Human CCT2(Chaperonin Containing TCP1, Subunit 2) ELISA Kit

Human CCT2(Chaperonin Containing TCP1, Subunit 2) ELISA Kit

To Order Contact us:  Mark@operatiebrp.nl

Human Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit
RD-CCT2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 783

Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit
DLR-CCT2-Mu-48T	DL Develop	48T	EUR 566
Should the Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) in samples from tissue homogenates or other biological fluids.

Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit
DLR-CCT2-Mu-96T	DL Develop	96T	EUR 741
Should the Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) in samples from tissue homogenates or other biological fluids.

Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit
RDR-CCT2-Mu-48Tests	Reddot Biotech	48 Tests	EUR 603

Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit
RDR-CCT2-Mu-96Tests	Reddot Biotech	96 Tests	EUR 840

Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit
RD-CCT2-Mu-48Tests	Reddot Biotech	48 Tests	EUR 577

Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit
RD-CCT2-Mu-96Tests	Reddot Biotech	96 Tests	EUR 802

Chaperonin Containing TCP1, Subunit 2 (CCT2) Antibody
abx015792-100ul	Abbexa	100 ul	EUR 411
Shipped within 5-10 working days.

Chaperonin Containing TCP1, Subunit 2 (CCT2) Antibody
20-abx175787	Abbexa	EUR 1344.00 EUR 634.00	1 mg 200 ug
Please enquire.

Chaperonin Containing TCP1, Subunit 2 (CCT2) Antibody
20-abx175788	Abbexa	EUR 1344.00 EUR 634.00	1 mg 200 ug
Please enquire.

Chaperonin Containing TCP1, Subunit 2 (CCT2) Antibody
20-abx128398	Abbexa	EUR 453.00 EUR 133.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Chaperonin Containing TCP1, Subunit 2 (CCT2) Antibody
abx146184-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Chaperonin Containing TCP1, Subunit 2 (CCT2) Antibody
20-abx171675	Abbexa	EUR 926.00 EUR 467.00	1 mg 200 ug
Please enquire.

Chaperonin Containing TCP1, Subunit 2 (CCT2) Antibody
abx231396-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Recombinant Chaperonin Containing TCP1, Subunit 2 (CCT2)
4-RPL292Hu01	Cloud-Clone	EUR 494.24 EUR 235.00 EUR 1578.40 EUR 592.80 EUR 1085.60 EUR 394.00 EUR 3796.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P78371 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 56.4kDa Isoelectric Point: Inquire
Description: Recombinant Human Chaperonin Containing TCP1, Subunit 2 expressed in: E.coli

Human Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit
SEL292Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5189.65
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Chaperonin Containing TCP1, Subunit 2 (CCT2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inte Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Chaperonin Containing TCP1, Subunit 2 (CCT2) in Tissue homogenates, cell lysates and other biological fluids.

Human Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit
SEL292Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 515.03
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Chaperonin Containing TCP1, Subunit 2 (CCT2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inte Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Chaperonin Containing TCP1, Subunit 2 (CCT2) in Tissue homogenates, cell lysates and other biological fluids.

Human Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit
SEL292Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 692.9
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Chaperonin Containing TCP1, Subunit 2 (CCT2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inte Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Chaperonin Containing TCP1, Subunit 2 (CCT2) in Tissue homogenates, cell lysates and other biological fluids.

Human Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit
SEL292Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2818.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Chaperonin Containing TCP1, Subunit 2 (CCT2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inte Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Chaperonin Containing TCP1, Subunit 2 (CCT2) in Tissue homogenates, cell lysates and other biological fluids.

Human Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit
4-SEL292Hu	Cloud-Clone	EUR 5240.00 EUR 2769.00 EUR 693.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Chaperonin Containing TCP1, Subunit 2 elisa. Alternative names of the recognized antigen: CCT-beta CCTB TCP-1-beta T-Complex Protein 1 Subunit Beta
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Chaperonin Containing TCP1, Subunit 2 (CCT2) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Chaperonin Containing TCP1, Subunit 2 (CCT2) Protein
20-abx167032	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit
SEL292Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5333.64
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inte Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) in Tissue homogenates and other biological fluids.

Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit
SEL292Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 526.89
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inte Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) in Tissue homogenates and other biological fluids.

Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit
SEL292Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 709.84
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inte Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) in Tissue homogenates and other biological fluids.

Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit
SEL292Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2894.28
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inte Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) in Tissue homogenates and other biological fluids.

Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit
4-SEL292Mu	Cloud-Clone	EUR 5384.00 EUR 2845.00 EUR 710.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Chaperonin Containing TCP1, Subunit 2 elisa. Alternative names of the recognized antigen: CCT-beta CCTB TCP-1-beta T-Complex Protein 1 Subunit Beta
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Chaperonin Containing TCP1, Subunit 2 (CCT2) CLIA Kit
20-abx495908	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human CCT2 (Chaperonin Containing TCP1, Subunit 2)
ELK6962	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Chaperonin Containing TCP1, Subunit 2 (CCT2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody s Show more
Description: A sandwich ELISA kit for detection of Chaperonin Containing TCP1, Subunit 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) Protein
20-abx652852	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) Protein
20-abx652853	Abbexa	EUR 718.00 EUR 286.00 EUR 2221.00 EUR 857.00 EUR 509.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) CLIA Kit
20-abx495909	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Mouse CCT2 (Chaperonin Containing TCP1, Subunit 2)
ELK8023	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Chaperonin Containing TCP1, Subunit 2 (CCT2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody s Show more
Description: A sandwich ELISA kit for detection of Chaperonin Containing TCP1, Subunit 2 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Chaperonin Containing TCP1, Subunit 2 (CCT2) Polyclonal Antibody (Human, Mouse)
4-PAL292Hu01	Cloud-Clone	EUR 262.00 EUR 2747.00 EUR 679.00 EUR 331.00 EUR 220.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CCT2 (Met1~Cys488) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2)

Chaperonin Containing TCP1, Subunit 2 (CCT2) Polyclonal Antibody (Human, Mouse), APC
4-PAL292Hu01-APC	Cloud-Clone	EUR 368.00 EUR 3599.00 EUR 993.00 EUR 472.00 EUR 229.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CCT2 (Met1~Cys488) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2). This antibody is labeled with APC.

Chaperonin Containing TCP1, Subunit 2 (CCT2) Polyclonal Antibody (Human, Mouse), Biotinylated
4-PAL292Hu01-Biotin	Cloud-Clone	EUR 328.00 EUR 2697.00 EUR 786.00 EUR 404.00 EUR 226.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CCT2 (Met1~Cys488) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2). This antibody is labeled with Biotin.

Chaperonin Containing TCP1, Subunit 2 (CCT2) Polyclonal Antibody (Human, Mouse), Cy3
4-PAL292Hu01-Cy3	Cloud-Clone	EUR 449.00 EUR 4757.00 EUR 1283.00 EUR 588.00 EUR 264.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CCT2 (Met1~Cys488) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2). This antibody is labeled with Cy3.

Chaperonin Containing TCP1, Subunit 2 (CCT2) Polyclonal Antibody (Human, Mouse), FITC
4-PAL292Hu01-FITC	Cloud-Clone	EUR 314.00 EUR 2899.00 EUR 814.00 EUR 397.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CCT2 (Met1~Cys488) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2). This antibody is labeled with FITC.

Chaperonin Containing TCP1, Subunit 2 (CCT2) Polyclonal Antibody (Human, Mouse), HRP
4-PAL292Hu01-HRP	Cloud-Clone	EUR 335.00 EUR 3135.00 EUR 877.00 EUR 426.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CCT2 (Met1~Cys488) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2). This antibody is labeled with HRP.

Chaperonin Containing TCP1, Subunit 2 (CCT2) Polyclonal Antibody (Human, Mouse), PE
4-PAL292Hu01-PE	Cloud-Clone	EUR 314.00 EUR 2899.00 EUR 814.00 EUR 397.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CCT2 (Met1~Cys488) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2). This antibody is labeled with PE.

Chaperonin Containing TCP1, Subunit 2 (CCT2) Polyclonal Antibody (Human, Mouse), APC-Cy7
4-PAL292Hu01-APC-Cy7	Cloud-Clone	EUR 616.00 EUR 7078.00 EUR 1867.00 EUR 824.00 EUR 338.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CCT2 (Met1~Cys488) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2). This antibody is labeled with APC-Cy7.

Chaperonin Containing TCP1, Subunit 3 (CCT3) Antibody
20-abx111563	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Chaperonin Containing TCP1, Subunit 4 (CCT4) Antibody
20-abx111564	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Chaperonin Containing TCP1, Subunit 5 (CCT5) Antibody
20-abx111565	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Chaperonin Containing TCP1, Subunit 6A (CCT6A) Antibody
20-abx111566	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Chaperonin Containing TCP1, Subunit 6B (CCT6B) Antibody
20-abx111567	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Chaperonin Containing TCP1, Subunit 7 (CCT7) Antibody
20-abx111568	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Chaperonin Containing TCP1, Subunit 8 (CCT8) Antibody
20-abx111569	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Chaperonin Containing TCP1, Subunit 6B (CCT6B) Antibody
abx146187-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Chaperonin Containing TCP1, Subunit 4 (CCT4) Antibody
abx146193-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Chaperonin Containing TCP1, Subunit 3 (CCT3) Antibody
abx146205-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Chaperonin Containing TCP1, Subunit 7 (CCT7) Antibody
abx146230-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Chaperonin Containing TCP1, Subunit 7 (CCT7) Antibody
abx413783-01mg	Abbexa	0.1 mg	EUR 495
Shipped within 1 week.

