Rat SLN(Sarcolipin) ELISA Kit

Rat SLN(Sarcolipin) ELISA Kit

To Order Contact us:  Mark@operatiebrp.nl

Rat Sarcolipin (SLN) ELISA Kit

RD-SLN-Ra-48Tests 48 Tests
EUR 557

Rat Sarcolipin (SLN) ELISA Kit

RD-SLN-Ra-96Tests 96 Tests
EUR 775

Rat Sarcolipin (SLN) ELISA Kit

RDR-SLN-Ra-48Tests 48 Tests
EUR 583

Rat Sarcolipin (SLN) ELISA Kit

RDR-SLN-Ra-96Tests 96 Tests
EUR 811

Human Sarcolipin (SLN) ELISA Kit

DLR-SLN-Hu-48T 48T
EUR 517
  • Should the Human Sarcolipin (SLN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Sarcolipin (SLN) in samples from tissue homogenates or other biological fluids.

Human Sarcolipin (SLN) ELISA Kit

DLR-SLN-Hu-96T 96T
EUR 673
  • Should the Human Sarcolipin (SLN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Sarcolipin (SLN) in samples from tissue homogenates or other biological fluids.

Human Sarcolipin (SLN) ELISA Kit

RD-SLN-Hu-48Tests 48 Tests
EUR 521

Human Sarcolipin (SLN) ELISA Kit

RD-SLN-Hu-96Tests 96 Tests
EUR 723

Human Sarcolipin (SLN) ELISA Kit

RDR-SLN-Hu-48Tests 48 Tests
EUR 544

Human Sarcolipin (SLN) ELISA Kit

RDR-SLN-Hu-96Tests 96 Tests
EUR 756

Rat Sarcolipin, Sln ELISA KIT

ELI-18888r 96 Tests
EUR 886

Rat Sarcolipin (SLN) ELISA Kit

20-abx156065
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Sarcolipin (SLN) ELISA Kit

SEC848Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Sarcolipin (SLN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Sarcolipin (SLN) in Tissue homogenates and other biological fluids.

Rat Sarcolipin (SLN) ELISA Kit

SEC848Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Sarcolipin (SLN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Sarcolipin (SLN) in Tissue homogenates and other biological fluids.

Rat Sarcolipin (SLN) ELISA Kit

SEC848Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Sarcolipin (SLN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Sarcolipin (SLN) in Tissue homogenates and other biological fluids.

Rat Sarcolipin (SLN) ELISA Kit

SEC848Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Sarcolipin (SLN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Sarcolipin (SLN) in Tissue homogenates and other biological fluids.

Rat Sarcolipin (SLN) ELISA Kit

4-SEC848Ra
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Sarcolipin elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Sarcolipin (SLN) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rat Sarcolipin ELISA Kit (SLN)

RK03952 96 Tests
EUR 521

Rat Sarcolipin (SLN) Protein

20-abx654988
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Rat Sarcolipin (SLN) CLIA Kit

20-abx493936
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Rat SLN (Sarcolipin)

ELK7068 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Sarcolipin (SLN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Sarcolipin (SLN).
  • Show more
Description: A sandwich ELISA kit for detection of Sarcolipin from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat Sarcolipin (SLN)

KTE100238-48T 48T
EUR 332
  • Sarcoplasmic reticulum Ca(2+)-ATPases are transmembrane proteins that catalyze the ATP-dependent transport of Ca(2+) from the cytosol into the lumen of the sarcoplasmic reticulum in muscle cells. Sarcolipin is a small proteolipid that regulates sever
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Sarcolipin (SLN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Sarcolipin (SLN)

KTE100238-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Sarcoplasmic reticulum Ca(2+)-ATPases are transmembrane proteins that catalyze the ATP-dependent transport of Ca(2+) from the cytosol into the lumen of the sarcoplasmic reticulum in muscle cells. Sarcolipin is a small proteolipid that regulates sever
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Sarcolipin (SLN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Sarcolipin (SLN)

