Rat RPA1(Replication Protein A1) ELISA Kit

Rat RPA1(Replication Protein A1) ELISA Kit

To Order Contact us: Mark@operatiebrp.nl

Rat Replication Protein A1 (RPA1) ELISA Kit
RDR-RPA1-Ra-48Tests	Reddot Biotech	48 Tests	EUR 583

Rat Replication Protein A1 (RPA1) ELISA Kit
RDR-RPA1-Ra-96Tests	Reddot Biotech	96 Tests	EUR 811

Rat Replication Protein A1 (RPA1) ELISA Kit
RD-RPA1-Ra-48Tests	Reddot Biotech	48 Tests	EUR 557

Rat Replication Protein A1 (RPA1) ELISA Kit
RD-RPA1-Ra-96Tests	Reddot Biotech	96 Tests	EUR 775

Human Replication Protein A1 (RPA1) ELISA Kit
DLR-RPA1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Replication Protein A1 (RPA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Replication Protein A1 (RPA1) in samples from tissue homogenates or other biological fluids.

Human Replication Protein A1 (RPA1) ELISA Kit
DLR-RPA1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Replication Protein A1 (RPA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Replication Protein A1 (RPA1) in samples from tissue homogenates or other biological fluids.

Human Replication Protein A1 (RPA1) ELISA Kit
RDR-RPA1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Replication Protein A1 (RPA1) ELISA Kit
RDR-RPA1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Replication Protein A1 (RPA1) ELISA Kit
RD-RPA1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Replication Protein A1 (RPA1) ELISA Kit
RD-RPA1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Rat Replication Protein A1 (RPA1) ELISA Kit
20-abx156054	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Rat Replication Protein A1 (RPA1) ELISA Kit
SEH217Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5124.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Replication Protein A1 (RPA1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Replication Protein A1 (RPA1) in Tissue homogenates, cell lysates and other biological fluids.

Rat Replication Protein A1 (RPA1) ELISA Kit
SEH217Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 509.64
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Replication Protein A1 (RPA1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Replication Protein A1 (RPA1) in Tissue homogenates, cell lysates and other biological fluids.

Rat Replication Protein A1 (RPA1) ELISA Kit
SEH217Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 685.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Replication Protein A1 (RPA1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Replication Protein A1 (RPA1) in Tissue homogenates, cell lysates and other biological fluids.

Rat Replication Protein A1 (RPA1) ELISA Kit
SEH217Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2783.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Replication Protein A1 (RPA1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Replication Protein A1 (RPA1) in Tissue homogenates, cell lysates and other biological fluids.

Rat Replication Protein A1 (RPA1) ELISA Kit
4-SEH217Ra	Cloud-Clone	EUR 5175.00 EUR 2734.00 EUR 686.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Replication Protein A1 elisa. Alternative names of the recognized antigen: HSSB REPA1 RF-A RP-A RPA70 Replication protein A 70 kDa DNA-binding subunit Single-stranded DNA-binding protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Replication Protein A1 (RPA1) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rat Replication Protein A1 (RPA1) Protein
20-abx654943	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Rat Replication Protein A1 (RPA1) CLIA Kit
20-abx495409	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Replication Protein A1 (RPA1) Antibody
20-abx007829	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Replication Protein A1 (RPA1) Antibody
abx010302-100ug	Abbexa	100 ug	EUR 411
Shipped within 5-10 working days.

Replication Protein A1 (RPA1) Antibody
abx028041-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Replication Protein A1 (RPA1) Antibody
abx028041-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Replication Protein A1 (RPA1) Antibody
20-abx178250	Abbexa	EUR 1205.00 EUR 578.00	1 mg 200 ug
Please enquire.

Replication Protein A1 (RPA1) Antibody
20-abx178251	Abbexa	EUR 1302.00 EUR 620.00	1 mg 200 ug
Please enquire.

Replication Protein A1 (RPA1) Antibody
abx159678-100ul	Abbexa	100 ul	EUR 467
Shipped within 5-10 working days.

Replication Protein A1 (RPA1) Antibody
20-abx174378	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Replication Protein A1 (RPA1) Antibody
20-abx174379	Abbexa	EUR 913.00 EUR 467.00	1 mg 200 ug
Please enquire.