Chaperonin Containing TCP1, Subunit 6A (CCT6A) Antibody
abx330610-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

Chaperonin Containing TCP1, Subunit 8 (CCT8) Antibody
20-abx325666	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Chaperonin Containing TCP1, Subunit 6A (CCT6A) Antibody
20-abx328411	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Chaperonin Containing TCP1, Subunit 3 (CCT3) Antibody
abx430056-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Chaperonin Containing TCP1, Subunit 6B (CCT6B) Antibody
20-abx301582	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Chaperonin Containing TCP1, Subunit 3 (CCT3) Antibody
abx231397-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Chaperonin Containing TCP1, Subunit 3 (CCT3) Antibody
abx231398-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Chaperonin Containing TCP1, Subunit 6B (CCT6B) Antibody
abx231402-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Chaperonin Containing TCP1, Subunit 7 (CCT7) Antibody
abx231403-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Chaperonin Containing TCP1, Subunit 6B (CCT6B) Antibody (HRP)
20-abx309773	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Chaperonin Containing TCP1, Subunit 6B (CCT6B) Antibody (FITC)
20-abx309774	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Chaperonin Containing TCP1, Subunit 6B (CCT6B) Antibody (Biotin)
20-abx309775	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Anti-TCP1 beta/CCT2 Antibody
PB9992	BosterBio	100ug/vial	EUR 334

Cct2/ Rat Cct2 ELISA Kit
ELI-51953r	Lifescience Market	96 Tests	EUR 886

CCT2 ELISA KIT|Human
EF008478	Lifescience Market	96 Tests	EUR 689

Tcp1/ Rat Tcp1 ELISA Kit
ELI-41942r	Lifescience Market	96 Tests	EUR 886

Anti-TCP1 eta/CCT7 Antibody
A08169-2	BosterBio	100ug/vial	EUR 294

TCP1 ELISA KIT|Human
EF003503	Lifescience Market	96 Tests	EUR 689

CCT2 ELISA Kit (Human) (OKCD00604)
OKCD00604	Aviva Systems Biology	96 Wells	EUR 909
Description: Description of target: Molecular chaperone; assists the folding of proteins upon ATP hydrolysis. As part of the BBS/CCT complex may play a role in the assembly of BBSome, a complex involved in ciliogenesis regulating transports vesicles to the cilia. Known to play a role, in vitro, in the folding of actin and tubulin.1 Publication <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.17"BBS6, BBS10, and BBS12 form a complex with CCT/TRiC family chaperonins and mediate BBSome assembly."_x005F_x005F_x000D_Seo S., Baye L.M., Schulz N.P., Beck J.S., Zhang Q., Slusarski D.C., Sheffield V.C._x005F_x005F_x000D_Proc. Natl. Acad. Sci. U.S.A. 107:1488-1493(2010) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION, IDENTIFICATION IN BBS/CCT COMPLEX. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.056 ng/mL

CCT2 ELISA Kit (Human) (OKDD00174)
OKDD00174	Aviva Systems Biology	96 Wells	EUR 1053
Description: Description of target: The protein encoded by this gene is a molecular chaperone that is a member of the chaperonin containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). This complex consists of two identical stacked rings, each containing eight different proteins. Unfolded polypeptides enter the central cavity of the complex and are folded in an ATP-dependent manner. The complex folds various proteins, including actin and tubulin. Two transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.067 ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Human T-Complex Protein 1 Subunit Beta (CCT2) ELISA Kit
20-abx150988	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human T- complex protein 1 subunit beta, CCT2 ELISA KIT
ELI-13747h	Lifescience Market	96 Tests	EUR 824

Human T- complex protein 1 subunit alpha, TCP1 ELISA KIT
ELI-17403h	Lifescience Market	96 Tests	EUR 824

Human Chaperonin 10 ELISA kit
E01C0815-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Chaperonin 10 ELISA kit
E01C0815-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Chaperonin 10 ELISA kit
E01C0815-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse T-Complex Protein 1 Subunit Beta (CCT2) ELISA Kit
20-abx153795	Abbexa	EUR 7504.00 EUR 3996.00 EUR 926.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Bovine T- complex protein 1 subunit beta, CCT2 ELISA KIT
ELI-18861b	Lifescience Market	96 Tests	EUR 928