KTE100238-96T 96T
EUR 539
  • Sarcoplasmic reticulum Ca(2+)-ATPases are transmembrane proteins that catalyze the ATP-dependent transport of Ca(2+) from the cytosol into the lumen of the sarcoplasmic reticulum in muscle cells. Sarcolipin is a small proteolipid that regulates sever
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Sarcolipin (SLN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Sarcolipin (SLN) Antibody

20-abx115382
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sarcolipin (SLN) Antibody

20-abx174457
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Sarcolipin (SLN) Antibody

20-abx174458
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Sarcolipin (SLN) Antibody

abx237987-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Sarcolipin (SLN) Antibody

20-abx178309
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Sarcolipin (SLN) Antibody

20-abx178310
  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Mouse Sarcolipin, Sln ELISA KIT

ELI-20144m 96 Tests
EUR 865

Rabbit Sarcolipin, SLN ELISA KIT

ELI-20145Ra 96 Tests
EUR 928

Human Sarcolipin, SLN ELISA KIT

ELI-29539h 96 Tests
EUR 824

Human Sarcolipin (SLN) ELISA Kit

20-abx153017
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Sarcolipin (SLN) ELISA Kit

SEC848Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sarcolipin (SLN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sarcolipin (SLN) in Tissue homogenates and other biological fluids.

Human Sarcolipin (SLN) ELISA Kit

SEC848Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sarcolipin (SLN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sarcolipin (SLN) in Tissue homogenates and other biological fluids.

Human Sarcolipin (SLN) ELISA Kit

SEC848Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sarcolipin (SLN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sarcolipin (SLN) in Tissue homogenates and other biological fluids.

Human Sarcolipin (SLN) ELISA Kit

SEC848Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sarcolipin (SLN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sarcolipin (SLN) in Tissue homogenates and other biological fluids.

Human Sarcolipin (SLN) ELISA Kit

4-SEC848Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Sarcolipin elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Sarcolipin (SLN) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Sarcolipin ELISA Kit (SLN)

RK02300 96 Tests
EUR 521

Human Sarcolipin(SLN)ELISA Kit

QY-E03004 96T
EUR 361

ELISA kit for Human SLN (Sarcolipin)

ELK3935 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Sarcolipin (SLN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Sarcolipin (SLN).
  • Show more
Description: A sandwich ELISA kit for detection of Sarcolipin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Sarcolipin (SLN)

KTE60578-48T 48T
EUR 332
  • Sarcoplasmic reticulum Ca(2+)-ATPases are transmembrane proteins that catalyze the ATP-dependent transport of Ca(2+) from the cytosol into the lumen of the sarcoplasmic reticulum in muscle cells. Sarcolipin is a small proteolipid that regulates sever
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Sarcolipin (SLN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Sarcolipin (SLN)

KTE60578-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Sarcoplasmic reticulum Ca(2+)-ATPases are transmembrane proteins that catalyze the ATP-dependent transport of Ca(2+) from the cytosol into the lumen of the sarcoplasmic reticulum in muscle cells. Sarcolipin is a small proteolipid that regulates sever
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Sarcolipin (SLN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Sarcolipin (SLN)

KTE60578-96T 96T
EUR 539
  • Sarcoplasmic reticulum Ca(2+)-ATPases are transmembrane proteins that catalyze the ATP-dependent transport of Ca(2+) from the cytosol into the lumen of the sarcoplasmic reticulum in muscle cells. Sarcolipin is a small proteolipid that regulates sever
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Sarcolipin (SLN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Sarcolipin (SLN) CLIA Kit

20-abx493935
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Sarcolipin (SLN) Protein

20-abx654987
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

SLN ELISA Kit (Rat) (OKDD00843)

