Rat RPA1(Replication Protein A1) ELISA Kit

Rat RPA1(Replication Protein A1) ELISA Kit

To Order Contact us:  Mark@operatiebrp.nl

Rat Replication Protein A1 (RPA1) ELISA Kit

RD-RPA1-Ra-48Tests 48 Tests
EUR 557

Rat Replication Protein A1 (RPA1) ELISA Kit

RD-RPA1-Ra-96Tests 96 Tests
EUR 775

Rat Replication Protein A1 (RPA1) ELISA Kit

RDR-RPA1-Ra-48Tests 48 Tests
EUR 583

Rat Replication Protein A1 (RPA1) ELISA Kit

RDR-RPA1-Ra-96Tests 96 Tests
EUR 811

Human Replication Protein A1 (RPA1) ELISA Kit

DLR-RPA1-Hu-48T 48T
EUR 517
  • Should the Human Replication Protein A1 (RPA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Replication Protein A1 (RPA1) in samples from tissue homogenates or other biological fluids.

Human Replication Protein A1 (RPA1) ELISA Kit

DLR-RPA1-Hu-96T 96T
EUR 673
  • Should the Human Replication Protein A1 (RPA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Replication Protein A1 (RPA1) in samples from tissue homogenates or other biological fluids.

Human Replication Protein A1 (RPA1) ELISA Kit

RD-RPA1-Hu-48Tests 48 Tests
EUR 521

Human Replication Protein A1 (RPA1) ELISA Kit

RD-RPA1-Hu-96Tests 96 Tests
EUR 723

Human Replication Protein A1 (RPA1) ELISA Kit

RDR-RPA1-Hu-48Tests 48 Tests
EUR 544

Human Replication Protein A1 (RPA1) ELISA Kit

RDR-RPA1-Hu-96Tests 96 Tests
EUR 756

Rat Replication Protein A1 (RPA1) ELISA Kit

20-abx156054
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Replication Protein A1 (RPA1) ELISA Kit

SEH217Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Replication Protein A1 (RPA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Replication Protein A1 (RPA1) in Tissue homogenates, cell lysates and other biological fluids.

Rat Replication Protein A1 (RPA1) ELISA Kit

SEH217Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Replication Protein A1 (RPA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Replication Protein A1 (RPA1) in Tissue homogenates, cell lysates and other biological fluids.

Rat Replication Protein A1 (RPA1) ELISA Kit

SEH217Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Replication Protein A1 (RPA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Replication Protein A1 (RPA1) in Tissue homogenates, cell lysates and other biological fluids.

Rat Replication Protein A1 (RPA1) ELISA Kit

SEH217Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Replication Protein A1 (RPA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Replication Protein A1 (RPA1) in Tissue homogenates, cell lysates and other biological fluids.

Rat Replication Protein A1 (RPA1) ELISA Kit

4-SEH217Ra
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Replication Protein A1 elisa. Alternative names of the recognized antigen: HSSB
  • REPA1
  • RF-A
  • RP-A
  • RPA70
  • Replication protein A 70 kDa DNA-binding subunit
  • Single-stranded DNA-binding protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Replication Protein A1 (RPA1) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rat Replication Protein A1 (RPA1) Protein

20-abx654943
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Rat Replication Protein A1 (RPA1) CLIA Kit

20-abx495409
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Replication Protein A1 (RPA1) Antibody

20-abx000943
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Replication Protein A1 (RPA1) Antibody

abx159678-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

Replication Protein A1 (RPA1) Antibody

abx010302-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

Replication Protein A1 (RPA1) Antibody

20-abx007829
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Replication Protein A1 (RPA1) Antibody

abx028041-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Replication Protein A1 (RPA1) Antibody

abx028041-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Replication Protein A1 (RPA1) Antibody

20-abx174378
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Replication Protein A1 (RPA1) Antibody

20-abx174379
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Replication Protein A1 (RPA1) Antibody

20-abx178250
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Replication Protein A1 (RPA1) Antibody

20-abx178251
  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Replication Protein A1 (RPA1) Antibody

abx237391-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Replication Protein A1 (RPA1) Antibody

