522	SAB	100ul	EUR 397

MSMB cloning plasmid
CSB-CL015046HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 Î¼g plasmid + 200Î¼l Glycerol Length: 345 Sequence: atgaatgttctcctgggcagcgttgtgatctttgccaccttcgtgactttatgcaatgcatcatgctatttcatacctaatgagggagttccaggagattcaaccaggaaatgcatggatctcaaaggaaacaaacacccaataaactcggagtggcagactgacaactgtgagac Show more
Description: A cloning plasmid for the MSMB gene.

MSMB Rabbit mAb
A4168-100ul	Abclonal	100 ul	EUR 410

MSMB Rabbit mAb
A4168-200ul	Abclonal	200 ul	EUR 571

MSMB Rabbit mAb
A4168-20ul	Abclonal	20 ul	EUR 221

MSMB Rabbit mAb
A4168-50ul	Abclonal	50 ul	EUR 287

MSMB Polyclonal Antibody
ABP59329-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human MSMB protein Applications tips:
Description: A polyclonal antibody for detection of MSMB from Human, Mouse, Rat. This MSMB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MSMB protein

MSMB Polyclonal Antibody
ABP59329-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human MSMB protein Applications tips:
Description: A polyclonal antibody for detection of MSMB from Human, Mouse, Rat. This MSMB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MSMB protein

MSMB Polyclonal Antibody
ABP59329-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human MSMB protein Applications tips:
Description: A polyclonal antibody for detection of MSMB from Human, Mouse, Rat. This MSMB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MSMB protein

MSMB Polyclonal Antibody
ES11068-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MSMB from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

MSMB Polyclonal Antibody
ES11068-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MSMB from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-MSMB antibody
STJ112132	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a member of the immunoglobulin binding factor family. It is synthesized by the epithelial cells of the prostate gland and secreted into the seminal plasma. This protein has inhibin-like activity. It may have a role as an autocrine paracrine factor in uterine, breast and other female reproductive tissues. The expression of the encoded protein is found to be decreased in prostate cancer. Two alternatively spliced transcript variants encoding different isoforms are described for this gene. The use of alternate polyadenylation sites has been found for this gene.

Anti-MSMB antibody
STJ115584	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a member of the immunoglobulin binding factor family. It is synthesized by the epithelial cells of the prostate gland and secreted into the seminal plasma. This protein has inhibin-like activity. It may have a role as an autocrine paracrine factor in uterine, breast and other female reproductive tissues. The expression of the encoded protein is found to be decreased in prostate cancer. Two alternatively spliced transcript variants encoding different isoforms are described for this gene. The use of alternate polyadenylation sites has been found for this gene.

Anti-MSMB antibody
STJ192226	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to MSMB

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Mouse Anti-Human MSMB Monoclonal Antibody
CAB-1906MH	Creative Diagnostics	0.5mg	EUR 840

Mouse Anti-Human MSMB Monoclonal Antibody
CAB-1908MH	Creative Diagnostics	0.5mg	EUR 840

Msmb sgRNA CRISPR Lentivector set (Mouse)
K3408701	ABM	3 x 1.0 ug	EUR 339

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

MSMB Antibody, HRP conjugated
1-CSB-PA015046LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MSMB. Recognizes MSMB from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MSMB Antibody, FITC conjugated
1-CSB-PA015046LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MSMB. Recognizes MSMB from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MSMB Antibody, Biotin conjugated
1-CSB-PA015046LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MSMB. Recognizes MSMB from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Rat MSMB shRNA Plasmid
20-abx985418	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human MSMB shRNA Plasmid
20-abx952973	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Anti-MSMB Monoclonal Antibody
M03041	BosterBio	100ug	EUR 397
Description: Rabbit Monoclonal MSMB Antibody. Validated in IP, WB and tested in Human.

MSMB Recombinant Protein (Human)
RP020176	ABM	100 ug	Ask for price

MSMB Recombinant Protein (Rat)
RP212564	ABM	100 ug	Ask for price

Mouse beta Thromboglobulin (beta-TG) ELISA Kit
20-abx153711	Abbexa	EUR 6642.00 EUR 3542.00 EUR 825.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse beta Thromboglobulin (beta-TG) ELISA Kit
abx254521-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Mouse beta Thromboglobulin (beta-TG) ELISA Kit
abx352893-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Msmb sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3408702	ABM	1.0 ug DNA	EUR 154

Msmb sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3408703	ABM	1.0 ug DNA	EUR 154

Msmb sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3408704	ABM	1.0 ug DNA	EUR 154

MSMB Protein Vector (Mouse) (pPB-C-His)
PV202450	ABM	500 ng	EUR 603

MSMB Protein Vector (Mouse) (pPB-N-His)
PV202451	ABM	500 ng	EUR 603

MSMB Protein Vector (Mouse) (pPM-C-HA)
PV202452	ABM	500 ng	EUR 603

MSMB Protein Vector (Mouse) (pPM-C-His)
PV202453	ABM	500 ng	EUR 603

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT	SBI	1 Kit	EUR 153
Category: Cas9

Mouse IL1 beta ELISA kit
55R-1607	Fitzgerald	1 kit	EUR 651
Description: ELISA kit for the detection of Mouse IL1 beta in the research laboratory

Mouse IL1 beta ELISA kit
55R-IB49700	Fitzgerald	96 wells	EUR 1067
Description: ELISA kit for the detection of Mouse IL1 beta in the research laboratory

Mouse IFN beta ELISA Kit
55R-PB42400	Fitzgerald	1 kit	EUR 1092
Description: ELISA kit for detection of Mouse IFN Beta in the research laboratory

Mouse beta Endorphin ELISA kit
E03E0219-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse beta Endorphin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse beta Endorphin ELISA kit
E03E0219-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse beta Endorphin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse beta Endorphin ELISA kit
E03E0219-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse beta Endorphin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse beta lactoglobulin ELISA kit
E03L0012-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse beta lactoglobulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse beta lactoglobulin ELISA kit
E03L0012-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse beta lactoglobulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse beta lactoglobulin ELISA kit
E03L0012-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse beta lactoglobulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Beta-taxilin ELISA kit
E03B0982-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Beta-taxilin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Beta-taxilin ELISA kit
E03B0982-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Beta-taxilin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Beta-taxilin ELISA kit
E03B0982-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Beta-taxilin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Beta hydroxybutyrate ELISA kit
E03B1010-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Beta hydroxybutyrate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.