Human CCT2(Chaperonin Containing TCP1, Subunit 2) ELISA Kit

Human CCT2(Chaperonin Containing TCP1, Subunit 2) ELISA Kit

To Order Contact us:  Mark@operatiebrp.nl

Human Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit

RDR-CCT2-Hu-96Tests 96 Tests
EUR 820

Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit

DLR-CCT2-Mu-48T 48T
EUR 566
  • Should the Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) in samples from tissue homogenates or other biological fluids.

Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit

DLR-CCT2-Mu-96T 96T
EUR 741
  • Should the Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) in samples from tissue homogenates or other biological fluids.

Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit

RD-CCT2-Mu-48Tests 48 Tests
EUR 577

Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit

RD-CCT2-Mu-96Tests 96 Tests
EUR 802

Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit

RDR-CCT2-Mu-48Tests 48 Tests
EUR 603

Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit

RDR-CCT2-Mu-96Tests 96 Tests
EUR 840

Chaperonin Containing TCP1, Subunit 2 (CCT2) Antibody

20-abx128398
  • EUR 453.00
  • EUR 133.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Chaperonin Containing TCP1, Subunit 2 (CCT2) Antibody

abx146184-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Chaperonin Containing TCP1, Subunit 2 (CCT2) Antibody

abx015792-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

Chaperonin Containing TCP1, Subunit 2 (CCT2) Antibody

20-abx175787
  • EUR 1344.00
  • EUR 634.00
  • 1 mg
  • 200 ug
  • Please enquire.

Chaperonin Containing TCP1, Subunit 2 (CCT2) Antibody

20-abx175788
  • EUR 1344.00
  • EUR 634.00
  • 1 mg
  • 200 ug
  • Please enquire.

Chaperonin Containing TCP1, Subunit 2 (CCT2) Antibody

abx231396-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Chaperonin Containing TCP1, Subunit 2 (CCT2) Antibody

20-abx171675
  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Chaperonin Containing TCP1, Subunit 2 (CCT2)

4-RPL292Hu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P78371
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 56.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Chaperonin Containing TCP1, Subunit 2 expressed in: E.coli

Human Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit

SEL292Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Chaperonin Containing TCP1, Subunit 2 (CCT2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inte
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Chaperonin Containing TCP1, Subunit 2 (CCT2) in Tissue homogenates, cell lysates and other biological fluids.

Human Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit

SEL292Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Chaperonin Containing TCP1, Subunit 2 (CCT2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inte
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Chaperonin Containing TCP1, Subunit 2 (CCT2) in Tissue homogenates, cell lysates and other biological fluids.

Human Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit

SEL292Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Chaperonin Containing TCP1, Subunit 2 (CCT2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inte
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Chaperonin Containing TCP1, Subunit 2 (CCT2) in Tissue homogenates, cell lysates and other biological fluids.

Human Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit

SEL292Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Chaperonin Containing TCP1, Subunit 2 (CCT2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inte
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Chaperonin Containing TCP1, Subunit 2 (CCT2) in Tissue homogenates, cell lysates and other biological fluids.

Human Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit

4-SEL292Hu
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Chaperonin Containing TCP1, Subunit 2 elisa. Alternative names of the recognized antigen: CCT-beta
  • CCTB
  • TCP-1-beta
  • T-Complex Protein 1 Subunit Beta
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Chaperonin Containing TCP1, Subunit 2 (CCT2) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Chaperonin Containing TCP1, Subunit 2 (CCT2) Protein

20-abx167032
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit

SEL292Mu-10x96wellstestplate 10x96-wells test plate
EUR 5333.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inte
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) in Tissue homogenates and other biological fluids.

Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit

SEL292Mu-1x48wellstestplate 1x48-wells test plate
EUR 526.89
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inte
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) in Tissue homogenates and other biological fluids.

Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit

SEL292Mu-1x96wellstestplate 1x96-wells test plate
EUR 709.84
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inte
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) in Tissue homogenates and other biological fluids.

Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit

SEL292Mu-5x96wellstestplate 5x96-wells test plate
EUR 2894.28
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inte
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) in Tissue homogenates and other biological fluids.

Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit

4-SEL292Mu
  • EUR 5384.00
  • EUR 2845.00
  • EUR 710.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Chaperonin Containing TCP1, Subunit 2 elisa. Alternative names of the recognized antigen: CCT-beta
  • CCTB
  • TCP-1-beta
  • T-Complex Protein 1 Subunit Beta
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Chaperonin Containing TCP1, Subunit 2 (CCT2) CLIA Kit

20-abx495908
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human CCT2 (Chaperonin Containing TCP1, Subunit 2)

ELK6962 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Chaperonin Containing TCP1, Subunit 2 (CCT2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody s
  • Show more
Description: A sandwich ELISA kit for detection of Chaperonin Containing TCP1, Subunit 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) Protein

20-abx652852
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) Protein

20-abx652853
  • EUR 718.00
  • EUR 286.00
  • EUR 2221.00
  • EUR 857.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) CLIA Kit

20-abx495909
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Mouse CCT2 (Chaperonin Containing TCP1, Subunit 2)

ELK8023 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Chaperonin Containing TCP1, Subunit 2 (CCT2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody s
  • Show more
Description: A sandwich ELISA kit for detection of Chaperonin Containing TCP1, Subunit 2 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Chaperonin Containing TCP1, Subunit 2 (CCT2) Polyclonal Antibody (Human, Mouse)

4-PAL292Hu01
  • EUR 262.00
  • EUR 2747.00
  • EUR 679.00
  • EUR 331.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCT2 (Met1~Cys488)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2)

Chaperonin Containing TCP1, Subunit 2 (CCT2) Polyclonal Antibody (Human, Mouse), APC

4-PAL292Hu01-APC
  • EUR 368.00
  • EUR 3599.00
  • EUR 993.00
  • EUR 472.00
  • EUR 229.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCT2 (Met1~Cys488)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2). This antibody is labeled with APC.

Chaperonin Containing TCP1, Subunit 2 (CCT2) Polyclonal Antibody (Human, Mouse), Biotinylated

4-PAL292Hu01-Biotin
  • EUR 328.00
  • EUR 2697.00
  • EUR 786.00
  • EUR 404.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCT2 (Met1~Cys488)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2). This antibody is labeled with Biotin.

Chaperonin Containing TCP1, Subunit 2 (CCT2) Polyclonal Antibody (Human, Mouse), Cy3

4-PAL292Hu01-Cy3
  • EUR 449.00
  • EUR 4757.00
  • EUR 1283.00
  • EUR 588.00
  • EUR 264.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCT2 (Met1~Cys488)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2). This antibody is labeled with Cy3.

Chaperonin Containing TCP1, Subunit 2 (CCT2) Polyclonal Antibody (Human, Mouse), FITC

4-PAL292Hu01-FITC
  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCT2 (Met1~Cys488)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2). This antibody is labeled with FITC.

Chaperonin Containing TCP1, Subunit 2 (CCT2) Polyclonal Antibody (Human, Mouse), HRP

4-PAL292Hu01-HRP
  • EUR 335.00
  • EUR 3135.00
  • EUR 877.00
  • EUR 426.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCT2 (Met1~Cys488)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2). This antibody is labeled with HRP.

Chaperonin Containing TCP1, Subunit 2 (CCT2) Polyclonal Antibody (Human, Mouse), PE

4-PAL292Hu01-PE
  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCT2 (Met1~Cys488)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2). This antibody is labeled with PE.

Chaperonin Containing TCP1, Subunit 2 (CCT2) Polyclonal Antibody (Human, Mouse), APC-Cy7

4-PAL292Hu01-APC-Cy7
  • EUR 616.00
  • EUR 7078.00
  • EUR 1867.00
  • EUR 824.00
  • EUR 338.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCT2 (Met1~Cys488)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2). This antibody is labeled with APC-Cy7.