20-abx301840
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ELISA kit for Rat RPA1 (Replication Protein A1)

ELK6959 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Replication Protein A1 (RPA1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Repl
  • Show more
Description: A sandwich ELISA kit for detection of Replication Protein A1 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Pig Replication Protein A1 (RPA1) ELISA Kit

abx360874-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Replication Protein A1 (RPA1) ELISA Kit

abx363576-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Replication Protein A1 (RPA1) ELISA Kit

abx573009-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Human Replication Protein A1 (RPA1) ELISA Kit

20-abx152981
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Monkey Replication Protein A1 (RPA1) ELISA Kit

abx358961-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Replication Protein A1 (RPA1) ELISA Kit

abx355854-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Replication Protein A1 (RPA1) ELISA Kit

SEH217Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Protein A1 (RPA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Protein A1 (RPA1) in Tissue homogenates and other biological fluids.

Human Replication Protein A1 (RPA1) ELISA Kit

SEH217Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Protein A1 (RPA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Protein A1 (RPA1) in Tissue homogenates and other biological fluids.

Human Replication Protein A1 (RPA1) ELISA Kit

SEH217Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Protein A1 (RPA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Protein A1 (RPA1) in Tissue homogenates and other biological fluids.

Human Replication Protein A1 (RPA1) ELISA Kit

SEH217Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Protein A1 (RPA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Protein A1 (RPA1) in Tissue homogenates and other biological fluids.

Human Replication Protein A1 (RPA1) ELISA Kit

4-SEH217Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Replication Protein A1 elisa. Alternative names of the recognized antigen: HSSB
  • REPA1
  • RF-A
  • RP-A
  • RPA70
  • Replication protein A 70 kDa DNA-binding subunit
  • Single-stranded DNA-binding protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Replication Protein A1 (RPA1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Replication Protein A1 (RPA1) Protein

20-abx654942
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

ELISA kit for Human RPA1 (Replication Protein A1)

ELK4413 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Replication Protein A1 (RPA1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Repl
  • Show more
Description: A sandwich ELISA kit for detection of Replication Protein A1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human RPA1 (Replication protein A1)

E-EL-H1282 1 plate of 96 wells
EUR 534
  • Gentaur's RPA1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human RPA1. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human RPA1 (Replication protein A1) in samples from Serum, Plasma, Cell supernatant

Replication Protein A1 (RPA1) Antibody (HRP)

20-abx315981
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Replication Protein A1 (RPA1) Antibody (FITC)

20-abx315982
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Replication Protein A1 (RPA1) Antibody (Biotin)

20-abx315983
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human Replication Protein A1 (RPA1) CLIA Kit

20-abx495408
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit

E02R0418-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit

E02R0418-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit

E02R0418-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Rat Replication protein A 70 kDa DNA-binding subunit (RPA1)

KTE100972-48T 48T
EUR 332
  • Replication protein A (RPA) is a 3-subunit single-stranded DNA (ssDNA)-binding protein that has been isolated from human cells and found to be essential for in vitro replication of the papovavirus SV40. The human cDNA directed production in E. coli o
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Replication protein A 70 kDa DNA-binding subunit (RPA1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Replication protein A 70 kDa DNA-binding subunit (RPA1)

KTE100972-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Replication protein A (RPA) is a 3-subunit single-stranded DNA (ssDNA)-binding protein that has been isolated from human cells and found to be essential for in vitro replication of the papovavirus SV40. The human cDNA directed production in E. coli o
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Replication protein A 70 kDa DNA-binding subunit (RPA1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Replication protein A 70 kDa DNA-binding subunit (RPA1)

KTE100972-96T 96T
EUR 539
  • Replication protein A (RPA) is a 3-subunit single-stranded DNA (ssDNA)-binding protein that has been isolated from human cells and found to be essential for in vitro replication of the papovavirus SV40. The human cDNA directed production in E. coli o
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Replication protein A 70 kDa DNA-binding subunit (RPA1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Replication Protein A1, 70 kDa Antibody

20-abx115128
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mouse Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit

E03R0418-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit

E03R0418-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit

E03R0418-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit

E04R0418-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit

E04R0418-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit

E04R0418-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit

E01R0418-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit

E01R0418-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit

E01R0418-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit

E06R0418-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit

E06R0418-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit

E06R0418-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit

E07R0418-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit

E07R0418-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit

E07R0418-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit

E08R0418-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit

E08R0418-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit

E08R0418-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit

E09R0418-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit

E09R0418-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit

E09R0418-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Replication protein A 70KDA DNA-binding subunit (RPA1)

1-CSB-EP020088HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 84 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Replication protein A 70KDA DNA-binding subunit(RPA1) expressed in E.coli

Guinea pig Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit

E05R0418-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit

E05R0418-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Replication protein A 70 kDa DNA binding subunit(RPA1) ELISA kit

E05R0418-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Replication protein A 70 kDa DNA binding subunit(RPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

RPA1 Recombinant Protein (Rat)

RP226547 100 ug Ask for price

Human RPA1 ELISA KIT

ELI-14555h 96 Tests
EUR 824

RPA1 ELISA KIT|Human

EF002550 96 Tests
EUR 689

Mouse Rpa1 ELISA KIT

ELI-30131m 96 Tests
EUR 865

Chicken RPA1 ELISA KIT

ELI-41192c 96 Tests
EUR 928

apo-A1/ Rat apo- A1 ELISA Kit

ELA-E0604r 96 Tests
EUR 886

Rat apoprotein A1(apo-A1)ELISA Kit

GA-E0751RT-48T 48T
EUR 317

Rat apoprotein A1(apo-A1)ELISA Kit

GA-E0751RT-96T 96T
EUR 496

Rat apolipoprotein A1 (Apo-A1) ELISA Kit

CSB-E08105r-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat apolipoprotein A1 (Apo-A1) in samples from serum, plasma, bronchoalveolarlavagefluid, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rat apolipoprotein A1 (Apo-A1) ELISA Kit

1-CSB-E08105r
  • EUR 967.00
  • EUR 5925.00
  • EUR 3134.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat apolipoprotein A1 (Apo-A1) in samples from serum, plasma, bronchoalveolarlavagefluid, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat apoprotein A1,apo-A1 ELISA Kit

CN-01444R1 96T
EUR 434

Rat apoprotein A1,apo-A1 ELISA Kit

CN-01444R2 48T
EUR 284

Rat apoprotein A1(apo-A1)ELISA Kit

QY-E10901 96T
EUR 361

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Replication Protein A2 (RPA2) ELISA Kit

abx595526-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

Rat Replication Initiator 1 (REPIN1) ELISA Kit

abx391903-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Replication Initiator 1(REPIN1)ELISA Kit

QY-E10499 96T
EUR 361

Repin1 ELISA Kit| Rat Replication initiator 1 ELISA Kit

EF019263 96 Tests
EUR 689

Rat Annexin A1 ELISA kit

E02A0208-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Annexin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Annexin A1 ELISA kit

E02A0208-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Annexin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Annexin A1 ELISA kit

E02A0208-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Annexin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Apolipoprotein A1 ELISA kit

E02A0509-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Apolipoprotein A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Apolipoprotein A1 ELISA kit

E02A0509-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Apolipoprotein A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Apolipoprotein A1 ELISA kit

E02A0509-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Apolipoprotein A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ephrin A1 ELISA kit

E02E0042-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Ephrin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ephrin A1 ELISA kit

E02E0042-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Ephrin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ephrin A1 ELISA kit

E02E0042-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Ephrin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat a1 microglobulin ELISA kit

E02A0689-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat a1 microglobulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat a1 microglobulin ELISA kit

E02A0689-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat a1 microglobulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat a1 microglobulin ELISA kit

E02A0689-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat a1 microglobulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Immunoglobulin A1 ELISA kit

E02I0016-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Immunoglobulin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Immunoglobulin A1 ELISA kit

E02I0016-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Immunoglobulin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Immunoglobulin A1 ELISA kit

