Rat RPA1(Replication Protein A1) ELISA Kit
To Order Contact us: Mark@operatiebrp.nl
Rat Replication Protein A1 (RPA1) ELISA Kit |
RDR-RPA1-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 583 |
Rat Replication Protein A1 (RPA1) ELISA Kit |
RDR-RPA1-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 811 |
Rat Replication Protein A1 (RPA1) ELISA Kit |
RD-RPA1-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Rat Replication Protein A1 (RPA1) ELISA Kit |
RD-RPA1-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 775 |
Human Replication Protein A1 (RPA1) ELISA Kit |
DLR-RPA1-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Replication Protein A1 (RPA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Replication Protein A1 (RPA1) in samples from tissue homogenates or other biological fluids. |
Human Replication Protein A1 (RPA1) ELISA Kit |
DLR-RPA1-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Replication Protein A1 (RPA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Replication Protein A1 (RPA1) in samples from tissue homogenates or other biological fluids. |
Human Replication Protein A1 (RPA1) ELISA Kit |
RDR-RPA1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Replication Protein A1 (RPA1) ELISA Kit |
RDR-RPA1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Replication Protein A1 (RPA1) ELISA Kit |
RD-RPA1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Replication Protein A1 (RPA1) ELISA Kit |
RD-RPA1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Rat Replication Protein A1 (RPA1) ELISA Kit |
20-abx156054 |
Abbexa |
-
EUR 7237.00
-
EUR 3855.00
-
EUR 895.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Rat Replication Protein A1 (RPA1) ELISA Kit |
SEH217Ra-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5124.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Replication Protein A1 (RPA1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Replication Protein A1 (RPA1) in Tissue homogenates, cell lysates and other biological fluids. |
Rat Replication Protein A1 (RPA1) ELISA Kit |
SEH217Ra-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 509.64 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Replication Protein A1 (RPA1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Replication Protein A1 (RPA1) in Tissue homogenates, cell lysates and other biological fluids. |
Rat Replication Protein A1 (RPA1) ELISA Kit |
SEH217Ra-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 685.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Replication Protein A1 (RPA1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Replication Protein A1 (RPA1) in Tissue homogenates, cell lysates and other biological fluids. |
Rat Replication Protein A1 (RPA1) ELISA Kit |
SEH217Ra-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2783.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Replication Protein A1 (RPA1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Replication Protein A1 (RPA1) in Tissue homogenates, cell lysates and other biological fluids. |
Rat Replication Protein A1 (RPA1) ELISA Kit |
4-SEH217Ra |
Cloud-Clone |
-
EUR 5175.00
-
EUR 2734.00
-
EUR 686.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Replication Protein A1 elisa. Alternative names of the recognized antigen: HSSB
- REPA1
- RF-A
- RP-A
- RPA70
- Replication protein A 70 kDa DNA-binding subunit
- Single-stranded DNA-binding protein
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Replication Protein A1 (RPA1) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Rat Replication Protein A1 (RPA1) Protein |
20-abx654943 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Rat Replication Protein A1 (RPA1) CLIA Kit |
20-abx495409 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Replication Protein A1 (RPA1) Antibody |
20-abx007829 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Replication Protein A1 (RPA1) Antibody |
abx010302-100ug |
Abbexa |
100 ug |
EUR 411 |
- Shipped within 5-10 working days.
|
Replication Protein A1 (RPA1) Antibody |
abx028041-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Replication Protein A1 (RPA1) Antibody |
abx028041-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Replication Protein A1 (RPA1) Antibody |
20-abx178250 |
Abbexa |
|
|
|
Replication Protein A1 (RPA1) Antibody |
20-abx178251 |
Abbexa |
|
|
|
Replication Protein A1 (RPA1) Antibody |
abx159678-100ul |
Abbexa |
100 ul |
EUR 467 |
- Shipped within 5-10 working days.