Chaperonin Containing TCP1, Subunit 3 (CCT3) Antibody

20-abx111563
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Chaperonin Containing TCP1, Subunit 4 (CCT4) Antibody

20-abx111564
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Chaperonin Containing TCP1, Subunit 5 (CCT5) Antibody

20-abx111565
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Chaperonin Containing TCP1, Subunit 6A (CCT6A) Antibody

20-abx111566
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Chaperonin Containing TCP1, Subunit 6B (CCT6B) Antibody

20-abx111567
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Chaperonin Containing TCP1, Subunit 7 (CCT7) Antibody

20-abx111568
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Chaperonin Containing TCP1, Subunit 8 (CCT8) Antibody

20-abx111569
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Chaperonin Containing TCP1, Subunit 6B (CCT6B) Antibody

abx146187-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Chaperonin Containing TCP1, Subunit 4 (CCT4) Antibody

abx146193-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Chaperonin Containing TCP1, Subunit 3 (CCT3) Antibody

abx146205-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Chaperonin Containing TCP1, Subunit 7 (CCT7) Antibody

abx146230-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Chaperonin Containing TCP1, Subunit 8 (CCT8) Antibody

20-abx325666
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Chaperonin Containing TCP1, Subunit 6A (CCT6A) Antibody

20-abx328411
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Chaperonin Containing TCP1, Subunit 6A (CCT6A) Antibody

abx330610-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Chaperonin Containing TCP1, Subunit 7 (CCT7) Antibody

abx413783-01mg 0.1 mg
EUR 495
  • Shipped within 1 week.

Chaperonin Containing TCP1, Subunit 3 (CCT3) Antibody

abx430056-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Chaperonin Containing TCP1, Subunit 6B (CCT6B) Antibody

20-abx301582
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Chaperonin Containing TCP1, Subunit 3 (CCT3) Antibody

abx231397-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Chaperonin Containing TCP1, Subunit 3 (CCT3) Antibody

abx231398-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Chaperonin Containing TCP1, Subunit 6B (CCT6B) Antibody

abx231402-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Chaperonin Containing TCP1, Subunit 7 (CCT7) Antibody

abx231403-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Chaperonin Containing TCP1, Subunit 6B (CCT6B) Antibody (HRP)

20-abx309773
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Chaperonin Containing TCP1, Subunit 6B (CCT6B) Antibody (FITC)

20-abx309774
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Chaperonin Containing TCP1, Subunit 6B (CCT6B) Antibody (Biotin)

20-abx309775
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-TCP1 beta/CCT2 Antibody

PB9992 100ug/vial
EUR 334

Cct2/ Rat Cct2 ELISA Kit

ELI-51953r 96 Tests
EUR 886

CCT2 ELISA KIT|Human

EF008478 96 Tests
EUR 689

Tcp1/ Rat Tcp1 ELISA Kit

ELI-41942r 96 Tests
EUR 886

TCP1 ELISA KIT|Human

EF003503 96 Tests
EUR 689

Anti-TCP1 eta/CCT7 Antibody

A08169-2 100ug/vial
EUR 294

Human T- complex protein 1 subunit beta, CCT2 ELISA KIT

ELI-13747h 96 Tests
EUR 824

Human T-Complex Protein 1 Subunit Beta (CCT2) ELISA Kit

20-abx150988
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Human T- complex protein 1 subunit alpha, TCP1 ELISA KIT

ELI-17403h 96 Tests
EUR 824

Human Chaperonin 10 ELISA kit

E01C0815-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Chaperonin 10 ELISA kit

E01C0815-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Chaperonin 10 ELISA kit

E01C0815-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Bovine T- complex protein 1 subunit beta, CCT2 ELISA KIT

ELI-18861b 96 Tests
EUR 928

Mouse T- complex protein 1 subunit beta, Cct2 ELISA KIT

ELI-41400m 96 Tests
EUR 865

Mouse T-Complex Protein 1 Subunit Beta (CCT2) ELISA Kit

20-abx153795
  • EUR 7504.00
  • EUR 3996.00
  • EUR 926.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human T-complex protein 1 subunit beta (CCT2)

1-CSB-YP004856HU
  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 59.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human T-complex protein 1 subunit beta(CCT2) expressed in Yeast

Human T-complex protein 1 subunit beta (CCT2)

1-CSB-EP004856HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 73.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human T-complex protein 1 subunit beta(CCT2) expressed in E.coli

Human chaperonin 10,CPN10 ELISA kit

E01C2306-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human chaperonin 10,CPN10 ELISA kit

E01C2306-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human chaperonin 10,CPN10 ELISA kit