E02I0016-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Immunoglobulin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Phospholipase A1 ELISA kit

E02P0124-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Phospholipase A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Phospholipase A1 ELISA kit

E02P0124-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Phospholipase A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Phospholipase A1 ELISA kit

E02P0124-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Phospholipase A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat A1-AGP ELISA Kit

ERA0695 96Tests
EUR 521

Rat A1-MG ELISA Kit

ERA0696 96Tests
EUR 521

Rat Apo-A1 ELISA Kit

ERA0851 96Tests
EUR 521

RPA1 Antibody

BF0367 200ul
EUR 376
Description: RPA1 antibody detects endogenous levels of total RPA1.

RPA1 antibody

70R-51326 100 ul
EUR 244
Description: Purified Polyclonal RPA1 antibody

RPA1 antibody

70R-5545 50 ug
EUR 467
Description: Rabbit polyclonal RPA1 antibody raised against the middle region of RPA1

RPA1 antibody

70R-5546 50 ug
EUR 467
Description: Rabbit polyclonal RPA1 antibody raised against the middle region of RPA1

RPA1 Antibody

ABD6172 100 ug
EUR 438

RPA1 antibody

38162-100ul 100ul
EUR 252

RPA1 antibody

10R-1208 100 ug
EUR 512
Description: Mouse monoclonal RPA1 antibody

RPA1 antibody

70R-19947 50 ul
EUR 435
Description: Rabbit polyclonal RPA1 antibody

RPA1 Antibody

DF6172 200ul
EUR 304
Description: RPA1 Antibody detects endogenous levels of total RPA1.

RPA1 siRNA

20-abx931869
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPA1 siRNA

20-abx931870
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPA1 Antibody

1-CSB-PA020088GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RPA1. Recognizes RPA1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RPA1 Antibody

1-CSB-PA020088LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPA1. Recognizes RPA1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:200-1:3000, IHC:1:20-1:200

Rat Surfactant Protein A1 (SFTPA1) ELISA Kit

abx574425-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Rat Phospholipase A1 Activating Protein ELISA kit

E02P0125-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Phospholipase A1 Activating Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Phospholipase A1 Activating Protein ELISA kit

E02P0125-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Phospholipase A1 Activating Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Phospholipase A1 Activating Protein ELISA kit

E02P0125-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Phospholipase A1 Activating Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Protein S100- A1, S100a1 ELISA KIT

ELI-53356r 96 Tests
EUR 886

Rat Surfactant Protein A1 (SFTPA1) ELISA Kit

20-abx156111
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Surfactant Protein A1 (SFTPA1) ELISA Kit

abx256019-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Rat Protein S100-A1(S100A1) ELISA kit

CSB-EL020622RA-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Protein S100-A1 (S100A1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rat Protein S100-A1(S100A1) ELISA kit

1-CSB-EL020622RA
  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Protein S100-A1(S100A1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

RPA1 Recombinant Protein (Human)

RP026776 100 ug Ask for price

RPA1 Recombinant Protein (Mouse)

RP168854 100 ug Ask for price

RPA1 Recombinant Protein (Mouse)

RP168857 100 ug Ask for price

Human Replication Protein A2 (RPA2) ELISA Kit

abx382883-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Replication Protein A3 (RPA3) ELISA Kit

abx382884-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

ELISA kit for Rat SP-A1 (Pulmonary surfactant-associated protein A1)

E-EL-R0060 1 plate of 96 wells
EUR 534
  • Gentaur's SP-A1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat SP-A1. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat SP-A1 (Pulmonary surfactant-associated protein A1) in samples from Serum, Plasma, Cell supernatant

S100a1 ELISA Kit| Rat Protein S100-A1 ELISA Kit

EF019285 96 Tests
EUR 689

Rat anti-apolipoprotein A1(Apo-A1)antibody ELISA kit

E02A2043-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat anti-apolipoprotein A1(Apo-A1)antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat anti-apolipoprotein A1(Apo-A1)antibody ELISA kit

E02A2043-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat anti-apolipoprotein A1(Apo-A1)antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat anti-apolipoprotein A1(Apo-A1)antibody ELISA kit