|
Replication Protein A1 (RPA1) Antibody |
20-abx174378 |
Abbexa |
|
|
|
Replication Protein A1 (RPA1) Antibody |
20-abx174379 |
Abbexa |
|
|
|
Replication Protein A1 (RPA1) Antibody |
abx237391-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Replication Protein A1 (RPA1) Antibody |
20-abx301840 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Replication Protein A1 (RPA1) Antibody |
20-abx000943 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
ELISA kit for Rat RPA1 (Replication Protein A1) |
ELK6959 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Replication Protein A1 (RPA1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Repl
- Show more
|
Description: A sandwich ELISA kit for detection of Replication Protein A1 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human Replication Protein A1 (RPA1) ELISA Kit |
20-abx152981 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Pig Replication Protein A1 (RPA1) ELISA Kit |
abx360874-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Monkey Replication Protein A1 (RPA1) ELISA Kit |
abx358961-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Chicken Replication Protein A1 (RPA1) ELISA Kit |
abx355854-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rabbit Replication Protein A1 (RPA1) ELISA Kit |
abx363576-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Replication Protein A1 (RPA1) ELISA Kit |
abx573009-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-12 working days.
|
Human Replication Protein A1 (RPA1) ELISA Kit |
SEH217Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Protein A1 (RPA1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Protein A1 (RPA1) in Tissue homogenates and other biological fluids. |
Human Replication Protein A1 (RPA1) ELISA Kit |
SEH217Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Protein A1 (RPA1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Protein A1 (RPA1) in Tissue homogenates and other biological fluids. |
Human Replication Protein A1 (RPA1) ELISA Kit |
SEH217Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Protein A1 (RPA1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Protein A1 (RPA1) in Tissue homogenates and other biological fluids. |
Human Replication Protein A1 (RPA1) ELISA Kit |
SEH217Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Protein A1 (RPA1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Protein A1 (RPA1) in Tissue homogenates and other biological fluids. |
Human Replication Protein A1 (RPA1) ELISA Kit |
4-SEH217Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Replication Protein A1 elisa. Alternative names of the recognized antigen: HSSB
- REPA1
- RF-A
- RP-A
- RPA70
- Replication protein A 70 kDa DNA-binding subunit
- Single-stranded DNA-binding protein
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Replication Protein A1 (RPA1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Human Replication Protein A1 (RPA1) Protein |
20-abx654942 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Replication Protein A1 (RPA1) Antibody (HRP) |
20-abx315981 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Replication Protein A1 (RPA1) Antibody (FITC) |
20-abx315982 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Replication Protein A1 (RPA1) Antibody (Biotin) |
20-abx315983 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
ELISA kit for Human RPA1 (Replication protein A1) |
E-EL-H1282 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's RPA1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human RPA1. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human RPA1 (Replication protein A1) in samples from Serum, Plasma, Cell supernatant |
ELISA kit for Human RPA1 (Replication Protein A1) |
ELK4413 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Replication Protein A1 (RPA1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Repl
- Show more
|
Description: A sandwich ELISA kit for detection of Replication Protein A1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human Replication Protein A1 (RPA1) CLIA Kit |
20-abx495408 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Rat Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit |
E02R0418-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit |
E02R0418-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit |
E02R0418-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
ELISA kit for Rat Replication protein A 70 kDa DNA-binding subunit (RPA1) |
KTE100972-48T |
Abbkine |
48T |
EUR 332 |
- Replication protein A (RPA) is a 3-subunit single-stranded DNA (ssDNA)-binding protein that has been isolated from human cells and found to be essential for in vitro replication of the papovavirus SV40. The human cDNA directed production in E. coli o
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Replication protein A 70 kDa DNA-binding subunit (RPA1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Replication protein A 70 kDa DNA-binding subunit (RPA1) |
KTE100972-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Replication protein A (RPA) is a 3-subunit single-stranded DNA (ssDNA)-binding protein that has been isolated from human cells and found to be essential for in vitro replication of the papovavirus SV40. The human cDNA directed production in E. coli o
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Replication protein A 70 kDa DNA-binding subunit (RPA1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Replication protein A 70 kDa DNA-binding subunit (RPA1) |
KTE100972-96T |