OKDD00843 96 Wells
EUR 1040
Description: Description of target: Reversibly inhibits the activity of atp2a1 in sarcoplasmic reticulum by decreasing the apparent affinity of the atpase for ca2+. modulates calcium re-uptake during muscle relaxation and plays an important role in calcium homeostasis in muscle. required for muscle-based, non-shivering thermogenesis (by similarity).;Species reactivity: Rat;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.058ng/mL

SLN ELISA KIT|Human

EF003037 96 Tests
EUR 689

SLN ELISA Kit (Human) (OKCD01707)

OKCD01707 96 Wells
EUR 831
Description: Description of target: Reversibly inhibits the activity of ATP2A1 in sarcoplasmic reticulum by decreasing the apparent affinity of the ATPase for Ca2+. Modulates calcium re-uptake during muscle relaxation and plays an important role in calcium homeostasis in muscle. Required for muscle-based, non-shivering thermogenesis.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.121 ng/mL

Rat SLN shRNA Plasmid

20-abx990682
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SLN Recombinant Protein (Rat)

RP229979 100 ug Ask for price

SLN siRNA

20-abx905135
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SLN antibody

70R-20378 50 ul
EUR 435
Description: Rabbit polyclonal SLN antibody

SLN siRNA

20-abx934265
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SLN siRNA

20-abx934266
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SLN Antibody

1-CSB-PA021780GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SLN. Recognizes SLN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Sln ORF Vector (Rat) (pORF)

ORF076661 1.0 ug DNA
EUR 506

SLN cloning plasmid

CSB-CL021780HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 108
  • Sequence: atggtcctgggattgactgagatgctccggagctgcctgctctatgccctgagaccccactgctgtcattgtcacaggatgccattctccatccgagggcacctgtga
Description: A cloning plasmid for the SLN gene.

SLN cloning plasmid

CSB-CL021780HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 96
  • Sequence: ATGGGGATAAACACCCGGGAGCTGTTTCTCAACTTCACTATTGTCTTGATTACGGTTATTCTTATGTGGCTCCTTGTGAGGTCCTATCAGTACTGA
Description: A cloning plasmid for the SLN gene.

anti- SLN antibody

FNab07987 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:50-1:500
  • IF: 1:20-1:200
  • Immunogen: sarcolipin
  • Uniprot ID: O00631
  • Gene ID: 6588
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against SLN

Anti-SLN antibody

PAab07987 100 ug
EUR 386

Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol)

RAT-5 1
EUR 1138

Sln sgRNA CRISPR Lentivector set (Rat)

K6259301 3 x 1.0 ug
EUR 339

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Mouse SLN shRNA Plasmid

20-abx975588
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SLN shRNA Plasmid

20-abx954475
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SLN Recombinant Protein (Human)

RP029320 100 ug Ask for price

SLN Recombinant Protein (Human)

RP043588 100 ug Ask for price

SLN Recombinant Protein (Mouse)

RP173738 100 ug Ask for price

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Sln sgRNA CRISPR Lentivector (Rat) (Target 1)

K6259302 1.0 ug DNA
EUR 154

Sln sgRNA CRISPR Lentivector (Rat) (Target 2)

K6259303 1.0 ug DNA
EUR 154

Sln sgRNA CRISPR Lentivector (Rat) (Target 3)

K6259304 1.0 ug DNA
EUR 154

SLN Protein Vector (Rat) (pPB-C-His)

PV306642 500 ng
EUR 603

SLN Protein Vector (Rat) (pPB-N-His)

PV306643 500 ng
EUR 603

SLN Protein Vector (Rat) (pPM-C-HA)

PV306644 500 ng
EUR 603

SLN Protein Vector (Rat) (pPM-C-His)

PV306645 500 ng
EUR 603

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Sln ORF Vector (Mouse) (pORF)

ORF057914 1.0 ug DNA
EUR 506

SLN ORF Vector (Human) (pORF)

ORF009774 1.0 ug DNA
EUR 95

SLN ORF Vector (Human) (pORF)

