Mouse MSMb(Microseminoprotein Beta) ELISA Kit

Mouse MSMb(Microseminoprotein Beta) ELISA Kit

To Order Contact us:

Mouse Microseminoprotein Beta (MSMb) ELISA Kit

RD-MSMb-Mu-48Tests 48 Tests
EUR 533

Mouse Microseminoprotein Beta (MSMb) ELISA Kit

RD-MSMb-Mu-96Tests 96 Tests
EUR 740

Mouse Microseminoprotein Beta (MSMb) ELISA Kit

RDR-MSMb-Mu-48Tests 48 Tests
EUR 557

Mouse Microseminoprotein Beta (MSMb) ELISA Kit

RDR-MSMb-Mu-96Tests 96 Tests
EUR 774

Human Microseminoprotein Beta (MSMb) ELISA Kit

DLR-MSMb-Hu-48T 48T
EUR 517
  • Should the Human Microseminoprotein Beta (MSMb) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Microseminoprotein Beta (MSMb) in samples from serum, plasma, seminal plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Microseminoprotein Beta (MSMb) ELISA Kit

DLR-MSMb-Hu-96T 96T
EUR 673
  • Should the Human Microseminoprotein Beta (MSMb) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Microseminoprotein Beta (MSMb) in samples from serum, plasma, seminal plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Microseminoprotein Beta (MSMb) ELISA Kit

RD-MSMb-Hu-48Tests 48 Tests
EUR 521

Human Microseminoprotein Beta (MSMb) ELISA Kit

RD-MSMb-Hu-96Tests 96 Tests
EUR 723

Human Microseminoprotein Beta (MSMb) ELISA Kit

RDR-MSMb-Hu-48Tests 48 Tests
EUR 544

Human Microseminoprotein Beta (MSMb) ELISA Kit

RDR-MSMb-Hu-96Tests 96 Tests
EUR 756

Mouse Beta-Microseminoprotein (MSMB) ELISA Kit

abx571578-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Msmb/ Beta-microseminoprotein ELISA Kit

E0972Mo 1 Kit
EUR 632

Mouse Beta- microseminoprotein, Msmb ELISA KIT

ELI-07505m 96 Tests
EUR 865

Mouse Microseminoprotein beta (MSMb) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Microseminoprotein Beta (MSMb) ELISA Kit

SEC628Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Microseminoprotein Beta (MSMb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Microseminoprotein Beta (MSMb) in serum, plasma and other biological fluids.

Mouse Microseminoprotein Beta (MSMb) ELISA Kit

SEC628Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Microseminoprotein Beta (MSMb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Microseminoprotein Beta (MSMb) in serum, plasma and other biological fluids.

Mouse Microseminoprotein Beta (MSMb) ELISA Kit

SEC628Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Microseminoprotein Beta (MSMb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Microseminoprotein Beta (MSMb) in serum, plasma and other biological fluids.

Mouse Microseminoprotein Beta (MSMb) ELISA Kit

SEC628Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Microseminoprotein Beta (MSMb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Microseminoprotein Beta (MSMb) in serum, plasma and other biological fluids.

Mouse Microseminoprotein Beta (MSMb) ELISA Kit

  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Microseminoprotein Beta elisa. Alternative names of the recognized antigen: MSM-B
  • IGBF
  • MSP
  • MSPB
  • PN44
  • PRPS
  • PSP
  • PSP57
  • PSP94
  • Immunoglobulin-binding factor
  • Prostate secreted seminal plasma protein
  • plasma beta-inhibin
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Microseminoprotein Beta (MSMb) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Microseminoprotein Beta (MSMb) Protein

  • EUR 704.00
  • EUR 286.00
  • EUR 2151.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Microseminoprotein Beta (MSMB) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Microseminoprotein Beta (MSMb) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Microseminoprotein Beta (MSMB) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Microseminoprotein Beta (MSMb) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Microseminoprotein Beta (MSMb) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Microseminoprotein Beta (MSMb) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Microseminoprotein Beta (MSMB) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Microseminoprotein Beta (MSMB) Protein