Mouse T- complex protein 1 subunit beta, Cct2 ELISA KIT
ELI-41400m	Lifescience Market	96 Tests	EUR 865

Human T-complex protein 1 subunit beta (CCT2)
1-CSB-EP004856HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 73.4 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human T-complex protein 1 subunit beta(CCT2) expressed in E.coli

Human T-complex protein 1 subunit beta (CCT2)
1-CSB-YP004856HU	Cusabio	EUR 430.00 EUR 234.00 EUR 1508.00 EUR 642.00 EUR 1009.00 EUR 291.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 59.4 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human T-complex protein 1 subunit beta(CCT2) expressed in Yeast

CCT2 ELISA Kit (Mouse) (OKDD00818)
OKDD00818	Aviva Systems Biology	96 Wells	EUR 1079
Description: Description of target: Molecular chaperone, assists the folding of proteins upon atp hydrolysis. as part of the bbs/cct complex may play a role in the assembly of bbsome, a complex involved in ciliogenesis regulating transports vesicles to the cilia. known to play a role, in vitro, in the folding of actin and tubulin (by similarity).;Species reactivity: Mouse;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.058ng/mL

Human chaperonin 10,CPN10 ELISA Kit
201-12-0674	SunredBio	96 tests	EUR 440
This chaperonin 10 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human chaperonin 10,CPN10 ELISA kit
E01C2306-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human chaperonin 10,CPN10 ELISA kit
E01C2306-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human chaperonin 10,CPN10 ELISA kit
E01C2306-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Chaperonin 10 (CPN10) ELISA Kit
abx052001-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Human chaperonin 10,CPN10 ELISA Kit
CN-03950H1	ChemNorm	96T	EUR 464

Human chaperonin 10,CPN10 ELISA Kit
CN-03950H2	ChemNorm	48T	EUR 313

Human chaperonin 10, CPN10 ELISA Kit
CSB-E09917h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human chaperonin 10, CPN10 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human chaperonin 10, CPN10 ELISA Kit
1-CSB-E09917h	Cusabio	EUR 900.00 EUR 5476.00 EUR 2900.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human chaperonin 10, CPN10 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Chaperonin 10 (CPN10) ELISA Kit
abx351409-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Human chaperonin 10(CPN10)ELISA Kit
GA-E0690HM-48T	GenAsia Biotech	48T	EUR 289

Human chaperonin 10(CPN10)ELISA Kit
GA-E0690HM-96T	GenAsia Biotech	96T	EUR 466

Human chaperonin 10(CPN10)ELISA Kit
QY-E04180	Qayee Biotechnology	96T	EUR 394

Bovine T- complex protein 1 subunit alpha, TCP1 ELISA KIT
ELI-41835b	Lifescience Market	96 Tests	EUR 928

Mouse T- complex protein 1 subunit alpha, Tcp1 ELISA KIT
ELI-41836m	Lifescience Market	96 Tests	EUR 865

Goat Chaperonin 10 ELISA kit
E06C0815-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Chaperonin 10 ELISA kit
E06C0815-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Chaperonin 10 ELISA kit
E06C0815-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Chaperonin 10 ELISA kit
E03C0815-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Chaperonin 10 ELISA kit
E03C0815-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Chaperonin 10 ELISA kit
E03C0815-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Chaperonin 10 ELISA kit
E04C0815-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Chaperonin 10 ELISA kit
E04C0815-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Chaperonin 10 ELISA kit
E04C0815-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Chaperonin 10 ELISA kit
E02C0815-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Chaperonin 10 ELISA kit
E02C0815-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Chaperonin 10 ELISA kit
E02C0815-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Chaperonin 10 ELISA kit
E09C0815-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Chaperonin 10 ELISA kit
E09C0815-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Chaperonin 10 ELISA kit
E09C0815-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Chaperonin 10 ELISA kit
E08C0815-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Chaperonin 10 ELISA kit
E08C0815-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Chaperonin 10 ELISA kit
E08C0815-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Chaperonin 10 ELISA kit
E07C0815-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Chaperonin 10 ELISA kit
E07C0815-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Chaperonin 10 ELISA kit
E07C0815-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CCT2 antibody
38998-100ul	SAB	100ul	EUR 252

CCT2 Antibody
43067-100ul	SAB	100ul	EUR 252

CCT2 Antibody
1-CSB-PA004856ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CCT2. Recognizes CCT2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IP; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IP:1:200-1:2000

CCT2 Antibody
BF0056	Affbiotech	200ul	EUR 376
Description: CCT2 antibody detects endogenous levels of total CCT2.