Abbkine |
96T |
EUR 539 |
- Replication protein A (RPA) is a 3-subunit single-stranded DNA (ssDNA)-binding protein that has been isolated from human cells and found to be essential for in vitro replication of the papovavirus SV40. The human cDNA directed production in E. coli o
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Replication protein A 70 kDa DNA-binding subunit (RPA1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Replication Protein A1, 70 kDa Antibody |
20-abx115128 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Rabbit Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit |
E04R0418-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit |
E04R0418-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit |
E04R0418-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit |
E03R0418-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit |
E03R0418-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit |
E03R0418-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit |
E01R0418-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit |
E01R0418-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit |
E01R0418-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit |
E06R0418-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit |
E06R0418-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit |
E06R0418-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit |
E08R0418-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit |
E08R0418-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit |
E08R0418-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit |
E09R0418-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit |
E09R0418-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit |
E09R0418-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit |
E07R0418-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit |
E07R0418-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit |
E07R0418-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Replication protein A 70KDA DNA-binding subunit (RPA1) |
1-CSB-EP020088HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 84 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Replication protein A 70KDA DNA-binding subunit(RPA1) expressed in E.coli |
RPA1 ELISA Kit (Rat) (OKCD04510) |
OKCD04510 |
Aviva Systems Biology |
96 Wells |
EUR 936 |
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.128 ng/mL |
Guinea pig Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit |
E05R0418-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit |
E05R0418-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit |
E05R0418-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
RPA1 Recombinant Protein (Rat) |
RP226547 |
ABM |
100 ug |
Ask for price |
RPA1 ELISA Kit (Human) (OKCD01948) |
OKCD01948 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: As part of the heterotrimeric replication protein A complex (RPA/RP-A), binds and stabilizes single-stranded DNA intermediates, that form during DNA replication or upon DNA stress. It prevents their reannealing and in parallel, recruits and activates different proteins and complexes involved in DNA metabolism. Thereby, it plays an essential role both in DNA replication and the cellular response to DNA damage.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.106 ng/mL |
RPA1 ELISA Kit (Mouse) (OKEH07912) |
OKEH07912 |
Aviva Systems Biology |
96 Wells |
EUR 896 |
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.24ng/mL |
Rat apolipoprotein A1 (Apo-A1) ELISA Kit |
CSB-E08105r-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Rat apolipoprotein A1 (Apo-A1) in samples from serum, plasma, bronchoalveolarlavagefluid, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Rat apolipoprotein A1 (Apo-A1) ELISA Kit |
1-CSB-E08105r |
Cusabio |
-
EUR 967.00
-
EUR 5925.00
-
EUR 3134.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Rat apolipoprotein A1 (Apo-A1) in samples from serum, plasma, bronchoalveolarlavagefluid, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Rat apoprotein A1,apo-A1 ELISA Kit |
CN-01444R1 |
ChemNorm |
96T |
EUR 434 |
Rat apoprotein A1,apo-A1 ELISA Kit |
CN-01444R2 |
ChemNorm |
48T |
EUR 284 |
Rat apoprotein A1(apo-A1)ELISA Kit |
GA-E0751RT-48T |
GenAsia Biotech |
48T |
EUR 317 |
Rat apoprotein A1(apo-A1)ELISA Kit |
GA-E0751RT-96T |
GenAsia Biotech |
96T |
EUR 496 |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Replication Protein A2 (RPA2) ELISA Kit |
abx595526-96tests |
Abbexa |
96 tests |
EUR 637 |
- Shipped within 1-2 weeks.
|
Rat Replication Initiator 1 (REPIN1) ELISA Kit |
abx391903-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Repin1 ELISA Kit| Rat Replication initiator 1 ELISA Kit |
EF019263 |
Lifescience Market |
96 Tests |
EUR 689 |
RPA1 antibody |
70R-19947 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal RPA1 antibody |
RPA1 antibody |
38162-100ul |
SAB |
100ul |
EUR 252 |
RPA1 antibody |
10R-1208 |
Fitzgerald |
100 ug |
EUR 512 |
Description: Mouse monoclonal RPA1 antibody |
RPA1 Antibody |
DF6172 |
Affbiotech |
200ul |
EUR 304 |
Description: RPA1 Antibody detects endogenous levels of total RPA1. |
RPA1 antibody |
70R-51326 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal RPA1 antibody |
RPA1 antibody |
70R-5545 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal RPA1 antibody raised against the middle region of RPA1 |
RPA1 antibody |
70R-5546 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal RPA1 antibody raised against the middle region of RPA1 |