  • EUR 328.00
  • EUR 7358.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Microseminoprotein Beta (MSMB) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Microseminoprotein Beta (MSMB) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Microseminoprotein Beta (MSMB) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Recombinant Microseminoprotein Beta (MSMb)

  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P08118
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 16.7kDa
  • Isoelectric Point: 5.6
Description: Recombinant Human Microseminoprotein Beta expressed in: E.coli

Recombinant Microseminoprotein Beta (MSMb)

  • EUR 499.62
  • EUR 236.00
  • EUR 1598.56
  • EUR 599.52
  • EUR 1099.04
  • EUR 397.00
  • EUR 3846.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O08540
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 40.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Microseminoprotein Beta expressed in: E.coli

Mouse Microseminoprotein beta (MSMb) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Mouse MSMb (Microseminoprotein Beta)

ELK6939 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Microseminoprotein Beta (MSM?). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Mic
  • Show more
Description: A sandwich ELISA kit for detection of Microseminoprotein Beta from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Pig Beta-Microseminoprotein (MSMB) ELISA Kit

abx520327-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Beta-Microseminoprotein (MSMB) ELISA Kit

abx520328-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Pig Microseminoprotein Beta (MSMb) ELISA Kit

abx361087-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Microseminoprotein Beta (MSMb) ELISA Kit

abx362965-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Sheep Microseminoprotein Beta (MSMb) ELISA Kit

abx364138-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.

Human Beta-Microseminoprotein (MSMB) ELISA Kit

abx574902-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Msmb/ Beta-microseminoprotein ELISA Kit

E0637Ra 1 Kit
EUR 646

Human MSMB/ Beta-microseminoprotein ELISA Kit

E1638Hu 1 Kit
EUR 605

Human MSMB(Beta-microseminoprotein) ELISA Kit

EH2282 96T
EUR 524.1
  • Detection range: 15.625-1000 pg/ml
  • Uniprot ID: P08118
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml

Porcine Beta- microseminoprotein, MSMB ELISA KIT

ELI-07504p 96 Tests
EUR 928

Human Beta- microseminoprotein, MSMB ELISA KIT

ELI-07506h 96 Tests
EUR 824

Human Microseminoprotein beta (MSMb) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Chicken Microseminoprotein Beta (MSMb) ELISA Kit

abx356068-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Monkey Microseminoprotein Beta (MSMb) ELISA Kit

abx359299-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Microseminoprotein Beta (MSMb) ELISA Kit

abx251632-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human Microseminoprotein Beta (MSMb) ELISA Kit

SEC628Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Microseminoprotein Beta (MSMb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Microseminoprotein Beta (MSMb) in serum, plasma, seminal plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Microseminoprotein Beta (MSMb) ELISA Kit

SEC628Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Microseminoprotein Beta (MSMb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Microseminoprotein Beta (MSMb) in serum, plasma, seminal plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Microseminoprotein Beta (MSMb) ELISA Kit

SEC628Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Microseminoprotein Beta (MSMb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Microseminoprotein Beta (MSMb) in serum, plasma, seminal plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Microseminoprotein Beta (MSMb) ELISA Kit

SEC628Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Microseminoprotein Beta (MSMb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Microseminoprotein Beta (MSMb) in serum, plasma, seminal plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Microseminoprotein Beta (MSMb) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Microseminoprotein Beta elisa. Alternative names of the recognized antigen: MSM-B
  • IGBF
  • MSP
  • MSPB
  • PN44
  • PRPS
  • PSP
  • PSP57
  • PSP94
  • Immunoglobulin-binding factor
  • Prostate secreted seminal plasma protein
  • plasma beta-inhibin
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Microseminoprotein Beta (MSMb) in samples from Serum, plasma, seminal plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Microseminoprotein Beta(MSMb)ELISA Kit

QY-E01085 96T
EUR 361

Microseminoprotein Beta (MSMb) Polyclonal Antibody (Mouse)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MSMb (Val21-Met113)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microseminoprotein Beta (MSMb)

ELISA kit for Human MSMb (Microseminoprotein Beta)