Replication Protein A1 (RPA1) Antibody
abx237391-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Replication Protein A1 (RPA1) Antibody
20-abx301840	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Replication Protein A1 (RPA1) Antibody
20-abx000943	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

ELISA kit for Rat RPA1 (Replication Protein A1)
ELK6959	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Replication Protein A1 (RPA1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Repl Show more
Description: A sandwich ELISA kit for detection of Replication Protein A1 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Replication Protein A1 (RPA1) ELISA Kit
20-abx152981	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Pig Replication Protein A1 (RPA1) ELISA Kit
abx360874-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Monkey Replication Protein A1 (RPA1) ELISA Kit
abx358961-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Chicken Replication Protein A1 (RPA1) ELISA Kit
abx355854-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Replication Protein A1 (RPA1) ELISA Kit
abx363576-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Replication Protein A1 (RPA1) ELISA Kit
abx573009-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Human Replication Protein A1 (RPA1) ELISA Kit
SEH217Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Protein A1 (RPA1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Protein A1 (RPA1) in Tissue homogenates and other biological fluids.

Human Replication Protein A1 (RPA1) ELISA Kit
SEH217Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Protein A1 (RPA1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Protein A1 (RPA1) in Tissue homogenates and other biological fluids.

Human Replication Protein A1 (RPA1) ELISA Kit
SEH217Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Protein A1 (RPA1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Protein A1 (RPA1) in Tissue homogenates and other biological fluids.

Human Replication Protein A1 (RPA1) ELISA Kit
SEH217Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Protein A1 (RPA1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Protein A1 (RPA1) in Tissue homogenates and other biological fluids.

Human Replication Protein A1 (RPA1) ELISA Kit
4-SEH217Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Replication Protein A1 elisa. Alternative names of the recognized antigen: HSSB REPA1 RF-A RP-A RPA70 Replication protein A 70 kDa DNA-binding subunit Single-stranded DNA-binding protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Replication Protein A1 (RPA1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Replication Protein A1 (RPA1) Protein
20-abx654942	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Replication Protein A1 (RPA1) Antibody (HRP)
20-abx315981	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Replication Protein A1 (RPA1) Antibody (FITC)
20-abx315982	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Replication Protein A1 (RPA1) Antibody (Biotin)
20-abx315983	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

ELISA kit for Human RPA1 (Replication protein A1)
E-EL-H1282	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's RPA1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human RPA1. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human RPA1 (Replication protein A1) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human RPA1 (Replication Protein A1)
ELK4413	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Replication Protein A1 (RPA1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Repl Show more
Description: A sandwich ELISA kit for detection of Replication Protein A1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Replication Protein A1 (RPA1) CLIA Kit
20-abx495408	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Rat Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit
E02R0418-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit
E02R0418-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit
E02R0418-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Rat Replication protein A 70 kDa DNA-binding subunit (RPA1)
KTE100972-48T	Abbkine	48T	EUR 332
Replication protein A (RPA) is a 3-subunit single-stranded DNA (ssDNA)-binding protein that has been isolated from human cells and found to be essential for in vitro replication of the papovavirus SV40. The human cDNA directed production in E. coli o Show more
Description: Quantitative sandwich ELISA for measuring Rat Replication protein A 70 kDa DNA-binding subunit (RPA1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Replication protein A 70 kDa DNA-binding subunit (RPA1)
KTE100972-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Replication protein A (RPA) is a 3-subunit single-stranded DNA (ssDNA)-binding protein that has been isolated from human cells and found to be essential for in vitro replication of the papovavirus SV40. The human cDNA directed production in E. coli o Show more
Description: Quantitative sandwich ELISA for measuring Rat Replication protein A 70 kDa DNA-binding subunit (RPA1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Replication protein A 70 kDa DNA-binding subunit (RPA1)
KTE100972-96T	Abbkine	96T	EUR 539
Replication protein A (RPA) is a 3-subunit single-stranded DNA (ssDNA)-binding protein that has been isolated from human cells and found to be essential for in vitro replication of the papovavirus SV40. The human cDNA directed production in E. coli o Show more
Description: Quantitative sandwich ELISA for measuring Rat Replication protein A 70 kDa DNA-binding subunit (RPA1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Replication Protein A1, 70 kDa Antibody
20-abx115128	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Rabbit Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit
E04R0418-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit
E04R0418-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit
E04R0418-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit
E03R0418-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit
E03R0418-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit
E03R0418-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit
E01R0418-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit
E01R0418-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit
E01R0418-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit
E06R0418-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit
E06R0418-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit
E06R0418-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit
E08R0418-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit
E08R0418-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit
E08R0418-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit
E09R0418-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit
E09R0418-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit
E09R0418-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit
E07R0418-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit
E07R0418-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit
E07R0418-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Replication protein A 70KDA DNA-binding subunit (RPA1)
1-CSB-EP020088HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 84 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Replication protein A 70KDA DNA-binding subunit(RPA1) expressed in E.coli