E02A2043-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat anti-apolipoprotein A1(Apo-A1)antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat DNA replication licensing factor MCM3 ELISA kit

E02D0531-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat DNA replication licensing factor MCM3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat DNA replication licensing factor MCM3 ELISA kit

E02D0531-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat DNA replication licensing factor MCM3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat DNA replication licensing factor MCM3 ELISA kit

E02D0531-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat DNA replication licensing factor MCM3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rpa1 ORF Vector (Rat) (pORF)

ORF075517 1.0 ug DNA
EUR 506

RPA1 Protein Vector (Rat) (pPB-C-His)

PV302066 500 ng
EUR 1166

RPA1 Protein Vector (Rat) (pPB-N-His)

PV302067 500 ng
EUR 1166

RPA1 Protein Vector (Rat) (pPM-C-HA)

PV302068 500 ng
EUR 1166

RPA1 Protein Vector (Rat) (pPM-C-His)

PV302069 500 ng
EUR 1166

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

ES Electrophoresis Casting Tray, 7cm X 14cm

LE1011-A1 Ea
EUR 165

Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol)

RAT-5 1
EUR 1138

Rat Ephrin A1 (EFNA1) ELISA Kit

abx516828-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Annexin A1 (ANXA1) ELISA Kit

abx512632-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Apolipoprotein A1 (APOA1) ELISA Kit

abx575111-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Carboxypeptidase A1(CPA1) ELISA kit

E02C1990-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Carboxypeptidase A1(CPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Carboxypeptidase A1(CPA1) ELISA kit

E02C1990-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Carboxypeptidase A1(CPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Carboxypeptidase A1(CPA1) ELISA kit

E02C1990-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Carboxypeptidase A1(CPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat a1 Acid glycoprotein ELISA kit

E02A0688-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat a1 Acid glycoprotein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat a1 Acid glycoprotein ELISA kit

E02A0688-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat a1 Acid glycoprotein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat a1 Acid glycoprotein ELISA kit

E02A0688-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat a1 Acid glycoprotein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cyclin A1(CCNA1) ELISA kit

E02C1444-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cyclin A1(CCNA1) ELISA kit

E02C1444-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cyclin A1(CCNA1) ELISA kit

E02C1444-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Apolipoprotein A1 precursor ELISA kit

E02P0714-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Apolipoprotein A1 precursor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Apolipoprotein A1 precursor ELISA kit

E02P0714-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Apolipoprotein A1 precursor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Apolipoprotein A1 precursor ELISA kit

E02P0714-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Apolipoprotein A1 precursor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Plexin A1 PicoKine ELISA Kit

EK1819 96 wells
EUR 425
Description: For quantitative detection of rat Plexin A1 in cell culture supernates, serum and plasma (heparin, EDTA).

Rat Pre-APO-A1 ELISA Kit

ERP0721 96Tests
EUR 521

Rat Apolipoprotein A1 (APOA1) ELISA Kit

20-abx155214
  • EUR 6580.00
  • EUR 3510.00
  • EUR 817.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Phospholipase A1 (PLA1A) ELISA Kit

abx353836-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Rat Cyclin A1 (CCNA1) ELISA Kit

abx354064-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Rat Apolipoprotein A1 (APOA1) ELISA Kit

abx256312-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Annexin A1 (ANXA1) ELISA Kit

20-abx258091
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Apolipoprotein A1 (APOA1) ELISA Kit

DLR-APOA1-Ra-48T 48T
EUR 467
  • Should the Rat Apolipoprotein A1 (APOA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Apolipoprotein A1 (APOA1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Apolipoprotein A1 (APOA1) ELISA Kit

DLR-APOA1-Ra-96T 96T
EUR 605
  • Should the Rat Apolipoprotein A1 (APOA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Apolipoprotein A1 (APOA1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Anxa1/ Annexin A1 ELISA Kit