ELK3501 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Microseminoprotein Beta (MSM?). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Mic
  • Show more
Description: A sandwich ELISA kit for detection of Microseminoprotein Beta from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Guinea pig Microseminoprotein Beta (MSMb) ELISA Kit

abx358166-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Beta-microseminoprotein (MSMB/PRSP) ELISA kit

CSB-E17126h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Beta-microseminoprotein (MSMB/PRSP) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Beta-microseminoprotein (MSMB/PRSP) ELISA kit

  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Beta-microseminoprotein (MSMB/PRSP) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Microseminoprotein Beta (MSMb) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Microseminoprotein Beta (MSMb) Antibody (FITC)

  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Microseminoprotein Beta (MSMb) Antibody Pair

  • EUR 1748.00
  • EUR 1121.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.

Microseminoprotein Beta (MSMB) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Microseminoprotein Beta (MSMB) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Microseminoprotein Beta (MSMB) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Microseminoprotein Beta (MSMb) Antibody (Biotin)

  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Microseminoprotein beta (MSMb) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Microseminoprotein Beta (MSMb) CLIA Kit

abx197287-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse β microseminoprotein(MSMB) ELISA kit

E03B0949-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β microseminoprotein(MSMB) ELISA kit

E03B0949-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β microseminoprotein(MSMB) ELISA kit

E03B0949-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Microseminoprotein Beta (MSMb) Polyclonal Antibody (Mouse), APC

  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MSMb (Val21-Met113)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microseminoprotein Beta (MSMb). This antibody is labeled with APC.

Microseminoprotein Beta (MSMb) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MSMb (Val21-Met113)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microseminoprotein Beta (MSMb). This antibody is labeled with Biotin.

Microseminoprotein Beta (MSMb) Polyclonal Antibody (Mouse), Cy3

  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MSMb (Val21-Met113)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microseminoprotein Beta (MSMb). This antibody is labeled with Cy3.

Microseminoprotein Beta (MSMb) Polyclonal Antibody (Mouse), FITC

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MSMb (Val21-Met113)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microseminoprotein Beta (MSMb). This antibody is labeled with FITC.

Microseminoprotein Beta (MSMb) Polyclonal Antibody (Mouse), HRP

  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MSMb (Val21-Met113)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microseminoprotein Beta (MSMb). This antibody is labeled with HRP.

Microseminoprotein Beta (MSMb) Polyclonal Antibody (Mouse), PE

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MSMb (Val21-Met113)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microseminoprotein Beta (MSMb). This antibody is labeled with PE.

MSMB Beta-Microseminoprotein Human Recombinant Protein

PROTP08118 Regular: 10ug
EUR 317
Description: MSMB Recombinant Human produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 104 amino acids and having a molecular mass of 12 kDa. ;The MSMB is fused to His tag at N-Terminus.;The Human MSMB is purified by proprietary chromatographic techniques.

Microseminoprotein Beta (MSMb) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MSMb (Asn19~Ile114)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Microseminoprotein Beta (MSMb)

Microseminoprotein Beta (MSMb) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MSMb (Val21-Met113)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microseminoprotein Beta (MSMb). This antibody is labeled with APC-Cy7.

Goat β microseminoprotein(MSMB) ELISA kit

E06B0949-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat β microseminoprotein(MSMB) ELISA kit

E06B0949-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat β microseminoprotein(MSMB) ELISA kit

E06B0949-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat β microseminoprotein(MSMB) ELISA kit

E02B0949-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat β microseminoprotein(MSMB) ELISA kit

E02B0949-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat β microseminoprotein(MSMB) ELISA kit

E02B0949-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human β microseminoprotein(MSMB) ELISA kit

E01B0949-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human β microseminoprotein(MSMB) ELISA kit

E01B0949-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human β microseminoprotein(MSMB) ELISA kit

E01B0949-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit β microseminoprotein(MSMB) ELISA kit

E04B0949-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit β microseminoprotein(MSMB) ELISA kit

E04B0949-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit β microseminoprotein(MSMB) ELISA kit

E04B0949-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig β microseminoprotein(MSMB) ELISA kit

E07B0949-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig β microseminoprotein(MSMB) ELISA kit

E07B0949-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig β microseminoprotein(MSMB) ELISA kit

E07B0949-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey β microseminoprotein(MSMB) ELISA kit

E09B0949-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey β microseminoprotein(MSMB) ELISA kit

E09B0949-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey β microseminoprotein(MSMB) ELISA kit

E09B0949-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog β microseminoprotein(MSMB) ELISA kit

E08B0949-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog β microseminoprotein(MSMB) ELISA kit

E08B0949-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog β microseminoprotein(MSMB) ELISA kit

E08B0949-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Microseminoprotein Beta (MSMb) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MSMb (Asn19~Ile114)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Microseminoprotein Beta (MSMb). This antibody is labeled with APC.