RPA1 ELISA Kit (Rat) (OKCD04510)
OKCD04510	Aviva Systems Biology	96 Wells	EUR 936
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.128 ng/mL

Guinea pig Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit
E05R0418-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit
E05R0418-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit
E05R0418-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

RPA1 Recombinant Protein (Rat)
RP226547	ABM	100 ug	Ask for price

Human RPA1 ELISA KIT
ELI-14555h	Lifescience Market	96 Tests	EUR 824

Mouse Rpa1 ELISA KIT
ELI-30131m	Lifescience Market	96 Tests	EUR 865

RPA1 ELISA KIT\|Human
EF002550	Lifescience Market	96 Tests	EUR 689

Chicken RPA1 ELISA KIT
ELI-41192c	Lifescience Market	96 Tests	EUR 928

RPA1 ELISA Kit (Human) (OKCD01948)
OKCD01948	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: As part of the heterotrimeric replication protein A complex (RPA/RP-A), binds and stabilizes single-stranded DNA intermediates, that form during DNA replication or upon DNA stress. It prevents their reannealing and in parallel, recruits and activates different proteins and complexes involved in DNA metabolism. Thereby, it plays an essential role both in DNA replication and the cellular response to DNA damage.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.106 ng/mL

RPA1 ELISA Kit (Mouse) (OKEH07912)
OKEH07912	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.24ng/mL

apo-A1/ Rat apo- A1 ELISA Kit
ELA-E0604r	Lifescience Market	96 Tests	EUR 886

Rat apolipoprotein A1 (Apo-A1) ELISA Kit
CSB-E08105r-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat apolipoprotein A1 (Apo-A1) in samples from serum, plasma, bronchoalveolarlavagefluid, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rat apolipoprotein A1 (Apo-A1) ELISA Kit
1-CSB-E08105r	Cusabio	EUR 967.00 EUR 5925.00 EUR 3134.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat apolipoprotein A1 (Apo-A1) in samples from serum, plasma, bronchoalveolarlavagefluid, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat apoprotein A1,apo-A1 ELISA Kit
CN-01444R1	ChemNorm	96T	EUR 434

Rat apoprotein A1,apo-A1 ELISA Kit
CN-01444R2	ChemNorm	48T	EUR 284

Rat apoprotein A1(apo-A1)ELISA Kit
GA-E0751RT-48T	GenAsia Biotech	48T	EUR 317

Rat apoprotein A1(apo-A1)ELISA Kit
GA-E0751RT-96T	GenAsia Biotech	96T	EUR 496

Rat apoprotein A1(apo-A1)ELISA Kit
QY-E10901	Qayee Biotechnology	96T	EUR 361

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Replication Protein A2 (RPA2) ELISA Kit
abx595526-96tests	Abbexa	96 tests	EUR 637
Shipped within 1-2 weeks.

Rat Replication Initiator 1 (REPIN1) ELISA Kit
abx391903-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rat Replication Initiator 1(REPIN1)ELISA Kit
QY-E10499	Qayee Biotechnology	96T	EUR 361

Repin1 ELISA Kit\| Rat Replication initiator 1 ELISA Kit
EF019263	Lifescience Market	96 Tests	EUR 689

RPA1 antibody
70R-19947	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal RPA1 antibody

RPA1 antibody
38162-100ul	SAB	100ul	EUR 252

RPA1 antibody
10R-1208	Fitzgerald	100 ug	EUR 512
Description: Mouse monoclonal RPA1 antibody

RPA1 Antibody
DF6172	Affbiotech	200ul	EUR 304
Description: RPA1 Antibody detects endogenous levels of total RPA1.