E0072Ra 1 Kit
EUR 571

Rat Apolipoprotein A1 (APOA1) ELISA Kit

SEA519Ra-10x96wellstestplate 10x96-wells test plate
EUR 4129.36
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Apolipoprotein A1 (APOA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Apolipoprotein A1 (APOA1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Apolipoprotein A1 (APOA1) ELISA Kit

SEA519Ra-1x48wellstestplate 1x48-wells test plate
EUR 427.71
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Apolipoprotein A1 (APOA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Apolipoprotein A1 (APOA1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Apolipoprotein A1 (APOA1) ELISA Kit

SEA519Ra-1x96wellstestplate 1x96-wells test plate
EUR 568.16
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Apolipoprotein A1 (APOA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Apolipoprotein A1 (APOA1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Apolipoprotein A1 (APOA1) ELISA Kit

SEA519Ra-5x96wellstestplate 5x96-wells test plate
EUR 2256.72
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Apolipoprotein A1 (APOA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Apolipoprotein A1 (APOA1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Apolipoprotein A1 (APOA1) ELISA Kit

4-SEA519Ra
  • EUR 4180.00
  • EUR 2207.00
  • EUR 569.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Apolipoprotein A1 elisa. Alternative names of the recognized antigen: Apo-A1
  • ApoA-1 Milano
  • ProapoA-I
  • Proapolipoprotein A-I
  • Truncated apolipoprotein A-I
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Apolipoprotein A1 (APOA1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Apolipoprotein A1 ELISA Kit (APOA1)

RK03503 96 Tests
EUR 521

Rat Apolipoprotein A1 (APOA1) ELISA Kit

RD-APOA1-Ra-48Tests 48 Tests
EUR 465

Rat Apolipoprotein A1 (APOA1) ELISA Kit

RD-APOA1-Ra-96Tests 96 Tests
EUR 643

Rat Apolipoprotein A1 (APOA1) ELISA Kit

RDR-APOA1-Ra-48Tests 48 Tests
EUR 486

Rat Apolipoprotein A1 (APOA1) ELISA Kit

RDR-APOA1-Ra-96Tests 96 Tests
EUR 672

Rat Phospholipase A1(PLA1)ELISA kit

QY-E10547 96T
EUR 413

Rat Annexin A1 (ANXA1) ELISA Kit

SEE787Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Annexin A1 (ANXA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Annexin A1 (ANXA1) in serum, plasma, tissue homogenates and other biological fluids.

Rat Annexin A1 (ANXA1) ELISA Kit

SEE787Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Annexin A1 (ANXA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Annexin A1 (ANXA1) in serum, plasma, tissue homogenates and other biological fluids.

Rat Annexin A1 (ANXA1) ELISA Kit

SEE787Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Annexin A1 (ANXA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Annexin A1 (ANXA1) in serum, plasma, tissue homogenates and other biological fluids.

Rat Annexin A1 (ANXA1) ELISA Kit

SEE787Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Annexin A1 (ANXA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Annexin A1 (ANXA1) in serum, plasma, tissue homogenates and other biological fluids.

Rat Annexin A1 (ANXA1) ELISA Kit

4-SEE787Ra
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Annexin A1 elisa. Alternative names of the recognized antigen: ANX-A1
  • ANX1
  • LPC1
  • Lipocortin I
  • Chromobindin-9
  • Calpactin II
  • Phospholipase A2 inhibitory protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Annexin A1 (ANXA1) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rat Apolipoprotein A1 Binding Protein (APOA1BP) ELISA Kit

abx514877-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

ELISA kit for Rat Protein S100-A1 (S100A1)

KTE100292-48T 48T
EUR 332
  • A1is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. This protein may function in stimulation of Ca2+-induced Ca2+ release, inhibition of microtubule assembly, and inhibition of protein kinase C-mediated phosphory
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Protein S100-A1 (S100A1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Protein S100-A1 (S100A1)

KTE100292-5platesof96wells 5 plates of 96 wells
EUR 2115
  • A1is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. This protein may function in stimulation of Ca2+-induced Ca2+ release, inhibition of microtubule assembly, and inhibition of protein kinase C-mediated phosphory
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Protein S100-A1 (S100A1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Protein S100-A1 (S100A1)