RPA1 Antibody |
BF0367 |
Affbiotech |
200ul |
EUR 376 |
Description: RPA1 antibody detects endogenous levels of total RPA1. |
RPA1 Antibody |
1-CSB-PA020088GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against RPA1. Recognizes RPA1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
RPA1 Antibody |
1-CSB-PA020088LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RPA1. Recognizes RPA1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:200-1:3000, IHC:1:20-1:200 |
RPA1 siRNA |
20-abx931869 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RPA1 siRNA |
20-abx931870 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Rat Phospholipase A1 ELISA kit |
E02P0124-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Phospholipase A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Phospholipase A1 ELISA kit |
E02P0124-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Phospholipase A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Phospholipase A1 ELISA kit |
E02P0124-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Phospholipase A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Ephrin A1 ELISA kit |
E02E0042-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Ephrin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Ephrin A1 ELISA kit |
E02E0042-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Ephrin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Ephrin A1 ELISA kit |
E02E0042-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Ephrin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Immunoglobulin A1 ELISA kit |
E02I0016-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Immunoglobulin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Immunoglobulin A1 ELISA kit |
E02I0016-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Immunoglobulin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Immunoglobulin A1 ELISA kit |
E02I0016-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Immunoglobulin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Annexin A1 ELISA kit |
E02A0208-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Annexin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Annexin A1 ELISA kit |
E02A0208-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Annexin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Annexin A1 ELISA kit |
E02A0208-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Annexin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Apolipoprotein A1 ELISA kit |
E02A0509-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Apolipoprotein A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Apolipoprotein A1 ELISA kit |
E02A0509-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Apolipoprotein A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Apolipoprotein A1 ELISA kit |
E02A0509-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Apolipoprotein A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat a1 microglobulin ELISA kit |
E02A0689-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat a1 microglobulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat a1 microglobulin ELISA kit |
E02A0689-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat a1 microglobulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat a1 microglobulin ELISA kit |
E02A0689-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat a1 microglobulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat A1-AGP ELISA Kit |
ERA0695 |
Abclonal |
96Tests |
EUR 521 |
Rat A1-MG ELISA Kit |
ERA0696 |
Abclonal |
96Tests |
EUR 521 |
Rat Apo-A1 ELISA Kit |
ERA0851 |
Abclonal |
96Tests |
EUR 521 |
Rat Protein S100-A1(S100A1) ELISA kit |
CSB-EL020622RA-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Rat Protein S100-A1 (S100A1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Rat Protein S100-A1(S100A1) ELISA kit |
1-CSB-EL020622RA |
Cusabio |
-
EUR 703.00
-
EUR 4843.00
-
EUR 2570.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Rat Protein S100-A1(S100A1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Rat Phospholipase A1 Activating Protein ELISA kit |
E02P0125-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Phospholipase A1 Activating Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Phospholipase A1 Activating Protein ELISA kit |
E02P0125-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Phospholipase A1 Activating Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Phospholipase A1 Activating Protein ELISA kit |
E02P0125-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Phospholipase A1 Activating Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Surfactant Protein A1 (SFTPA1) ELISA Kit |
20-abx156111 |
Abbexa |
-
EUR 7237.00
-
EUR 3855.00
-
EUR 895.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Rat Surfactant Protein A1 (SFTPA1) ELISA Kit |
abx256019-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Rat Surfactant Protein A1 (SFTPA1) ELISA Kit |
abx574425-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
RPA1 Recombinant Protein (Human) |
RP026776 |
ABM |
100 ug |
Ask for price |
RPA1 Recombinant Protein (Mouse) |
RP168854 |
ABM |
100 ug |
Ask for price |
RPA1 Recombinant Protein (Mouse) |
RP168857 |
ABM |
100 ug |
Ask for price |
Human Replication Protein A2 (RPA2) ELISA Kit |
abx382883-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Replication Protein A3 (RPA3) ELISA Kit |
abx382884-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
ELISA kit for Rat SP-A1 (Pulmonary surfactant-associated protein A1) |