RPA1 antibody
70R-51326	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal RPA1 antibody

RPA1 antibody
70R-5545	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal RPA1 antibody raised against the middle region of RPA1

RPA1 antibody
70R-5546	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal RPA1 antibody raised against the middle region of RPA1

RPA1 Antibody
BF0367	Affbiotech	200ul	EUR 376
Description: RPA1 antibody detects endogenous levels of total RPA1.

RPA1 Antibody
1-CSB-PA020088GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20â„ƒ, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RPA1. Recognizes RPA1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RPA1 Antibody
1-CSB-PA020088LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPA1. Recognizes RPA1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:200-1:3000, IHC:1:20-1:200

RPA1 siRNA
20-abx931869	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RPA1 siRNA
20-abx931870	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RPA1 Antibody
ABD6172	Lifescience Market	100 ug	EUR 438

Rat Phospholipase A1 ELISA kit
E02P0124-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Phospholipase A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Phospholipase A1 ELISA kit
E02P0124-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Phospholipase A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Phospholipase A1 ELISA kit
E02P0124-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Phospholipase A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ephrin A1 ELISA kit
E02E0042-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Ephrin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ephrin A1 ELISA kit
E02E0042-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Ephrin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ephrin A1 ELISA kit
E02E0042-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Ephrin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Immunoglobulin A1 ELISA kit
E02I0016-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Immunoglobulin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Immunoglobulin A1 ELISA kit
E02I0016-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Immunoglobulin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Immunoglobulin A1 ELISA kit
E02I0016-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Immunoglobulin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Annexin A1 ELISA kit
E02A0208-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Annexin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Annexin A1 ELISA kit
E02A0208-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Annexin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Annexin A1 ELISA kit
E02A0208-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Annexin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Apolipoprotein A1 ELISA kit
E02A0509-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Apolipoprotein A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Apolipoprotein A1 ELISA kit
E02A0509-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Apolipoprotein A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Apolipoprotein A1 ELISA kit
E02A0509-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Apolipoprotein A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat a1 microglobulin ELISA kit
E02A0689-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat a1 microglobulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat a1 microglobulin ELISA kit
E02A0689-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat a1 microglobulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat a1 microglobulin ELISA kit
E02A0689-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat a1 microglobulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat A1-AGP ELISA Kit
ERA0695	Abclonal	96Tests	EUR 521

Rat A1-MG ELISA Kit
ERA0696	Abclonal	96Tests	EUR 521

Rat Apo-A1 ELISA Kit
ERA0851	Abclonal	96Tests	EUR 521

Rat Protein S100-A1(S100A1) ELISA kit
CSB-EL020622RA-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Protein S100-A1 (S100A1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rat Protein S100-A1(S100A1) ELISA kit
1-CSB-EL020622RA	Cusabio	EUR 703.00 EUR 4843.00 EUR 2570.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Protein S100-A1(S100A1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat Phospholipase A1 Activating Protein ELISA kit
E02P0125-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Phospholipase A1 Activating Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Phospholipase A1 Activating Protein ELISA kit
E02P0125-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Phospholipase A1 Activating Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Phospholipase A1 Activating Protein ELISA kit
E02P0125-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Phospholipase A1 Activating Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Surfactant Protein A1 (SFTPA1) ELISA Kit
20-abx156111	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Rat Surfactant Protein A1 (SFTPA1) ELISA Kit
abx256019-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Rat Protein S100- A1, S100a1 ELISA KIT
ELI-53356r	Lifescience Market	96 Tests	EUR 886

Rat Surfactant Protein A1 (SFTPA1) ELISA Kit
abx574425-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

RPA1 Recombinant Protein (Human)
RP026776	ABM	100 ug	Ask for price

RPA1 Recombinant Protein (Mouse)
RP168854	ABM	100 ug	Ask for price

RPA1 Recombinant Protein (Mouse)
RP168857	ABM	100 ug	Ask for price

Human Replication Protein A2 (RPA2) ELISA Kit
abx382883-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Replication Protein A3 (RPA3) ELISA Kit
abx382884-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

ELISA kit for Rat SP-A1 (Pulmonary surfactant-associated protein A1)
E-EL-R0060	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's SP-A1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat SP-A1. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat SP-A1 (Pulmonary surfactant-associated protein A1) in samples from Serum, Plasma, Cell supernatant

S100a1 ELISA Kit\| Rat Protein S100-A1 ELISA Kit
EF019285	Lifescience Market	96 Tests	EUR 689