E01C2306-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human chaperonin 10(CPN10)ELISA Kit

GA-E0690HM-48T 48T
EUR 289

Human chaperonin 10(CPN10)ELISA Kit

GA-E0690HM-96T 96T
EUR 466

Human Chaperonin 10 (CPN10) ELISA Kit

abx052001-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Human Chaperonin 10 (CPN10) ELISA Kit

abx351409-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Human chaperonin 10,CPN10 ELISA Kit

201-12-0674 96 tests
EUR 440
  • This chaperonin 10 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human chaperonin 10, CPN10 ELISA Kit

CSB-E09917h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human chaperonin 10, CPN10 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human chaperonin 10, CPN10 ELISA Kit

1-CSB-E09917h
  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human chaperonin 10, CPN10 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human chaperonin 10,CPN10 ELISA Kit

CN-03950H1 96T
EUR 464

Human chaperonin 10,CPN10 ELISA Kit

CN-03950H2 48T
EUR 313

Human chaperonin 10(CPN10)ELISA Kit

QY-E04180 96T
EUR 394

Bovine T- complex protein 1 subunit alpha, TCP1 ELISA KIT

ELI-41835b 96 Tests
EUR 928

Mouse T- complex protein 1 subunit alpha, Tcp1 ELISA KIT

ELI-41836m 96 Tests
EUR 865

Goat Chaperonin 10 ELISA kit

E06C0815-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Chaperonin 10 ELISA kit

E06C0815-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Chaperonin 10 ELISA kit

E06C0815-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Chaperonin 10 ELISA kit

E02C0815-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Chaperonin 10 ELISA kit

E02C0815-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Chaperonin 10 ELISA kit

E02C0815-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Chaperonin 10 ELISA kit

E03C0815-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Chaperonin 10 ELISA kit

E03C0815-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Chaperonin 10 ELISA kit

E03C0815-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Chaperonin 10 ELISA kit

E04C0815-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Chaperonin 10 ELISA kit

E04C0815-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Chaperonin 10 ELISA kit

E04C0815-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Chaperonin 10 ELISA kit

E07C0815-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Chaperonin 10 ELISA kit

E07C0815-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Chaperonin 10 ELISA kit

E07C0815-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Chaperonin 10 ELISA kit

E08C0815-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Chaperonin 10 ELISA kit

E08C0815-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Chaperonin 10 ELISA kit

E08C0815-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Chaperonin 10 ELISA kit

E09C0815-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Chaperonin 10 ELISA kit

E09C0815-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Chaperonin 10 ELISA kit

E09C0815-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CCT2 siRNA

20-abx900891
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CCT2 Antibody

BF0056 200ul
EUR 376
Description: CCT2 antibody detects endogenous levels of total CCT2.

CCT2 siRNA

20-abx910899
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CCT2 siRNA

20-abx910900
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CCT2 antibody

38998-100ul 100ul
EUR 252

CCT2 Antibody

43067-100ul 100ul
EUR 252

CCT2 Antibody

1-CSB-PA004856ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CCT2. Recognizes CCT2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IP; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IP:1:200-1:2000

ELISA kit for Human CPN10 (Chaperonin 10)

E-EL-H0697 1 plate of 96 wells
EUR 534
  • Gentaur's CPN10 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human CPN10. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human CPN10 (Chaperonin 10) in samples from Serum, Plasma, Cell supernatant

Human T-Complex 1 (TCP1) ELISA Kit

20-abx383676
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

T-Complex Protein 1 Subunit Beta (CCT2) Antibody

abx011837-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

T-Complex Protein 1 Subunit Beta (CCT2) Antibody

20-abx005024
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

T-Complex Protein 1 Subunit Beta (CCT2) Antibody

20-abx321387
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

T-Complex Protein 1 Subunit Beta (CCT2) Antibody

20-abx225083
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

CCT2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0396403 1.0 ug DNA
EUR 154

Human CCT2 shRNA Plasmid

20-abx957196
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CCT2 Recombinant Protein (Human)

RP037867 100 ug Ask for price

CCT2 Recombinant Protein (Human)