E-EL-R0060 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's SP-A1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat SP-A1. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Rat SP-A1 (Pulmonary surfactant-associated protein A1) in samples from Serum, Plasma, Cell supernatant |
S100a1 ELISA Kit| Rat Protein S100-A1 ELISA Kit |
EF019285 |
Lifescience Market |
96 Tests |
EUR 689 |
Rat anti-apolipoprotein A1(Apo-A1)antibody ELISA kit |
E02A2043-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat anti-apolipoprotein A1(Apo-A1)antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat anti-apolipoprotein A1(Apo-A1)antibody ELISA kit |
E02A2043-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat anti-apolipoprotein A1(Apo-A1)antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat anti-apolipoprotein A1(Apo-A1)antibody ELISA kit |
E02A2043-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat anti-apolipoprotein A1(Apo-A1)antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat DNA replication licensing factor MCM3 ELISA kit |
E02D0531-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat DNA replication licensing factor MCM3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat DNA replication licensing factor MCM3 ELISA kit |
E02D0531-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat DNA replication licensing factor MCM3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat DNA replication licensing factor MCM3 ELISA kit |
E02D0531-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat DNA replication licensing factor MCM3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rpa1 ORF Vector (Rat) (pORF) |
ORF075517 |
ABM |
1.0 ug DNA |
EUR 506 |
RPA1 Protein Vector (Rat) (pPB-C-His) |
PV302066 |
ABM |
500 ng |
EUR 1166 |
RPA1 Protein Vector (Rat) (pPB-N-His) |
PV302067 |
ABM |
500 ng |
EUR 1166 |
RPA1 Protein Vector (Rat) (pPM-C-HA) |
PV302068 |
ABM |
500 ng |
EUR 1166 |
RPA1 Protein Vector (Rat) (pPM-C-His) |
PV302069 |
ABM |
500 ng |
EUR 1166 |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
ES Electrophoresis Casting Tray, 7cm X 14cm |
LE1011-A1 |
GenDepot |
Ea |
EUR 165 |
Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol) |
RAT-5 |
Alpha Diagnostics |
1 |
EUR 1138 |
Rat Apolipoprotein A1 (APOA1) ELISA Kit |
DLR-APOA1-Ra-48T |
DL Develop |
48T |
EUR 467 |
- Should the Rat Apolipoprotein A1 (APOA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Apolipoprotein A1 (APOA1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Rat Apolipoprotein A1 (APOA1) ELISA Kit |
DLR-APOA1-Ra-96T |
DL Develop |
96T |
EUR 605 |
- Should the Rat Apolipoprotein A1 (APOA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Apolipoprotein A1 (APOA1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Rat Anxa1/ Annexin A1 ELISA Kit |
E0072Ra |
Sunlong |
1 Kit |
EUR 571 |
Rat Cyclin A1(CCNA1) ELISA kit |
E02C1444-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Cyclin A1(CCNA1) ELISA kit |
E02C1444-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Cyclin A1(CCNA1) ELISA kit |
E02C1444-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Carboxypeptidase A1(CPA1) ELISA kit |
E02C1990-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Carboxypeptidase A1(CPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Carboxypeptidase A1(CPA1) ELISA kit |
E02C1990-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Carboxypeptidase A1(CPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Carboxypeptidase A1(CPA1) ELISA kit |
E02C1990-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Carboxypeptidase A1(CPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Apolipoprotein A1 precursor ELISA kit |
E02P0714-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Apolipoprotein A1 precursor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Apolipoprotein A1 precursor ELISA kit |
E02P0714-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Apolipoprotein A1 precursor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Apolipoprotein A1 precursor ELISA kit |
E02P0714-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Apolipoprotein A1 precursor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat a1 Acid glycoprotein ELISA kit |
E02A0688-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat a1 Acid glycoprotein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat a1 Acid glycoprotein ELISA kit |
E02A0688-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat a1 Acid glycoprotein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat a1 Acid glycoprotein ELISA kit |
E02A0688-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat a1 Acid glycoprotein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Apolipoprotein A1 (APOA1) ELISA Kit |
20-abx155214 |
Abbexa |
-
EUR 6580.00
-
EUR 3510.00
-
EUR 817.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Rat Apolipoprotein A1 (APOA1) ELISA Kit |
abx256312-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Rat Annexin A1 (ANXA1) ELISA Kit |
20-abx258091 |
Abbexa |
-
EUR 7237.00
-
EUR 3855.00
-
EUR 895.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Rat Plexin A1 PicoKine ELISA Kit |
EK1819 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of rat Plexin A1 in cell culture supernates, serum and plasma (heparin, EDTA). |
Rat Phospholipase A1 (PLA1A) ELISA Kit |
abx353836-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-12 working days.
|
Rat Cyclin A1 (CCNA1) ELISA Kit |
abx354064-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-12 working days.