Rat anti-apolipoprotein A1(Apo-A1)antibody ELISA kit
E02A2043-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat anti-apolipoprotein A1(Apo-A1)antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat anti-apolipoprotein A1(Apo-A1)antibody ELISA kit
E02A2043-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat anti-apolipoprotein A1(Apo-A1)antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat anti-apolipoprotein A1(Apo-A1)antibody ELISA kit
E02A2043-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat anti-apolipoprotein A1(Apo-A1)antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat DNA replication licensing factor MCM3 ELISA kit
E02D0531-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat DNA replication licensing factor MCM3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat DNA replication licensing factor MCM3 ELISA kit
E02D0531-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat DNA replication licensing factor MCM3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat DNA replication licensing factor MCM3 ELISA kit
E02D0531-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat DNA replication licensing factor MCM3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rpa1 ORF Vector (Rat) (pORF)
ORF075517	ABM	1.0 ug DNA	EUR 506

RPA1 Protein Vector (Rat) (pPB-C-His)
PV302066	ABM	500 ng	EUR 1166

RPA1 Protein Vector (Rat) (pPB-N-His)
PV302067	ABM	500 ng	EUR 1166

RPA1 Protein Vector (Rat) (pPM-C-HA)
PV302068	ABM	500 ng	EUR 1166

RPA1 Protein Vector (Rat) (pPM-C-His)
PV302069	ABM	500 ng	EUR 1166

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

ES Electrophoresis Casting Tray, 7cm X 14cm
LE1011-A1	GenDepot	Ea	EUR 165

Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol)
RAT-5	Alpha Diagnostics	1	EUR 1138

Rat Apolipoprotein A1 (APOA1) ELISA Kit
DLR-APOA1-Ra-48T	DL Develop	48T	EUR 467
Should the Rat Apolipoprotein A1 (APOA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Apolipoprotein A1 (APOA1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Apolipoprotein A1 (APOA1) ELISA Kit
DLR-APOA1-Ra-96T	DL Develop	96T	EUR 605
Should the Rat Apolipoprotein A1 (APOA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Apolipoprotein A1 (APOA1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Anxa1/ Annexin A1 ELISA Kit
E0072Ra	Sunlong	1 Kit	EUR 571

Rat Cyclin A1(CCNA1) ELISA kit
E02C1444-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cyclin A1(CCNA1) ELISA kit
E02C1444-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cyclin A1(CCNA1) ELISA kit
E02C1444-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Carboxypeptidase A1(CPA1) ELISA kit
E02C1990-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Carboxypeptidase A1(CPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Carboxypeptidase A1(CPA1) ELISA kit
E02C1990-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Carboxypeptidase A1(CPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Carboxypeptidase A1(CPA1) ELISA kit
E02C1990-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Carboxypeptidase A1(CPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Apolipoprotein A1 precursor ELISA kit
E02P0714-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Apolipoprotein A1 precursor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Apolipoprotein A1 precursor ELISA kit
E02P0714-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Apolipoprotein A1 precursor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Apolipoprotein A1 precursor ELISA kit
E02P0714-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Apolipoprotein A1 precursor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat a1 Acid glycoprotein ELISA kit
E02A0688-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat a1 Acid glycoprotein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat a1 Acid glycoprotein ELISA kit
E02A0688-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat a1 Acid glycoprotein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat a1 Acid glycoprotein ELISA kit
E02A0688-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat a1 Acid glycoprotein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Apolipoprotein A1 (APOA1) ELISA Kit
20-abx155214	Abbexa	EUR 6580.00 EUR 3510.00 EUR 817.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Rat Apolipoprotein A1 (APOA1) ELISA Kit
abx256312-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rat Annexin A1 (ANXA1) ELISA Kit
20-abx258091	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Rat Plexin A1 PicoKine ELISA Kit
EK1819	BosterBio	96 wells	EUR 425
Description: For quantitative detection of rat Plexin A1 in cell culture supernates, serum and plasma (heparin, EDTA).