RP037870 100 ug Ask for price

Monkey Chaperonin 10 (CPN10) ELISA Kit

abx359786-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Chaperonin 10 (CPN10) ELISA Kit

abx361563-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Chaperonin 10 (CPN10) ELISA Kit

abx363426-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Guinea pig Chaperonin 10 ELISA kit

E05C0815-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Chaperonin 10 ELISA kit

E05C0815-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Chaperonin 10 ELISA kit

E05C0815-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat chaperonin 10,CPN10 ELISA kit

E06C2306-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat chaperonin 10,CPN10 ELISA kit

E06C2306-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat chaperonin 10,CPN10 ELISA kit

E06C2306-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat chaperonin 10,CPN10 ELISA kit

E02C2306-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat chaperonin 10,CPN10 ELISA kit

E02C2306-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat chaperonin 10,CPN10 ELISA kit

E02C2306-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse chaperonin 10,CPN10 ELISA kit

E03C2306-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse chaperonin 10,CPN10 ELISA kit

E03C2306-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse chaperonin 10,CPN10 ELISA kit

E03C2306-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit chaperonin 10,CPN10 ELISA kit

E04C2306-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit chaperonin 10,CPN10 ELISA kit

E04C2306-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit chaperonin 10,CPN10 ELISA kit

E04C2306-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog chaperonin 10,CPN10 ELISA kit

E08C2306-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog chaperonin 10,CPN10 ELISA kit

E08C2306-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog chaperonin 10,CPN10 ELISA kit

E08C2306-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey chaperonin 10,CPN10 ELISA kit

E09C2306-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey chaperonin 10,CPN10 ELISA kit

E09C2306-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey chaperonin 10,CPN10 ELISA kit

E09C2306-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig chaperonin 10,CPN10 ELISA kit

E07C2306-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig chaperonin 10,CPN10 ELISA kit

E07C2306-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig chaperonin 10,CPN10 ELISA kit

E07C2306-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Sheep Chaperonin 10 (CPN10) ELISA Kit

abx364720-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.

Chicken Chaperonin 10 (CPN10) ELISA Kit

abx357010-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

TCP1 siRNA

20-abx905504
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TCP1 siRNA

20-abx936380
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TCP1 siRNA

20-abx936381
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TCP1 antibody

70R-20745 50 ul
EUR 435
Description: Rabbit polyclonal TCP1 antibody

TCP1 Antibody

ABD6714 100 ug
EUR 438

TCP1 Antibody

43013-100ul 100ul
EUR 252

TCP1 Antibody

32517-100ul 100ul
EUR 252

TCP1 Antibody

DF6714 200ul
EUR 304
Description: TCP1 Antibody detects endogenous levels of total TCP1.

TCP1 Antibody

1-CSB-PA050225
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TCP1. Recognizes TCP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

TCP1 Antibody

1-CSB-PA023320GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TCP1. Recognizes TCP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

TCP1 Antibody

1-CSB-PA023320LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TCP1. Recognizes TCP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:500-1:1000, IF:1:200-1:500

TCP1 sgRNA CRISPR Lentivector (Human) (Target 2)

K2351303 1.0 ug DNA
EUR 154

CCT2 Conjugated Antibody

C38998 100ul
EUR 397

CCT2 Conjugated Antibody

C43067 100ul
EUR 397

CCT2 Blocking Peptide

BF0056-BP 1mg
EUR 195

CCT2 cloning plasmid

CSB-CL004856HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1608
  • Sequence: atggcgtccctttcccttgcacctgttaacatctttaaggcaggagctgatgaagagagagcagagacagctcgtctgacttcttttattggtgccatcgccattggagacttggtaaagagcaccttgggacccaaaggcatggacaaaattcttctaagcagtggacgagatg
  • Show more
Description: A cloning plasmid for the CCT2 gene.