|
Rat Apolipoprotein A1 (APOA1) ELISA Kit |
abx575111-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Rat Ephrin A1 (EFNA1) ELISA Kit |
abx516828-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Rat Annexin A1 (ANXA1) ELISA Kit |
abx512632-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Rat Pre-APO-A1 ELISA Kit |
ERP0721 |
Abclonal |
96Tests |
EUR 521 |
Rat Apolipoprotein A1 (APOA1) ELISA Kit |
RDR-APOA1-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 486 |
Rat Apolipoprotein A1 (APOA1) ELISA Kit |
RDR-APOA1-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 672 |
Rat Annexin A1 (ANXA1) ELISA Kit |
SEE787Ra-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5124.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Annexin A1 (ANXA1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Annexin A1 (ANXA1) in serum, plasma, tissue homogenates and other biological fluids. |
Rat Annexin A1 (ANXA1) ELISA Kit |
SEE787Ra-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 509.64 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Annexin A1 (ANXA1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Annexin A1 (ANXA1) in serum, plasma, tissue homogenates and other biological fluids. |
Rat Annexin A1 (ANXA1) ELISA Kit |
SEE787Ra-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 685.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Annexin A1 (ANXA1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Annexin A1 (ANXA1) in serum, plasma, tissue homogenates and other biological fluids. |
Rat Annexin A1 (ANXA1) ELISA Kit |
SEE787Ra-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2783.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Annexin A1 (ANXA1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Annexin A1 (ANXA1) in serum, plasma, tissue homogenates and other biological fluids. |
Rat Annexin A1 (ANXA1) ELISA Kit |
4-SEE787Ra |
Cloud-Clone |
-
EUR 5175.00
-
EUR 2734.00
-
EUR 686.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Annexin A1 elisa. Alternative names of the recognized antigen: ANX-A1
- ANX1
- LPC1
- Lipocortin I
- Chromobindin-9
- Calpactin II
- Phospholipase A2 inhibitory protein
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Annexin A1 (ANXA1) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Rat Apolipoprotein A1 (APOA1) ELISA Kit |
SEA519Ra-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4129.36 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Apolipoprotein A1 (APOA1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Apolipoprotein A1 (APOA1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Apolipoprotein A1 (APOA1) ELISA Kit |
SEA519Ra-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 427.71 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Apolipoprotein A1 (APOA1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Apolipoprotein A1 (APOA1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Apolipoprotein A1 (APOA1) ELISA Kit |
SEA519Ra-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 568.16 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Apolipoprotein A1 (APOA1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Apolipoprotein A1 (APOA1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Apolipoprotein A1 (APOA1) ELISA Kit |
SEA519Ra-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2256.72 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Apolipoprotein A1 (APOA1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Apolipoprotein A1 (APOA1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Apolipoprotein A1 (APOA1) ELISA Kit |
4-SEA519Ra |
Cloud-Clone |
-
EUR 4180.00
-
EUR 2207.00
-
EUR 569.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Apolipoprotein A1 elisa. Alternative names of the recognized antigen: Apo-A1
- ApoA-1 Milano
- ProapoA-I
- Proapolipoprotein A-I
- Truncated apolipoprotein A-I
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Apolipoprotein A1 (APOA1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Rat Apolipoprotein A1 ELISA Kit (APOA1) |
RK03503 |
Abclonal |
96 Tests |
EUR 521 |
Rat Apolipoprotein A1 (APOA1) ELISA Kit |
RD-APOA1-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 465 |
Rat Apolipoprotein A1 (APOA1) ELISA Kit |
RD-APOA1-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 643 |
Rat Apolipoprotein A1 Binding Protein (APOA1BP) ELISA Kit |
abx514877-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
ELISA kit for Rat Protein S100-A1 (S100A1) |
KTE100292-48T |