Rat Phospholipase A1 (PLA1A) ELISA Kit
abx353836-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Rat Cyclin A1 (CCNA1) ELISA Kit
abx354064-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Rat Apolipoprotein A1 (APOA1) ELISA Kit
abx575111-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rat Ephrin A1 (EFNA1) ELISA Kit
abx516828-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rat Annexin A1 (ANXA1) ELISA Kit
abx512632-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rat Pre-APO-A1 ELISA Kit
ERP0721	Abclonal	96Tests	EUR 521

Rat Phospholipase A1(PLA1)ELISA kit
QY-E10547	Qayee Biotechnology	96T	EUR 413

Rat Apolipoprotein A1 (APOA1) ELISA Kit
RDR-APOA1-Ra-48Tests	Reddot Biotech	48 Tests	EUR 486

Rat Apolipoprotein A1 (APOA1) ELISA Kit
RDR-APOA1-Ra-96Tests	Reddot Biotech	96 Tests	EUR 672

Rat Annexin A1 (ANXA1) ELISA Kit
SEE787Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5124.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Annexin A1 (ANXA1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Annexin A1 (ANXA1) in serum, plasma, tissue homogenates and other biological fluids.

Rat Annexin A1 (ANXA1) ELISA Kit
SEE787Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 509.64
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Annexin A1 (ANXA1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Annexin A1 (ANXA1) in serum, plasma, tissue homogenates and other biological fluids.

Rat Annexin A1 (ANXA1) ELISA Kit
SEE787Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 685.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Annexin A1 (ANXA1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Annexin A1 (ANXA1) in serum, plasma, tissue homogenates and other biological fluids.

Rat Annexin A1 (ANXA1) ELISA Kit
SEE787Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2783.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Annexin A1 (ANXA1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Annexin A1 (ANXA1) in serum, plasma, tissue homogenates and other biological fluids.

Rat Annexin A1 (ANXA1) ELISA Kit
4-SEE787Ra	Cloud-Clone	EUR 5175.00 EUR 2734.00 EUR 686.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Annexin A1 elisa. Alternative names of the recognized antigen: ANX-A1 ANX1 LPC1 Lipocortin I Chromobindin-9 Calpactin II Phospholipase A2 inhibitory protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Annexin A1 (ANXA1) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rat Apolipoprotein A1 (APOA1) ELISA Kit
SEA519Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4129.36
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Apolipoprotein A1 (APOA1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Apolipoprotein A1 (APOA1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Apolipoprotein A1 (APOA1) ELISA Kit
SEA519Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 427.71
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Apolipoprotein A1 (APOA1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Apolipoprotein A1 (APOA1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Apolipoprotein A1 (APOA1) ELISA Kit
SEA519Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 568.16
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Apolipoprotein A1 (APOA1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Apolipoprotein A1 (APOA1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Apolipoprotein A1 (APOA1) ELISA Kit
SEA519Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2256.72
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Apolipoprotein A1 (APOA1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Apolipoprotein A1 (APOA1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Apolipoprotein A1 (APOA1) ELISA Kit
4-SEA519Ra	Cloud-Clone	EUR 4180.00 EUR 2207.00 EUR 569.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Apolipoprotein A1 elisa. Alternative names of the recognized antigen: Apo-A1 ApoA-1 Milano ProapoA-I Proapolipoprotein A-I Truncated apolipoprotein A-I
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Apolipoprotein A1 (APOA1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Apolipoprotein A1 ELISA Kit (APOA1)
RK03503	Abclonal	96 Tests	EUR 521

Rat Apolipoprotein A1 (APOA1) ELISA Kit
RD-APOA1-Ra-48Tests	Reddot Biotech	48 Tests	EUR 465

Rat Apolipoprotein A1 (APOA1) ELISA Kit
RD-APOA1-Ra-96Tests	Reddot Biotech	96 Tests	EUR 643

Rat Apolipoprotein A1 Binding Protein (APOA1BP) ELISA Kit
abx514877-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