CCT2 siRNA
20-abx900891	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CCT2 siRNA
20-abx910899	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CCT2 siRNA
20-abx910900	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ELISA kit for Human CPN10 (Chaperonin 10)
E-EL-H0697	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's CPN10 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human CPN10. Standards or samples are added to the micro ELISA plate wells and combined with Show more
Description: A sandwich ELISA kit for quantitative measurement of Human CPN10 (Chaperonin 10) in samples from Serum, Plasma, Cell supernatant

Human T-Complex 1 (TCP1) ELISA Kit
20-abx383676	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-12 working days.

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-2	CORNING	1/pk	EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

T-Complex Protein 1 Subunit Beta (CCT2) Antibody
20-abx005024	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

T-Complex Protein 1 Subunit Beta (CCT2) Antibody
abx011837-100ul	Abbexa	100 ul	EUR 411
Shipped within 5-10 working days.

T-Complex Protein 1 Subunit Beta (CCT2) Antibody
20-abx321387	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

T-Complex Protein 1 Subunit Beta (CCT2) Antibody
20-abx225083	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

CCT2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0396403	ABM	1.0 ug DNA	EUR 154

Human CCT2 shRNA Plasmid
20-abx957196	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

CCT2 Recombinant Protein (Human)
RP037867	ABM	100 ug	Ask for price

CCT2 Recombinant Protein (Human)
RP037870	ABM	100 ug	Ask for price

Rat chaperonin 10,CPN10 ELISA kit
E02C2306-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat chaperonin 10,CPN10 ELISA kit
E02C2306-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat chaperonin 10,CPN10 ELISA kit
E02C2306-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Chaperonin 10 ELISA kit
E05C0815-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Chaperonin 10 ELISA kit
E05C0815-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Chaperonin 10 ELISA kit
E05C0815-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse chaperonin 10,CPN10 ELISA kit
E03C2306-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse chaperonin 10,CPN10 ELISA kit
E03C2306-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse chaperonin 10,CPN10 ELISA kit
E03C2306-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat chaperonin 10,CPN10 ELISA kit
E06C2306-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat chaperonin 10,CPN10 ELISA kit
E06C2306-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat chaperonin 10,CPN10 ELISA kit
E06C2306-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit chaperonin 10,CPN10 ELISA kit
E04C2306-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit chaperonin 10,CPN10 ELISA kit
E04C2306-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit chaperonin 10,CPN10 ELISA kit
E04C2306-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey chaperonin 10,CPN10 ELISA kit
E09C2306-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey chaperonin 10,CPN10 ELISA kit
E09C2306-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey chaperonin 10,CPN10 ELISA kit
E09C2306-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog chaperonin 10,CPN10 ELISA kit
E08C2306-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog chaperonin 10,CPN10 ELISA kit
E08C2306-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog chaperonin 10,CPN10 ELISA kit
E08C2306-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig chaperonin 10,CPN10 ELISA kit
E07C2306-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig chaperonin 10,CPN10 ELISA kit
E07C2306-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig chaperonin 10,CPN10 ELISA kit
E07C2306-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Chaperonin 10 (CPN10) ELISA Kit
abx359786-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Pig Chaperonin 10 (CPN10) ELISA Kit
abx361563-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Chicken Chaperonin 10 (CPN10) ELISA Kit
abx357010-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Chaperonin 10 (CPN10) ELISA Kit
abx363426-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Sheep Chaperonin 10 (CPN10) ELISA Kit
abx364720-96tests	Abbexa	96 tests	EUR 926
Shipped within 5-12 working days.

TCP1 antibody
70R-20745	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal TCP1 antibody

TCP1 Antibody
32517-100ul	SAB	100ul	EUR 252

TCP1 Antibody
43013-100ul	SAB	100ul	EUR 252

TCP1 Antibody
1-CSB-PA050225	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TCP1. Recognizes TCP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

TCP1 Antibody
DF6714	Affbiotech	200ul	EUR 304
Description: TCP1 Antibody detects endogenous levels of total TCP1.