Abbkine |
48T |
EUR 332 |
- A1is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. This protein may function in stimulation of Ca2+-induced Ca2+ release, inhibition of microtubule assembly, and inhibition of protein kinase C-mediated phosphory
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Protein S100-A1 (S100A1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Protein S100-A1 (S100A1) |
KTE100292-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- A1is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. This protein may function in stimulation of Ca2+-induced Ca2+ release, inhibition of microtubule assembly, and inhibition of protein kinase C-mediated phosphory
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Protein S100-A1 (S100A1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Protein S100-A1 (S100A1) |
KTE100292-96T |
Abbkine |
96T |
EUR 539 |
- A1is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. This protein may function in stimulation of Ca2+-induced Ca2+ release, inhibition of microtubule assembly, and inhibition of protein kinase C-mediated phosphory
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Protein S100-A1 (S100A1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Apolipoprotein A1 precursor (Pre-Apo-A1) |
KTE100448-48T |
Abbkine |
48T |
EUR 354 |
Description: Quantitative sandwich ELISA for measuring Rat Apolipoprotein A1 precursor (Pre-Apo-A1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Apolipoprotein A1 precursor (Pre-Apo-A1) |
KTE100448-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
Description: Quantitative sandwich ELISA for measuring Rat Apolipoprotein A1 precursor (Pre-Apo-A1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Apolipoprotein A1 precursor (Pre-Apo-A1) |
KTE100448-96T |
Abbkine |
96T |
EUR 572 |
Description: Quantitative sandwich ELISA for measuring Rat Apolipoprotein A1 precursor (Pre-Apo-A1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Human replication protein A,RPA-70 ELISA Kit |
201-12-1914 |
SunredBio |
96 tests |
EUR 440 |
- This replication protein A ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human replication protein A,RPA-70 ELISA Kit |
CN-04330H1 |
ChemNorm |
96T |
EUR 449 |
Human replication protein A,RPA-70 ELISA Kit |
CN-04330H2 |
ChemNorm |
48T |
EUR 299 |
Human replication protein A(RPA-70)ELISA Kit |
GA-E1930HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
Human replication protein A(RPA-70)ELISA Kit |
GA-E1930HM-96T |
GenAsia Biotech |
96T |
EUR 466 |
RPA1 Rabbit pAb |
A0874-100ul |
Abclonal |
100 ul |
EUR 308 |
RPA1 Rabbit pAb |
A0874-200ul |
Abclonal |
200 ul |
EUR 459 |
RPA1 Rabbit pAb |
A0874-20ul |
Abclonal |
20 ul |
EUR 183 |
RPA1 Rabbit pAb |
A0874-50ul |
Abclonal |
50 ul |
EUR 223 |
RPA1 Rabbit pAb |
A0990-100ul |
Abclonal |
100 ul |
EUR 308 |
RPA1 Rabbit pAb |
A0990-200ul |
Abclonal |
200 ul |
EUR 459 |
RPA1 Rabbit pAb |
A0990-20ul |
Abclonal |
20 ul |
EUR 183 |
RPA1 Rabbit pAb |
A0990-50ul |
Abclonal |
50 ul |
EUR 223 |
RPA1 Blocking Peptide |
33R-8749 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RPA1 antibody, catalog no. 70R-5545 |
RPA1 Blocking Peptide |
33R-9194 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RPA1 antibody, catalog no. 70R-5546 |
RPA1 Blocking Peptide |
DF6172-BP |
Affbiotech |
1mg |
EUR 195 |
RPA1 Blocking Peptide |
20-abx064201 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RPA1 Conjugated Antibody |
C38162 |
SAB |
100ul |
EUR 397 |
RPA1 Blocking Peptide |
BF0367-BP |
Affbiotech |
1mg |
EUR 195 |
RPA1 cloning plasmid |
CSB-CL020088HU-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1851
- Sequence: atggtcggccaactgagcgagggggccattgcggccatcatgcagaagggggatacaaacataaagcccatcctccaagtcatcaacatccgtcccattactacggggaatagtccgccgcgttatcgactgctcatgagtgatggattgaacactctatcctctttcatgttgg
- Show more
|
Description: A cloning plasmid for the RPA1 gene. |
RPA1 Polyclonal Antibody |
ABP60232-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human RPA1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of RPA1 from Human. This RPA1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RPA1 protein |
RPA1 Polyclonal Antibody |
ABP60232-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human RPA1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of RPA1 from Human. This RPA1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RPA1 protein |
RPA1 Polyclonal Antibody |