ELISA kit for Rat Protein S100-A1 (S100A1)
KTE100292-48T	Abbkine	48T	EUR 332
A1is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. This protein may function in stimulation of Ca2+-induced Ca2+ release, inhibition of microtubule assembly, and inhibition of protein kinase C-mediated phosphory Show more
Description: Quantitative sandwich ELISA for measuring Rat Protein S100-A1 (S100A1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Protein S100-A1 (S100A1)
KTE100292-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
A1is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. This protein may function in stimulation of Ca2+-induced Ca2+ release, inhibition of microtubule assembly, and inhibition of protein kinase C-mediated phosphory Show more
Description: Quantitative sandwich ELISA for measuring Rat Protein S100-A1 (S100A1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Protein S100-A1 (S100A1)
KTE100292-96T	Abbkine	96T	EUR 539
A1is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. This protein may function in stimulation of Ca2+-induced Ca2+ release, inhibition of microtubule assembly, and inhibition of protein kinase C-mediated phosphory Show more
Description: Quantitative sandwich ELISA for measuring Rat Protein S100-A1 (S100A1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Apolipoprotein A1 precursor (Pre-Apo-A1)
KTE100448-48T	Abbkine	48T	EUR 354
Description: Quantitative sandwich ELISA for measuring Rat Apolipoprotein A1 precursor (Pre-Apo-A1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Apolipoprotein A1 precursor (Pre-Apo-A1)
KTE100448-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Description: Quantitative sandwich ELISA for measuring Rat Apolipoprotein A1 precursor (Pre-Apo-A1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Apolipoprotein A1 precursor (Pre-Apo-A1)
KTE100448-96T	Abbkine	96T	EUR 572
Description: Quantitative sandwich ELISA for measuring Rat Apolipoprotein A1 precursor (Pre-Apo-A1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human replication protein A,RPA-70 ELISA Kit
201-12-1914	SunredBio	96 tests	EUR 440
This replication protein A ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human replication protein A,RPA-70 ELISA Kit
CN-04330H1	ChemNorm	96T	EUR 449

Human replication protein A,RPA-70 ELISA Kit
CN-04330H2	ChemNorm	48T	EUR 299

Human replication protein A(RPA-70)ELISA Kit
GA-E1930HM-48T	GenAsia Biotech	48T	EUR 289

Human replication protein A(RPA-70)ELISA Kit
GA-E1930HM-96T	GenAsia Biotech	96T	EUR 466

Human replication protein A(RPA-70)ELISA Kit
QY-E03530	Qayee Biotechnology	96T	EUR 361

RPA1 Rabbit pAb
A0874-100ul	Abclonal	100 ul	EUR 308

RPA1 Rabbit pAb
A0874-200ul	Abclonal	200 ul	EUR 459

RPA1 Rabbit pAb
A0874-20ul	Abclonal	20 ul	EUR 183

RPA1 Rabbit pAb
A0874-50ul	Abclonal	50 ul	EUR 223

RPA1 Rabbit pAb
A0990-100ul	Abclonal	100 ul	EUR 308

RPA1 Rabbit pAb
A0990-200ul	Abclonal	200 ul	EUR 459

RPA1 Rabbit pAb
A0990-20ul	Abclonal	20 ul	EUR 183

RPA1 Rabbit pAb
A0990-50ul	Abclonal	50 ul	EUR 223

RPA1 Blocking Peptide
33R-8749	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RPA1 antibody, catalog no. 70R-5545

RPA1 Blocking Peptide
33R-9194	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RPA1 antibody, catalog no. 70R-5546

RPA1 Blocking Peptide
DF6172-BP	Affbiotech	1mg	EUR 195

RPA1 Blocking Peptide
20-abx064201	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

RPA1 Conjugated Antibody
C38162	SAB	100ul	EUR 397

RPA1 Blocking Peptide
BF0367-BP	Affbiotech	1mg	EUR 195

RPA1 cloning plasmid
CSB-CL020088HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 Î¼g plasmid + 200Î¼l Glycerol Length: 1851 Sequence: atggtcggccaactgagcgagggggccattgcggccatcatgcagaagggggatacaaacataaagcccatcctccaagtcatcaacatccgtcccattactacggggaatagtccgccgcgttatcgactgctcatgagtgatggattgaacactctatcctctttcatgttgg Show more
Description: A cloning plasmid for the RPA1 gene.

RPA1 Polyclonal Antibody
ABP60232-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human RPA1 protein Applications tips:
Description: A polyclonal antibody for detection of RPA1 from Human. This RPA1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RPA1 protein

RPA1 Polyclonal Antibody
ABP60232-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human RPA1 protein Applications tips:
Description: A polyclonal antibody for detection of RPA1 from Human. This RPA1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RPA1 protein

RPA1 Polyclonal Antibody
ABP60232-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human RPA1 protein Applications tips:
Description: A polyclonal antibody for detection of RPA1 from Human. This RPA1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RPA1 protein

anti- RPA1 antibody
FNab07391	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500 - 1:2000 Immunogen: replication protein A1, 70kDa Uniprot ID: P27694 Gene ID: 6117 Research Area: Metabolism
Description: Antibody raised against RPA1