Microseminoprotein Beta (MSMb) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MSMb (Asn19~Ile114)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Microseminoprotein Beta (MSMb). This antibody is labeled with Biotin.

Microseminoprotein Beta (MSMb) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MSMb (Asn19~Ile114)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Microseminoprotein Beta (MSMb). This antibody is labeled with Cy3.

Microseminoprotein Beta (MSMb) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MSMb (Asn19~Ile114)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Microseminoprotein Beta (MSMb). This antibody is labeled with FITC.

Microseminoprotein Beta (MSMb) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MSMb (Asn19~Ile114)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Microseminoprotein Beta (MSMb). This antibody is labeled with HRP.

Microseminoprotein Beta (MSMb) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MSMb (Asn19~Ile114)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Microseminoprotein Beta (MSMb). This antibody is labeled with PE.

Guinea pig β microseminoprotein(MSMB) ELISA kit

E05B0949-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig β microseminoprotein(MSMB) ELISA kit

E05B0949-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig β microseminoprotein(MSMB) ELISA kit

E05B0949-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Microseminoprotein Beta (MSMb) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MSMb (Asn19~Ile114)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Microseminoprotein Beta (MSMb). This antibody is labeled with APC-Cy7.

ELISA kit for Human Beta-microseminoprotein

EK4612 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Beta-microseminoprotein in samples from serum, plasma, tissue homogenates and other biological fluids.

Msmb/ Rat Msmb ELISA Kit

ELI-07507r 96 Tests
EUR 886

ELISA kit for Human MSM? (Microseminoprotein Beta)

E-EL-H0599 1 plate of 96 wells
EUR 534
  • Gentaur's MSM? ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human MSM?. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human MSM? (Microseminoprotein Beta) in samples from Serum, Plasma, Cell supernatant

Recombinant Human Beta-Microseminoprotein

7-05953 2µg Ask for price

Recombinant Human Beta-Microseminoprotein

7-05954 10µg Ask for price

Recombinant Human Beta-Microseminoprotein

7-05955 1mg Ask for price

MSMB ELISA Kit (Mouse) (OKCD02734)

OKCD02734 96 Wells
EUR 857
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.072 ng/mL

MSMB ELISA Kit (Mouse) (OKEH07071)

OKEH07071 96 Wells
EUR 727
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.16 ng/mL

CLIA kit for Human MSM? (Microseminoprotein Beta)

E-CL-H0462 1 plate of 96 wells
EUR 584
  • Gentaur's MSM? CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human MSM? . Standards or samples are added to the micro CLIA plate wells and combined with the
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human MSM? (Microseminoprotein Beta) in samples from Serum, Plasma, Cell supernatant


ELA-E3728h 96 Tests
EUR 824


EF006345 96 Tests
EUR 689

Mouse Prostate- associated microseminoprotein, Msmp ELISA KIT

ELI-39235m 96 Tests
EUR 865

Mouse Prostate-associated microseminoprotein (MSMP) ELISA Kit

abx389885-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

MSMB ELISA Kit (Human) (OKCD00344)

OKCD00344 96 Wells
EUR 831
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.065ng/m

MSMB ELISA Kit (Monkey) (OKCA01603)

OKCA01603 96 Wells
EUR 930
Description: Description of target: ;Species reactivity: Monkey;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 0.195 ug/mL

MSMB ELISA Kit (Rat) (OKEH05993)

OKEH05993 96 Wells
EUR 727
Description: Description of target: small protein found in secretions on mucosal surfaces [RGD, Feb 2006];Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.161 ng/mL