TCP1 Antibody
1-CSB-PA023320GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TCP1. Recognizes TCP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

TCP1 Antibody
1-CSB-PA023320LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TCP1. Recognizes TCP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:500-1:1000, IF:1:200-1:500

TCP1 siRNA
20-abx905504	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TCP1 siRNA
20-abx936380	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TCP1 siRNA
20-abx936381	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TCP1 Antibody
ABD6714	Lifescience Market	100 ug	EUR 438

TCP1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2351303	ABM	1.0 ug DNA	EUR 154

CCT2 Conjugated Antibody
C43067	SAB	100ul	EUR 397

CCT2 Conjugated Antibody
C38998	SAB	100ul	EUR 397

CCT2 Blocking Peptide
BF0056-BP	Affbiotech	1mg	EUR 195

CCT2 cloning plasmid
CSB-CL004856HU1-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1608 Sequence: atggcgtccctttcccttgcacctgttaacatctttaaggcaggagctgatgaagagagagcagagacagctcgtctgacttcttttattggtgccatcgccattggagacttggtaaagagcaccttgggacccaaaggcatggacaaaattcttctaagcagtggacgagatg Show more
Description: A cloning plasmid for the CCT2 gene.

CCT2 cloning plasmid
CSB-CL004856HU2-10ug	Cusabio	10ug	EUR 560
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1608 Sequence: atggcgtccctttcccttgcacctgttaacatctttaaggcaggagctgatgaagagagagcagagacagctcgtctgacttcttttattggtgccatcgccattggagacttggtaaagagcaccttgggacccaaaggcatggacaaaattcttctaagcagtggacgagatg Show more
Description: A cloning plasmid for the CCT2 gene.

CCT2 Rabbit pAb
A6546-100ul	Abclonal	100 ul	EUR 308

CCT2 Rabbit pAb
A6546-200ul	Abclonal	200 ul	EUR 459

CCT2 Rabbit pAb
A6546-20ul	Abclonal	20 ul	EUR 183

CCT2 Rabbit pAb
A6546-50ul	Abclonal	50 ul	EUR 223

anti- CCT2 antibody
FNab01396	FN Test	100µg	EUR 548.75
Immunogen: chaperonin containing TCP1, subunit 2(beta) Uniprot ID: P78371 Gene ID: 10576 Research Area: Metabolism
Description: Antibody raised against CCT2

anti-CCT2 (5B5F5)
LF-MA30629	Abfrontier	100 ul	EUR 527
Description: Mouse Monoclonal to CCT2

anti-CCT2 (5B5C4)
LF-MA30637	Abfrontier	100 ul	EUR 527
Description: Mouse Monoclonal to CCT2

Anti-CCT2 antibody
PAab01396	Lifescience Market	100 ug	EUR 386

pCR4-TOPO-CCT2
PVT18195	Lifescience Market	2 ug	EUR 231

Anti-CCT2 antibody
STJ28629	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a molecular chaperone that is a member of the chaperonin containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). This complex consists of two identical stacked rings, each containing eight different proteins. Unfolded polypeptides enter the central cavity of the complex and are folded in an ATP-dependent manner. The complex folds various proteins, including actin and tubulin. Two transcript variants encoding different isoforms have been found for this gene.

Human TCP1 shRNA Plasmid
20-abx954767	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TCP1 Recombinant Protein (Human)
RP031183	ABM	100 ug	Ask for price

CCT2 ORF Vector (Human) (pORF)
ORF012623	ABM	1.0 ug DNA	EUR 354

CCT2 ORF Vector (Human) (pORF)
ORF012624	ABM	1.0 ug DNA	EUR 354

Guinea pig chaperonin 10,CPN10 ELISA kit
E05C2306-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig chaperonin 10,CPN10 ELISA kit
E05C2306-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig chaperonin 10,CPN10 ELISA kit
E05C2306-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

T-Complex Protein 1 Subunit Epsilon (TCP1 epsilon) Antibody
20-abx008260	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

T-Complex Protein 1 Subunit Epsilon (TCP1 epsilon) Antibody
abx018169-100ug	Abbexa	100 ug	EUR 384
Shipped within 5-10 working days.

T-Complex Protein 1 Subunit Delta (TCP1 delta) Antibody
20-abx141878	Abbexa	EUR 370.00 EUR 606.00 EUR 300.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

T-Complex Protein 1 Subunit Alpha (TCP1 alpha) Antibody
abx445087-100ug	Abbexa	100 ug	EUR 495
Shipped within 5-12 working days.

T-Complex Protein 1 Subunit Alpha (TCP1 alpha) Antibody
abx445088-100ug	Abbexa	100 ug	EUR 495
Shipped within 5-12 working days.