KTE100292-96T 96T
EUR 539
  • A1is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. This protein may function in stimulation of Ca2+-induced Ca2+ release, inhibition of microtubule assembly, and inhibition of protein kinase C-mediated phosphory
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Protein S100-A1 (S100A1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Apolipoprotein A1 precursor (Pre-Apo-A1)

KTE100448-48T 48T
EUR 354
Description: Quantitative sandwich ELISA for measuring Rat Apolipoprotein A1 precursor (Pre-Apo-A1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Apolipoprotein A1 precursor (Pre-Apo-A1)

KTE100448-5platesof96wells 5 plates of 96 wells
EUR 2252
Description: Quantitative sandwich ELISA for measuring Rat Apolipoprotein A1 precursor (Pre-Apo-A1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Apolipoprotein A1 precursor (Pre-Apo-A1)

KTE100448-96T 96T
EUR 572
Description: Quantitative sandwich ELISA for measuring Rat Apolipoprotein A1 precursor (Pre-Apo-A1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human replication protein A(RPA-70)ELISA Kit

GA-E1930HM-48T 48T
EUR 289

Human replication protein A(RPA-70)ELISA Kit

GA-E1930HM-96T 96T
EUR 466

Human replication protein A,RPA-70 ELISA Kit

201-12-1914 96 tests
EUR 440
  • This replication protein A ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human replication protein A,RPA-70 ELISA Kit

CN-04330H1 96T
EUR 449

Human replication protein A,RPA-70 ELISA Kit

CN-04330H2 48T
EUR 299

Human replication protein A(RPA-70)ELISA Kit

QY-E03530 96T
EUR 361

RPA1 Conjugated Antibody

C38162 100ul
EUR 397

RPA1 Blocking Peptide

BF0367-BP 1mg
EUR 195

RPA1 cloning plasmid

CSB-CL020088HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1851
  • Sequence: atggtcggccaactgagcgagggggccattgcggccatcatgcagaagggggatacaaacataaagcccatcctccaagtcatcaacatccgtcccattactacggggaatagtccgccgcgttatcgactgctcatgagtgatggattgaacactctatcctctttcatgttgg
  • Show more
Description: A cloning plasmid for the RPA1 gene.

RPA1 Polyclonal Antibody

ES9601-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RPA1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

RPA1 Polyclonal Antibody

ES9601-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RPA1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

anti- RPA1 antibody

FNab07391 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • Immunogen: replication protein A1, 70kDa
  • Uniprot ID: P27694
  • Gene ID: 6117
  • Research Area: Metabolism
Description: Antibody raised against RPA1

RPA1 Blocking Peptide

20-abx064201
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

RPA1 Polyclonal Antibody

ABP60232-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human RPA1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of RPA1 from Human. This RPA1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RPA1 protein

RPA1 Polyclonal Antibody

ABP60232-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human RPA1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of RPA1 from Human. This RPA1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RPA1 protein

RPA1 Polyclonal Antibody

ABP60232-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RPA1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of RPA1 from Human. This RPA1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RPA1 protein

RPA1 Rabbit pAb

A0874-100ul 100 ul
EUR 308

RPA1 Rabbit pAb

A0874-200ul 200 ul
EUR 459

RPA1 Rabbit pAb

A0874-20ul 20 ul
EUR 183

RPA1 Rabbit pAb

A0874-50ul 50 ul
EUR 223

RPA1 Rabbit pAb

A0990-100ul 100 ul
EUR 308

RPA1 Rabbit pAb

A0990-200ul 200 ul
EUR 459

RPA1 Rabbit pAb

A0990-20ul 20 ul
EUR 183

RPA1 Rabbit pAb

A0990-50ul 50 ul
EUR 223

RPA1 Blocking Peptide

33R-8749 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RPA1 antibody, catalog no. 70R-5545

RPA1 Blocking Peptide

33R-9194 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RPA1 antibody, catalog no. 70R-5546

RPA1 Blocking Peptide

DF6172-BP 1mg
EUR 195

Anti-RPA1 antibody

PAab07391 100 ug
EUR 386

anti-RPA1 (4C4)