Msmp ELISA Kit| Mouse Prostate-associated microseminoprotein EL

EF015522 96 Tests
EUR 689

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Mouse MSMB shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MSMB Recombinant Protein (Mouse)

RP151835 100 ug Ask for price


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MSMB Antibody

ABD6720 100 ug
EUR 438

MSMB Antibody

32522-100ul 100ul
EUR 252

MSMB antibody

70R-18647 50 ul
EUR 435
Description: Rabbit polyclonal MSMB antibody

MSMB Antibody

DF6720 200ul
EUR 304
Description: MSMB Antibody detects endogenous levels of total MSMB.

MSMB Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MSMB. Recognizes MSMB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

MSMB Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MSMB. Recognizes MSMB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

MSMB Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against MSMB. Recognizes MSMB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

MSMB Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MSMB. Recognizes MSMB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Human MSMP(Prostate-associated microseminoprotein) ELISA Kit

EH14901 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Alias: MSMP/PC3-secreted microprotein/PSMP
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Prostate- associated microseminoprotein, MSMP ELISA KIT

ELI-16574h 96 Tests
EUR 824

Human Prostate-associated microseminoprotein (MSMP) ELISA Kit

abx385156-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Msmb ORF Vector (Mouse) (pORF)

ORF050613 1.0 ug DNA
EUR 506

MSMB ELISA Kit (Human) : 96 Wells (OKEH02836)

OKEH02836 96 Wells
EUR 727
Description: Description of target: The protein encoded by this gene is a member of the immunoglobulin binding factor family. It is synthesized by the epithelial cells of the prostate gland and secreted into the seminal plasma. This protein has inhibin-like activity. It may have a role as an autocrine paracrine factor in uterine, breast and other female reproductive tissues. The expression of the encoded protein is found to be decreased in prostate cancer. Two alternatively spliced transcript variants encoding different isoforms are described for this gene. The use of alternate polyadenylation sites has been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.082 ng/mL

MSMB Conjugated Antibody

C32522 100ul
EUR 397

MSMB cloning plasmid

CSB-CL015046HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 345
  • Sequence: atgaatgttctcctgggcagcgttgtgatctttgccaccttcgtgactttatgcaatgcatcatgctatttcatacctaatgagggagttccaggagattcaaccaggaaatgcatggatctcaaaggaaacaaacacccaataaactcggagtggcagactgacaactgtgagac
  • Show more
Description: A cloning plasmid for the MSMB gene.

MSMB Polyclonal Antibody

ES11068-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MSMB from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

MSMB Polyclonal Antibody

ES11068-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MSMB from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

MSMB Polyclonal Antibody

ABP59329-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human MSMB protein
  • Applications tips:
Description: A polyclonal antibody for detection of MSMB from Human, Mouse, Rat. This MSMB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MSMB protein

MSMB Polyclonal Antibody

ABP59329-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human MSMB protein
  • Applications tips:
Description: A polyclonal antibody for detection of MSMB from Human, Mouse, Rat. This MSMB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MSMB protein

MSMB Polyclonal Antibody

ABP59329-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MSMB protein
  • Applications tips:
Description: A polyclonal antibody for detection of MSMB from Human, Mouse, Rat. This MSMB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MSMB protein