CCT2 cloning plasmid

CSB-CL004856HU2-10ug 10ug
EUR 560
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1608
  • Sequence: atggcgtccctttcccttgcacctgttaacatctttaaggcaggagctgatgaagagagagcagagacagctcgtctgacttcttttattggtgccatcgccattggagacttggtaaagagcaccttgggacccaaaggcatggacaaaattcttctaagcagtggacgagatg
  • Show more
Description: A cloning plasmid for the CCT2 gene.

anti- CCT2 antibody

FNab01396 100µg
EUR 548.75
  • Immunogen: chaperonin containing TCP1, subunit 2(beta)
  • Uniprot ID: P78371
  • Gene ID: 10576
  • Research Area: Metabolism
Description: Antibody raised against CCT2

CCT2 Rabbit pAb

A6546-100ul 100 ul
EUR 308

CCT2 Rabbit pAb

A6546-200ul 200 ul
EUR 459

CCT2 Rabbit pAb

A6546-20ul 20 ul
EUR 183

CCT2 Rabbit pAb

A6546-50ul 50 ul
EUR 223

Anti-CCT2 antibody

PAab01396 100 ug
EUR 386

anti-CCT2 (5B5F5)

LF-MA30629 100 ul
EUR 527
Description: Mouse Monoclonal to CCT2

anti-CCT2 (5B5C4)

LF-MA30637 100 ul
EUR 527
Description: Mouse Monoclonal to CCT2

pCR4-TOPO-CCT2

PVT18195 2 ug
EUR 231

Anti-CCT2 antibody

STJ28629 100 µl
EUR 277
Description: The protein encoded by this gene is a molecular chaperone that is a member of the chaperonin containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). This complex consists of two identical stacked rings, each containing eight different proteins. Unfolded polypeptides enter the central cavity of the complex and are folded in an ATP-dependent manner. The complex folds various proteins, including actin and tubulin. Two transcript variants encoding different isoforms have been found for this gene.

Human TCP1 shRNA Plasmid

20-abx954767
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TCP1 Recombinant Protein (Human)

RP031183 100 ug Ask for price

CCT2 ORF Vector (Human) (pORF)

ORF012623 1.0 ug DNA
EUR 354

CCT2 ORF Vector (Human) (pORF)

ORF012624 1.0 ug DNA
EUR 354

Guinea pig chaperonin 10,CPN10 ELISA kit

E05C2306-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig chaperonin 10,CPN10 ELISA kit

E05C2306-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig chaperonin 10,CPN10 ELISA kit

E05C2306-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

T-Complex Protein 1 Subunit Delta (TCP1 delta) Antibody

20-abx141878
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

T-Complex Protein 1 Subunit Epsilon (TCP1 epsilon) Antibody

20-abx008260
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

T-Complex Protein 1 Subunit Epsilon (TCP1 epsilon) Antibody

abx018169-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.

T-Complex Protein 1 Subunit Alpha (TCP1 alpha) Antibody

abx445087-100ug 100 ug
EUR 495
  • Shipped within 5-12 working days.

T-Complex Protein 1 Subunit Alpha (TCP1 alpha) Antibody

abx445088-100ug 100 ug
EUR 495
  • Shipped within 5-12 working days.

Cct2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7255603 1.0 ug DNA
EUR 154

Cct2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4936203 1.0 ug DNA
EUR 154

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Human Prefoldin subunit 2(PFDN2) ELISA kit

E01P0762-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Prefoldin subunit 2(PFDN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Prefoldin subunit 2(PFDN2) ELISA kit

E01P0762-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Prefoldin subunit 2(PFDN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Prefoldin subunit 2(PFDN2) ELISA kit

E01P0762-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Prefoldin subunit 2(PFDN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Prefoldin subunit 2, PFDN2 ELISA KIT

ELI-21566h 96 Tests
EUR 824

Human Dynactin subunit 2, DCTN2 ELISA KIT

ELI-32027h 96 Tests
EUR 824

Human Dynactin Subunit 2 (DCTN2) ELISA Kit

abx259549-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Prefoldin subunit 2 (PFDN2) ELISA Kit

20-abx382168
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human Prefoldin Subunit 2 (PFDN2) ELISA Kit

DLR-PFDN2-Hu-48T 48T
EUR 517
  • Should the Human Prefoldin Subunit 2 (PFDN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Prefoldin Subunit 2 (PFDN2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Prefoldin Subunit 2 (PFDN2) ELISA Kit

DLR-PFDN2-Hu-96T 96T
EUR 673
  • Should the Human Prefoldin Subunit 2 (PFDN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Prefoldin Subunit 2 (PFDN2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Prefoldin Subunit 2 (PFDN2) ELISA Kit