RPA1 Polyclonal Antibody
ES9601-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against RPA1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

RPA1 Polyclonal Antibody
ES9601-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against RPA1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

anti-RPA1 (4C4)
LF-MA30702	Abfrontier	100 ul	EUR 527
Description: Mouse Monoclonal to RPA1

Anti-RPA1 antibody
PAab07391	Lifescience Market	100 ug	EUR 386

Anti-RPA1 antibody
STJ25385	St John's Laboratory	100 µl	EUR 277

Anti-RPA1 antibody
STJ114904	St John's Laboratory	100 µl	EUR 277

Anti-RPA1 antibody
STJ190759	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to RPA1

Human apoprotein A1,apo-A1 ELISA Kit
201-12-1536	SunredBio	96 tests	EUR 440
This apoprotein A1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Pig apolipoprotein A1 (Apo-A1) ELISA Kit
CSB-E06834p-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativecompetitive ELISA kit for measuring Pig apolipoprotein A1 (Apo-A1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Pig apolipoprotein A1 (Apo-A1) ELISA Kit
1-CSB-E06834p	Cusabio	EUR 703.00 EUR 4843.00 EUR 2570.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativecompetitive ELISA kit for measuring Pig apolipoprotein A1 (Apo-A1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rabbit apoprotein A1,apo-A1 ELISA Kit
CN-00595R1	ChemNorm	96T	EUR 441

Rabbit apoprotein A1,apo-A1 ELISA Kit
CN-00595R2	ChemNorm	48T	EUR 291

PoFAine apoprotein A1,apo-A1 ELISA Kit
CN-01220P1	ChemNorm	96T	EUR 447

PoFAine apoprotein A1,apo-A1 ELISA Kit
CN-01220P2	ChemNorm	48T	EUR 296

Human apolipoprotein A1 (Apo-A1) ELISA Kit
CSB-E08103h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human apolipoprotein A1 (Apo-A1) in samples from serum, plasma, cell culture supernates, saliva, urine. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human apolipoprotein A1 (Apo-A1) ELISA Kit
1-CSB-E08103h	Cusabio	EUR 657.00 EUR 4484.00 EUR 2384.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human apolipoprotein A1 (Apo-A1) in samples from serum, plasma, cell culture supernates, saliva, urine. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse apolipoprotein A1(Apo-A1) ELISA Kit
CSB-E08104m-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse apolipoprotein A1 (Apo-A1) in samples from serum, plasma, cell culture supernates, urine, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse apolipoprotein A1(Apo-A1) ELISA Kit
1-CSB-E08104m	Cusabio	EUR 946.00 EUR 5782.00 EUR 3060.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse apolipoprotein A1(Apo-A1) in samples from serum, plasma, cell culture supernates, urine, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Monkey apolipoprotein A1 (Apo-A1) ELISA Kit
CSB-E11041Mo-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Monkey apolipoprotein A1 (Apo-A1) in samples from serum, plasma. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Monkey apolipoprotein A1 (Apo-A1) ELISA Kit
1-CSB-E11041Mo	Cusabio	EUR 967.00 EUR 5925.00 EUR 3134.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Monkey apolipoprotein A1 (Apo-A1) in samples from serum, plasma. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Monkey apoprotein A1,apo-A1 ELISA Kit
CN-02223M1	ChemNorm	96T	EUR 449

Human apoprotein A1,apo-A1 ELISA Kit
CN-03325H1	ChemNorm	96T	EUR 451

Human apoprotein A1,apo-A1 ELISA Kit
CN-03325H2	ChemNorm	48T	EUR 300

Rabbit apolipoprotein A1 (Apo-A1) ELISA Kit
CSB-E09804Rb-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rabbit apolipoprotein A1 (Apo-A1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rabbit apolipoprotein A1 (Apo-A1) ELISA Kit
1-CSB-E09804Rb	Cusabio	EUR 767.00 EUR 5089.00 EUR 2699.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rabbit apolipoprotein A1 (Apo-A1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rabbit apoprotein A1,apo-A1 ELISA Kit
GA-E0038RB-48T	GenAsia Biotech	48T	EUR 326

Rabbit apoprotein A1,apo-A1 ELISA Kit
GA-E0038RB-96T	GenAsia Biotech	96T	EUR 524