MSMB Rabbit pAb

A10092-100ul 100 ul
EUR 308

MSMB Rabbit pAb

A10092-200ul 200 ul
EUR 459

MSMB Rabbit pAb

A10092-20ul 20 ul
EUR 183

MSMB Rabbit pAb

A10092-50ul 50 ul
EUR 223

MSMB Rabbit mAb

A4168-100ul 100 ul
EUR 410

MSMB Rabbit mAb

A4168-200ul 200 ul
EUR 571

MSMB Rabbit mAb

A4168-20ul 20 ul
EUR 221

MSMB Rabbit mAb

A4168-50ul 50 ul
EUR 287

MSMB Rabbit pAb

A13625-100ul 100 ul
EUR 308

MSMB Rabbit pAb

A13625-200ul 200 ul
EUR 459

MSMB Rabbit pAb

A13625-20ul 20 ul
EUR 183

MSMB Rabbit pAb

A13625-50ul 50 ul
EUR 223

MSMB Blocking Peptide

DF6720-BP 1mg
EUR 195

Anti-MSMB antibody

STJ112132 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the immunoglobulin binding factor family. It is synthesized by the epithelial cells of the prostate gland and secreted into the seminal plasma. This protein has inhibin-like activity. It may have a role as an autocrine paracrine factor in uterine, breast and other female reproductive tissues. The expression of the encoded protein is found to be decreased in prostate cancer. Two alternatively spliced transcript variants encoding different isoforms are described for this gene. The use of alternate polyadenylation sites has been found for this gene.

Anti-MSMB antibody

STJ192226 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MSMB

Anti-MSMB antibody

STJ115584 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the immunoglobulin binding factor family. It is synthesized by the epithelial cells of the prostate gland and secreted into the seminal plasma. This protein has inhibin-like activity. It may have a role as an autocrine paracrine factor in uterine, breast and other female reproductive tissues. The expression of the encoded protein is found to be decreased in prostate cancer. Two alternatively spliced transcript variants encoding different isoforms are described for this gene. The use of alternate polyadenylation sites has been found for this gene.

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Mouse Anti-Human MSMB Monoclonal Antibody

CAB-1906MH 0.5mg
EUR 840

Mouse Anti-Human MSMB Monoclonal Antibody

CAB-1908MH 0.5mg
EUR 840

Msmb sgRNA CRISPR Lentivector set (Mouse)

K3408701 3 x 1.0 ug
EUR 339

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

Rat MSMB shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human MSMB shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MSMB Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MSMB. Recognizes MSMB from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MSMB Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MSMB. Recognizes MSMB from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MSMB Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MSMB. Recognizes MSMB from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-MSMB Monoclonal Antibody

M03041 100ug
EUR 397
Description: Rabbit Monoclonal MSMB Antibody. Validated in IP, WB and tested in Human.

MSMB Recombinant Protein (Human)

RP020176 100 ug Ask for price

MSMB Recombinant Protein (Rat)

RP212564 100 ug Ask for price

Mouse beta Thromboglobulin (beta-TG) ELISA Kit

  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse beta Thromboglobulin (beta-TG) ELISA Kit

abx352893-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Mouse beta Thromboglobulin (beta-TG) ELISA Kit

abx254521-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Msmb sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3408702 1.0 ug DNA
EUR 154

Msmb sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3408703 1.0 ug DNA
EUR 154

Msmb sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3408704 1.0 ug DNA
EUR 154

MSMB Protein Vector (Mouse) (pPB-C-His)

PV202450 500 ng
EUR 603

MSMB Protein Vector (Mouse) (pPB-N-His)

PV202451 500 ng
EUR 603

MSMB Protein Vector (Mouse) (pPM-C-HA)

PV202452 500 ng
EUR 603

MSMB Protein Vector (Mouse) (pPM-C-His)

PV202453 500 ng
EUR 603

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

EUR 153
  • Category: Cas9

Mouse Beta-taxilin ELISA kit

E03B0982-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Beta-taxilin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Beta-taxilin ELISA kit

E03B0982-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Beta-taxilin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Beta-taxilin ELISA kit

E03B0982-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Beta-taxilin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Beta hydroxybutyrate ELISA kit

E03B1010-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Beta hydroxybutyrate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Beta hydroxybutyrate ELISA kit

E03B1010-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Beta hydroxybutyrate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Beta hydroxybutyrate ELISA kit

E03B1010-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Beta hydroxybutyrate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse beta Endorphin ELISA kit

E03E0219-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse beta Endorphin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse beta Endorphin ELISA kit

E03E0219-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse beta Endorphin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse beta Endorphin ELISA kit

E03E0219-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse beta Endorphin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse beta lactoglobulin ELISA kit

E03L0012-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse beta lactoglobulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse beta lactoglobulin ELISA kit

E03L0012-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse beta lactoglobulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse beta lactoglobulin ELISA kit

E03L0012-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse beta lactoglobulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Amylase Beta ELISA kit

ELA-E2216m 96 Tests
EUR 865