ORF014530 1.0 ug DNA
EUR 354

SLN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV682195 1.0 ug DNA
EUR 514

SLN Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV682199 1.0 ug DNA
EUR 514

SLN Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV682200 1.0 ug DNA
EUR 514

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

CAS9LIG-KIT 1 Kit
EUR 153
  • Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

SLN sgRNA CRISPR Lentivector set (Human)

K2196901 3 x 1.0 ug
EUR 339

Sln sgRNA CRISPR Lentivector set (Mouse)

K4052401 3 x 1.0 ug
EUR 339

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

vWF Acty. Kit

ABP-ACT-KIT 12 x 8 microwells
EUR 428

vWF Ant. Kit

ABP-TOT-KIT 12 x 8 microwells
EUR 394

Sln sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6259305 3 x 1.0 ug
EUR 376

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)

CAS620A-KIT 1 kit
EUR 2152
  • Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

SLN sgRNA CRISPR Lentivector (Human) (Target 1)

K2196902 1.0 ug DNA
EUR 154

SLN sgRNA CRISPR Lentivector (Human) (Target 2)

K2196903 1.0 ug DNA
EUR 154

SLN sgRNA CRISPR Lentivector (Human) (Target 3)

K2196904 1.0 ug DNA
EUR 154

Sln sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4052402 1.0 ug DNA
EUR 154

Sln sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4052403 1.0 ug DNA
EUR 154

Sln sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4052404 1.0 ug DNA
EUR 154

SLN Protein Vector (Human) (pPB-C-His)

PV058117 500 ng
EUR 481

SLN Protein Vector (Human) (pPB-N-His)

PV058118 500 ng
EUR 481

SLN Protein Vector (Human) (pPM-C-HA)

PV058119 500 ng
EUR 481

SLN Protein Vector (Human) (pPM-C-His)

PV058120 500 ng
EUR 481

SLN Protein Vector (Human) (pPB-C-His)

PV039093 500 ng
EUR 329

SLN Protein Vector (Human) (pPB-N-His)

PV039094 500 ng
EUR 329

SLN Protein Vector (Human) (pPM-C-HA)

PV039095 500 ng
EUR 329

SLN Protein Vector (Human) (pPM-C-His)

PV039096 500 ng
EUR 329

SLN Protein Vector (Mouse) (pPB-C-His)

PV231654 500 ng
EUR 603

SLN Protein Vector (Mouse) (pPB-N-His)

PV231655 500 ng
EUR 603

SLN Protein Vector (Mouse) (pPM-C-HA)

PV231656 500 ng
EUR 603

SLN Protein Vector (Mouse) (pPM-C-His)

PV231657 500 ng
EUR 603

Sln 3'UTR GFP Stable Cell Line

TU169277 1.0 ml Ask for price

SLN 3'UTR Luciferase Stable Cell Line

TU023687 1.0 ml
EUR 1394

Sln 3'UTR Luciferase Stable Cell Line

TU119277 1.0 ml Ask for price

SLN 3'UTR GFP Stable Cell Line

TU073687 1.0 ml
EUR 1394

Sln 3'UTR Luciferase Stable Cell Line

TU220795 1.0 ml Ask for price

Sln 3'UTR GFP Stable Cell Line

TU270795 1.0 ml Ask for price

PrecisionX Multiplex gRNA Cloning Kit

CAS9-GRNA-KIT 10 rxn
EUR 445
  • Category: Cas9

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

Sln sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6259306 1.0 ug DNA
EUR 167

Sln sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6259307 1.0 ug DNA
EUR 167

Sln sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6259308 1.0 ug DNA
EUR 167

SLN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV682196 1.0 ug DNA
EUR 514

SLN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV682197 1.0 ug DNA
EUR 572

SLN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV682198 1.0 ug DNA
EUR 572

SLN Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV702969 1.0 ug DNA
EUR 450

SLN Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV702973 1.0 ug DNA
EUR 450