RD-PFDN2-Hu-48Tests 48 Tests
EUR 521

Human Prefoldin Subunit 2 (PFDN2) ELISA Kit

RD-PFDN2-Hu-96Tests 96 Tests
EUR 723

Human Prefoldin Subunit 2 (PFDN2) ELISA Kit

RDR-PFDN2-Hu-48Tests 48 Tests
EUR 544

Human Prefoldin Subunit 2 (PFDN2) ELISA Kit

RDR-PFDN2-Hu-96Tests 96 Tests
EUR 756

Human Prefoldin Subunit 2(PFDN2)ELISA Kit

QY-E01898 96T
EUR 361

TCP1 Conjugated Antibody

C43013 100ul
EUR 397

TCP1 Conjugated Antibody

C32517 100ul
EUR 397

TCP1 cloning plasmid

CSB-CL023320HU-10ug 10ug
EUR 577
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1671
  • Sequence: atggaggggcctttgtccgtgttcggtgaccgcagcactggggaaacgatccgctcccaaaacgttatggctgcagcttcgattgccaatattgtaaaaagttctcttggtccagttggcttggataaaatgttggtggatgatattggtgatgtaaccattactaacgatggtg
  • Show more
Description: A cloning plasmid for the TCP1 gene.

anti- TCP1 antibody

FNab08563 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: t-complex 1
  • Uniprot ID: P17987
  • Gene ID: 6950
  • Research Area: Metabolism
Description: Antibody raised against TCP1

TCP1 zeta Antibody

20-abx009481
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

TCP1 theta Antibody

20-abx008312
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

TCP1 zeta antibody

70R-49493 100 ul
EUR 244
Description: Purified Polyclonal TCP1 zeta antibody

TCP1 theta antibody

70R-50824 100 ul
EUR 244
Description: Purified Polyclonal TCP1 theta antibody

TCP1 epsilon antibody

70R-50876 100 ul
EUR 244
Description: Purified Polyclonal TCP1 epsilon antibody

TCP1 Rabbit pAb

A13364-100ul 100 ul
EUR 308

TCP1 Rabbit pAb

A13364-200ul 200 ul
EUR 459

TCP1 Rabbit pAb

A13364-20ul 20 ul
EUR 183

TCP1 Rabbit pAb

A13364-50ul 50 ul
EUR 223

TCP1 Rabbit pAb

A1950-100ul 100 ul
EUR 308

TCP1 Rabbit pAb

A1950-200ul 200 ul
EUR 459

TCP1 Rabbit pAb

A1950-20ul 20 ul
EUR 183

TCP1 Rabbit pAb

A1950-50ul 50 ul
EUR 223

TCP1 epsilon antibody

10R-10382 100 ug
EUR 435
Description: Mouse monoclonal TCP1 epsilon antibody

TCP1 theta antibody

70R-12926 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal TCP1 theta antibody

TCP1 epsilon antibody

70R-13321 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal TCP1 epsilon antibody

TCP1 epsilon antibody

70R-13346 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal TCP1 epsilon antibody

TCP1 beta antibody

70R-13480 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal TCP1 beta antibody

TCP1 Blocking Peptide

DF6714-BP 1mg
EUR 195

Anti-TCP1 antibody

PAab08563 100 ug
EUR 412

pOTB7-TCP1 Plasmid

PVTB00130S 2 ug
EUR 356

Anti-TCP1 antibody

STJ70509 100 µg
EUR 359

Anti-TCP1 antibody

STJ25799 100 µl
EUR 277
Description: The protein encoded by this gene is a molecular chaperone that is a member of the chaperonin containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). This complex consists of two identical stacked rings, each containing eight different proteins. Unfolded polypeptides enter the central cavity of the complex and are folded in an ATP-dependent manner. The complex folds various proteins, including actin and tubulin. Alternate transcriptional splice variants of this gene, encoding different isoforms, have been characterized. In addition, three pseudogenes that appear to be derived from this gene have been found.