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Cct2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4936203	ABM	1.0 ug DNA	EUR 154

Cct2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7255603	ABM	1.0 ug DNA	EUR 154

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Human Prefoldin Subunit 2 (PFDN2) ELISA Kit
DLR-PFDN2-Hu-48T	DL Develop	48T	EUR 517
Should the Human Prefoldin Subunit 2 (PFDN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Prefoldin Subunit 2 (PFDN2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Prefoldin Subunit 2 (PFDN2) ELISA Kit
DLR-PFDN2-Hu-96T	DL Develop	96T	EUR 673
Should the Human Prefoldin Subunit 2 (PFDN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Prefoldin Subunit 2 (PFDN2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Prefoldin subunit 2(PFDN2) ELISA kit
E01P0762-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Prefoldin subunit 2(PFDN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Prefoldin subunit 2(PFDN2) ELISA kit
E01P0762-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Prefoldin subunit 2(PFDN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Prefoldin subunit 2(PFDN2) ELISA kit
E01P0762-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Prefoldin subunit 2(PFDN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dynactin Subunit 2 (DCTN2) ELISA Kit
abx259549-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Prefoldin subunit 2, PFDN2 ELISA KIT
ELI-21566h	Lifescience Market	96 Tests	EUR 824

Human Prefoldin subunit 2 (PFDN2) ELISA Kit
20-abx382168	Abbexa	EUR 6642.00 EUR 3542.00 EUR 825.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-12 working days.

Human Dynactin subunit 2, DCTN2 ELISA KIT
ELI-32027h	Lifescience Market	96 Tests	EUR 824

Human Prefoldin Subunit 2(PFDN2)ELISA Kit
QY-E01898	Qayee Biotechnology	96T	EUR 361

Human Prefoldin Subunit 2 (PFDN2) ELISA Kit
RDR-PFDN2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Prefoldin Subunit 2 (PFDN2) ELISA Kit
RDR-PFDN2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Prefoldin Subunit 2 (PFDN2) ELISA Kit
RD-PFDN2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Prefoldin Subunit 2 (PFDN2) ELISA Kit
RD-PFDN2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

TCP1 theta antibody
70R-12926	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal TCP1 theta antibody

TCP1 epsilon antibody
70R-13321	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal TCP1 epsilon antibody

TCP1 epsilon antibody
70R-13346	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal TCP1 epsilon antibody

TCP1 beta antibody
70R-13480	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal TCP1 beta antibody

TCP1 Rabbit pAb
A13364-100ul	Abclonal	100 ul	EUR 308

TCP1 Rabbit pAb
A13364-200ul	Abclonal	200 ul	EUR 459

TCP1 Rabbit pAb
A13364-20ul	Abclonal	20 ul	EUR 183

TCP1 Rabbit pAb
A13364-50ul	Abclonal	50 ul	EUR 223

TCP1 epsilon antibody
10R-10382	Fitzgerald	100 ug	EUR 435
Description: Mouse monoclonal TCP1 epsilon antibody

TCP1 Blocking Peptide
DF6714-BP	Affbiotech	1mg	EUR 195

TCP1 zeta antibody
70R-49493	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal TCP1 zeta antibody

TCP1 theta antibody
70R-50824	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal TCP1 theta antibody

TCP1 epsilon antibody
70R-50876	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal TCP1 epsilon antibody

TCP1 theta Antibody
20-abx008312	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

TCP1 zeta Antibody
20-abx009481	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

TCP1 Conjugated Antibody
C43013	SAB	100ul	EUR 397

TCP1 Conjugated Antibody
C32517	SAB	100ul	EUR 397

TCP1 cloning plasmid
CSB-CL023320HU-10ug	Cusabio	10ug	EUR 577
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1671 Sequence: atggaggggcctttgtccgtgttcggtgaccgcagcactggggaaacgatccgctcccaaaacgttatggctgcagcttcgattgccaatattgtaaaaagttctcttggtccagttggcttggataaaatgttggtggatgatattggtgatgtaaccattactaacgatggtg Show more
Description: A cloning plasmid for the TCP1 gene.

TCP1 Rabbit pAb
A1950-100ul	Abclonal	100 ul	EUR 308

TCP1 Rabbit pAb
A1950-200ul	Abclonal	200 ul	EUR 459

TCP1 Rabbit pAb
A1950-20ul	Abclonal	20 ul	EUR 183

TCP1 Rabbit pAb
A1950-50ul	Abclonal	50 ul	EUR 223

anti- TCP1 antibody
FNab08563	FN Test	100µg	EUR 585
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 IF: 1:50 - 1:200 Immunogen: t-complex 1 Uniprot ID: P17987 Gene ID: 6950 Research Area: Metabolism
Description: Antibody raised against TCP1

Anti-TCP1 antibody
PAab08563	Lifescience Market	100 ug	EUR 412

pOTB7-TCP1 Plasmid
PVTB00130S	Lifescience Market	2 ug	EUR 356

Anti-TCP1 antibody
STJ25799	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a molecular chaperone that is a member of the chaperonin containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). This complex consists of two identical stacked rings, each containing eight different proteins. Unfolded polypeptides enter the central cavity of the complex and are folded in an ATP-dependent manner. The complex folds various proteins, including actin and tubulin. Alternate transcriptional splice variants of this gene, encoding different isoforms, have been characterized. In addition, three pseudogenes that appear to be derived from this gene have been found.