ABP60232-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human RPA1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of RPA1 from Human. This RPA1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RPA1 protein |
anti- RPA1 antibody |
FNab07391 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500 - 1:2000
- Immunogen: replication protein A1, 70kDa
- Uniprot ID: P27694
- Gene ID: 6117
- Research Area: Metabolism
|
Description: Antibody raised against RPA1 |
RPA1 Polyclonal Antibody |
ES9601-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against RPA1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
RPA1 Polyclonal Antibody |
ES9601-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against RPA1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
anti-RPA1 (4C4) |
LF-MA30702 |
Abfrontier |
100 ul |
EUR 527 |
Description: Mouse Monoclonal to RPA1 |
Anti-RPA1 antibody |
STJ190759 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to RPA1 |
Human apoprotein A1,apo-A1 ELISA Kit |
201-12-1536 |
SunredBio |
96 tests |
EUR 440 |
- This apoprotein A1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Pig apolipoprotein A1 (Apo-A1) ELISA Kit |
CSB-E06834p-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativecompetitive ELISA kit for measuring Pig apolipoprotein A1 (Apo-A1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Pig apolipoprotein A1 (Apo-A1) ELISA Kit |
1-CSB-E06834p |
Cusabio |
-
EUR 703.00
-
EUR 4843.00
-
EUR 2570.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativecompetitive ELISA kit for measuring Pig apolipoprotein A1 (Apo-A1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Rabbit apoprotein A1,apo-A1 ELISA Kit |
CN-00595R1 |
ChemNorm |
96T |
EUR 441 |
Rabbit apoprotein A1,apo-A1 ELISA Kit |
CN-00595R2 |
ChemNorm |
48T |
EUR 291 |
PoFAine apoprotein A1,apo-A1 ELISA Kit |
CN-01220P1 |
ChemNorm |
96T |
EUR 447 |
PoFAine apoprotein A1,apo-A1 ELISA Kit |
CN-01220P2 |
ChemNorm |
48T |
EUR 296 |
Human apolipoprotein A1 (Apo-A1) ELISA Kit |
CSB-E08103h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitative sandwich ELISA kit for measuring Human apolipoprotein A1 (Apo-A1) in samples from serum, plasma, cell culture supernates, saliva, urine. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human apolipoprotein A1 (Apo-A1) ELISA Kit |
1-CSB-E08103h |
Cusabio |
-
EUR 657.00
-
EUR 4484.00
-
EUR 2384.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitative sandwich ELISA kit for measuring Human apolipoprotein A1 (Apo-A1) in samples from serum, plasma, cell culture supernates, saliva, urine. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Mouse apolipoprotein A1(Apo-A1) ELISA Kit |
CSB-E08104m-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse apolipoprotein A1 (Apo-A1) in samples from serum, plasma, cell culture supernates, urine, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Mouse apolipoprotein A1(Apo-A1) ELISA Kit |
1-CSB-E08104m |
Cusabio |
-
EUR 946.00
-
EUR 5782.00
-
EUR 3060.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse apolipoprotein A1(Apo-A1) in samples from serum, plasma, cell culture supernates, urine, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Monkey apolipoprotein A1 (Apo-A1) ELISA Kit |
CSB-E11041Mo-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Monkey apolipoprotein A1 (Apo-A1) in samples from serum, plasma. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Monkey apolipoprotein A1 (Apo-A1) ELISA Kit |
1-CSB-E11041Mo |
Cusabio |
-
EUR 967.00
-
EUR 5925.00
-
EUR 3134.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Monkey apolipoprotein A1 (Apo-A1) in samples from serum, plasma. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Monkey apoprotein A1,apo-A1 ELISA Kit |
CN-02223M1 |
ChemNorm |
96T |
EUR 449 |
Human apoprotein A1,apo-A1 ELISA Kit |
CN-03325H1 |
ChemNorm |
96T |
EUR 451 |
Human apoprotein A1,apo-A1 ELISA Kit |
CN-03325H2 |
ChemNorm |
48T |
EUR 300 |
Rabbit apolipoprotein A1 (Apo-A1) ELISA Kit |
CSB-E09804Rb-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Rabbit apolipoprotein A1 (Apo-A1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Rabbit apolipoprotein A1 (Apo-A1) ELISA Kit |
1-CSB-E09804Rb |
Cusabio |
-
EUR 767.00
-
EUR 5089.00
-
EUR 2699.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Rabbit apolipoprotein A1 (Apo-A1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Rabbit apoprotein A1,apo-A1 ELISA Kit |
GA-E0038RB-48T |
GenAsia Biotech |
48T |
EUR 326 |
Rabbit apoprotein A1,apo-A1 ELISA Kit |
GA-E0038RB-96T |
GenAsia Biotech |
96T |
EUR 524 |