Anti-TCP1 antibody

STJ115327 100 µl
EUR 277
Description: The protein encoded by this gene is a molecular chaperone that is a member of the chaperonin containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). This complex consists of two identical stacked rings, each containing eight different proteins. Unfolded polypeptides enter the central cavity of the complex and are folded in an ATP-dependent manner. The complex folds various proteins, including actin and tubulin. Alternate transcriptional splice variants of this gene, encoding different isoforms, have been characterized. In addition, three pseudogenes that appear to be derived from this gene have been found.

anti-TCP1 alpha

YF-PA24821 50 ul
EUR 334
Description: Mouse polyclonal to TCP1 alpha

anti-TCP1 eta

YF-PA17072 50 ul
EUR 363
Description: Mouse polyclonal to TCP1 eta

anti-TCP1 eta

YF-PA17073 100 ul
EUR 403
Description: Rabbit polyclonal to TCP1 eta

anti-TCP1 theta

YF-PA17168 50 ug
EUR 363
Description: Mouse polyclonal to TCP1 theta

Human Katanin p80 WD40- containing subunit B1, KATNB1 ELISA KIT

ELI-21094h 96 Tests
EUR 824

Human BRCA1/BRCA2 Containing Complex Subunit 3 (BRCC3) ELISA Kit

20-abx150837
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human BRCA1/BRCA2 Containing Complex Subunit 3 (BRCC3) ELISA Kit

abx050248-96tests 96 tests
EUR 637
  • Shipped within 5-10 working days.

Human BRCA1/BRCA2 Containing Complex Subunit 3 (BRCC3) ELISA Kit

SEN348Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human BRCA1/BRCA2 Containing Complex Subunit 3 (BRCC3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human BRCA1/BRCA2 Containing Complex Subunit 3 (BRCC3) in Tissue homogenates, cell lysates and other biological fluids.

Human BRCA1/BRCA2 Containing Complex Subunit 3 (BRCC3) ELISA Kit

SEN348Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human BRCA1/BRCA2 Containing Complex Subunit 3 (BRCC3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human BRCA1/BRCA2 Containing Complex Subunit 3 (BRCC3) in Tissue homogenates, cell lysates and other biological fluids.

Human BRCA1/BRCA2 Containing Complex Subunit 3 (BRCC3) ELISA Kit

SEN348Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human BRCA1/BRCA2 Containing Complex Subunit 3 (BRCC3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human BRCA1/BRCA2 Containing Complex Subunit 3 (BRCC3) in Tissue homogenates, cell lysates and other biological fluids.

Human BRCA1/BRCA2 Containing Complex Subunit 3 (BRCC3) ELISA Kit

SEN348Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human BRCA1/BRCA2 Containing Complex Subunit 3 (BRCC3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human BRCA1/BRCA2 Containing Complex Subunit 3 (BRCC3) in Tissue homogenates, cell lysates and other biological fluids.

Human BRCA1/BRCA2 Containing Complex Subunit 3 (BRCC3) ELISA Kit

4-SEN348Hu
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as BRCA1/BRCA2 Containing Complex Subunit 3 elisa. Alternative names of the recognized antigen: C6.1A
  • BRCC36
  • C6.1A
  • CXorf53
  • Lys-63-specific deubiquitinase BRCC36
  • BRCA1-A complex subunit BRCC36
  • BRISC complex subunit BRCC36
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human BRCA1/BRCA2 Containing Complex Subunit 3 (BRCC3) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat CCT2 shRNA Plasmid

20-abx989008
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse CCT2 shRNA Plasmid

20-abx969536
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pCR-BluntII-TOPO-CCT2

PVT18113 2 ug
EUR 231

CCT2 Recombinant Protein (Rat)

RP193808 100 ug Ask for price

CCT2 Recombinant Protein (Mouse)

RP122300 100 ug Ask for price

TCP1 ORF Vector (Human) (pORF)

ORF010395 1.0 ug DNA
EUR 95

CCT2 sgRNA CRISPR Lentivector set (Human)

K0396401 3 x 1.0 ug
EUR 339

T-Complex Protein 1 Subunit Alpha (TCP1 alpha) Antibody (ALP)

abx442484-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

T-Complex Protein 1 Subunit Alpha (TCP1 alpha) Antibody (ALP)

abx442485-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.