LF-MA30702 100 ul
EUR 527
Description: Mouse Monoclonal to RPA1

Anti-RPA1 antibody

STJ25385 100 µl
EUR 277

Anti-RPA1 antibody

STJ114904 100 µl
EUR 277

Anti-RPA1 antibody

STJ190759 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RPA1

Human apoprotein A1(apo-A1)ELISA Kit

GA-E1552HM-48T 48T
EUR 289

Human apoprotein A1(apo-A1)ELISA Kit

GA-E1552HM-96T 96T
EUR 466

Rabbit apoprotein A1,apo-A1 ELISA Kit

GA-E0038RB-48T 48T
EUR 326

Rabbit apoprotein A1,apo-A1 ELISA Kit

GA-E0038RB-96T 96T
EUR 524

Human apoprotein A1,apo-A1 ELISA Kit

201-12-1536 96 tests
EUR 440
  • This apoprotein A1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human apolipoprotein A1 (Apo-A1) ELISA Kit

CSB-E08103h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human apolipoprotein A1 (Apo-A1) in samples from serum, plasma, cell culture supernates, saliva, urine. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human apolipoprotein A1 (Apo-A1) ELISA Kit

1-CSB-E08103h
  • EUR 657.00
  • EUR 4484.00
  • EUR 2384.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human apolipoprotein A1 (Apo-A1) in samples from serum, plasma, cell culture supernates, saliva, urine. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse apolipoprotein A1(Apo-A1) ELISA Kit

CSB-E08104m-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse apolipoprotein A1 (Apo-A1) in samples from serum, plasma, cell culture supernates, urine, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse apolipoprotein A1(Apo-A1) ELISA Kit

1-CSB-E08104m
  • EUR 946.00
  • EUR 5782.00
  • EUR 3060.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse apolipoprotein A1(Apo-A1) in samples from serum, plasma, cell culture supernates, urine, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Monkey apolipoprotein A1 (Apo-A1) ELISA Kit

CSB-E11041Mo-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Monkey apolipoprotein A1 (Apo-A1) in samples from serum, plasma. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Monkey apolipoprotein A1 (Apo-A1) ELISA Kit

1-CSB-E11041Mo
  • EUR 967.00
  • EUR 5925.00
  • EUR 3134.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Monkey apolipoprotein A1 (Apo-A1) in samples from serum, plasma. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Pig apolipoprotein A1 (Apo-A1) ELISA Kit

CSB-E06834p-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativecompetitive ELISA kit for measuring Pig apolipoprotein A1 (Apo-A1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Pig apolipoprotein A1 (Apo-A1) ELISA Kit

1-CSB-E06834p
  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativecompetitive ELISA kit for measuring Pig apolipoprotein A1 (Apo-A1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Monkey apoprotein A1,apo-A1 ELISA Kit

CN-02223M1 96T
EUR 449

Human apoprotein A1,apo-A1 ELISA Kit

CN-03325H1 96T
EUR 451

Human apoprotein A1,apo-A1 ELISA Kit

CN-03325H2 48T
EUR 300

Rabbit apolipoprotein A1 (Apo-A1) ELISA Kit

CSB-E09804Rb-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rabbit apolipoprotein A1 (Apo-A1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rabbit apolipoprotein A1 (Apo-A1) ELISA Kit

1-CSB-E09804Rb
  • EUR 767.00
  • EUR 5089.00
  • EUR 2699.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rabbit apolipoprotein A1 (Apo-A1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rabbit apoprotein A1,apo-A1 ELISA Kit

CN-00595R1 96T
EUR 441

Rabbit apoprotein A1,apo-A1 ELISA Kit

CN-00595R2 48T
EUR 291

PoFAine apoprotein A1,apo-A1 ELISA Kit

CN-01220P1 96T
EUR 447

PoFAine apoprotein A1,apo-A1 ELISA Kit

CN-01220P2 48T
EUR 296

Human apoprotein A1(apo-A1)ELISA Kit

QY-E00339 96T
EUR 394