Anti-TCP1 antibody
STJ115327	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a molecular chaperone that is a member of the chaperonin containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). This complex consists of two identical stacked rings, each containing eight different proteins. Unfolded polypeptides enter the central cavity of the complex and are folded in an ATP-dependent manner. The complex folds various proteins, including actin and tubulin. Alternate transcriptional splice variants of this gene, encoding different isoforms, have been characterized. In addition, three pseudogenes that appear to be derived from this gene have been found.

Anti-TCP1 antibody
STJ70509	St John's Laboratory	100 µg	EUR 359

anti-TCP1 eta
YF-PA17072	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to TCP1 eta

anti-TCP1 eta
YF-PA17073	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to TCP1 eta

anti-TCP1 theta
YF-PA17168	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to TCP1 theta

anti-TCP1 alpha
YF-PA24821	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to TCP1 alpha

Human BRCA1/BRCA2 Containing Complex Subunit 3 (BRCC3) ELISA Kit
abx050248-96tests	Abbexa	96 tests	EUR 637
Shipped within 5-10 working days.

Human BRCA1/BRCA2 Containing Complex Subunit 3 (BRCC3) ELISA Kit
20-abx150837	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Katanin p80 WD40- containing subunit B1, KATNB1 ELISA KIT
ELI-21094h	Lifescience Market	96 Tests	EUR 824

Human BRCA1/BRCA2 Containing Complex Subunit 3 (BRCC3) ELISA Kit
SEN348Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5189.65
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human BRCA1/BRCA2 Containing Complex Subunit 3 (BRCC3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human BRCA1/BRCA2 Containing Complex Subunit 3 (BRCC3) in Tissue homogenates, cell lysates and other biological fluids.

Human BRCA1/BRCA2 Containing Complex Subunit 3 (BRCC3) ELISA Kit
SEN348Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 515.03
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human BRCA1/BRCA2 Containing Complex Subunit 3 (BRCC3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human BRCA1/BRCA2 Containing Complex Subunit 3 (BRCC3) in Tissue homogenates, cell lysates and other biological fluids.

Human BRCA1/BRCA2 Containing Complex Subunit 3 (BRCC3) ELISA Kit
SEN348Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 692.9
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human BRCA1/BRCA2 Containing Complex Subunit 3 (BRCC3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human BRCA1/BRCA2 Containing Complex Subunit 3 (BRCC3) in Tissue homogenates, cell lysates and other biological fluids.

Human BRCA1/BRCA2 Containing Complex Subunit 3 (BRCC3) ELISA Kit
SEN348Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2818.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human BRCA1/BRCA2 Containing Complex Subunit 3 (BRCC3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human BRCA1/BRCA2 Containing Complex Subunit 3 (BRCC3) in Tissue homogenates, cell lysates and other biological fluids.

Human BRCA1/BRCA2 Containing Complex Subunit 3 (BRCC3) ELISA Kit
4-SEN348Hu	Cloud-Clone	EUR 5240.00 EUR 2769.00 EUR 693.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as BRCA1/BRCA2 Containing Complex Subunit 3 elisa. Alternative names of the recognized antigen: C6.1A BRCC36 C6.1A CXorf53 Lys-63-specific deubiquitinase BRCC36 BRCA1-A complex subunit BRCC36 BRISC complex subunit BRCC36
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human BRCA1/BRCA2 Containing Complex Subunit 3 (BRCC3) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat CCT2 shRNA Plasmid
20-abx989008	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse CCT2 shRNA Plasmid
20-abx969536	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

pCR-BluntII-TOPO-CCT2
PVT18113	Lifescience Market	2 ug	EUR 231

CCT2 Recombinant Protein (Rat)
RP193808	ABM	100 ug	Ask for price

CCT2 Recombinant Protein (Mouse)
RP122300	ABM	100 ug	Ask for price

TCP1 ORF Vector (Human) (pORF)
ORF010395	ABM	1.0 ug DNA	EUR 95