SLN Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV702974 1.0 ug DNA
EUR 450

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent)

CASCL9-100A-KIT 1 Kit
EUR 1132
  • Category: Cas9

SLN sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K2196905 3 x 1.0 ug
EUR 376

Sln sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4052405 3 x 1.0 ug
EUR 376

SLN sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K2196906 1.0 ug DNA
EUR 167

SLN sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K2196907 1.0 ug DNA
EUR 167

SLN sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K2196908 1.0 ug DNA
EUR 167

Sln sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4052406 1.0 ug DNA
EUR 167

Sln sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4052407 1.0 ug DNA
EUR 167

Sln sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4052408 1.0 ug DNA
EUR 167

SLN Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV702970 1.0 ug DNA
EUR 450

SLN Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV702971 1.0 ug DNA
EUR 508

SLN Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV702972 1.0 ug DNA
EUR 508

AXYGEN® AXYPET® PRO STARTER KIT: 4 PIPETTORS, PLEXI STAND, SAMPLE TIPS

AP-STR-KIT-P 1/pk
EUR 721
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

/ Rat ELISA Kit

ELA-E0703r 96 Tests
EUR 886

/ Rat ELISA Kit

ELA-E1084r 96 Tests
EUR 886

TRF ELISA Kit| Rat Transferrin ELISA Kit

EF018096 96 Tests
EUR 689

TRX ELISA Kit| Rat Thioredoxin ELISA Kit

EF018097 96 Tests
EUR 689

TRY ELISA Kit| Rat Trypsin ELISA Kit

EF018099 96 Tests
EUR 689

TYR ELISA Kit| Rat Tyrosinase ELISA Kit

EF018105 96 Tests
EUR 689

VF ELISA Kit| Rat Visfatin ELISA Kit

EF018113 96 Tests
EUR 689

AD ELISA Kit| Rat Adropin ELISA Kit

EF018137 96 Tests
EUR 689

T ELISA Kit| Rat Testosterone ELISA Kit

EF018139 96 Tests
EUR 689

Ach ELISA Kit| Rat Acetylcholine ELISA Kit

EF018143 96 Tests
EUR 689

CFP ELISA Kit| Rat Properdin ELISA Kit

EF018144 96 Tests
EUR 689

BrdU ELISA Kit| Rat Bromodeoxyuridine ELISA Kit

EF018146 96 Tests
EUR 689

Estrone ELISA Kit| Rat Estrone ELISA Kit

EF018156 96 Tests
EUR 689

E2 ELISA Kit| Rat Estradiol ELISA Kit

EF018157 96 Tests
EUR 689

HCY ELISA Kit| Rat Homocysteine ELISA Kit

EF018158 96 Tests
EUR 689

GAGs ELISA Kit| Rat Glycosaminoglycan ELISA Kit

EF018159 96 Tests
EUR 689

DAG ELISA Kit| Rat Diacylglycerol ELISA Kit

EF018164 96 Tests
EUR 689

MTL5 ELISA Kit| Rat Tesmin ELISA Kit

EF018168 96 Tests
EUR 689

FATP4 ELISA Kit| Rat FATP4 ELISA Kit

EF018183 96 Tests
EUR 689

Hyp ELISA Kit| Rat Hydroxyproline ELISA Kit

EF018211 96 Tests
EUR 689

Adipolin ELISA Kit| Rat FAM132A ELISA Kit

EF018220 96 Tests
EUR 689

Calprotectin ELISA Kit| Rat Calprotectin ELISA Kit

EF018230 96 Tests
EUR 689

Ahi1 ELISA Kit| Rat Jouberin ELISA Kit

EF018267 96 Tests
EUR 689

Ahcy ELISA Kit| Rat Adenosylhomocysteinase ELISA Kit

EF018288 96 Tests
EUR 689

Afm ELISA Kit| Rat Afamin ELISA Kit

EF018303 96 Tests
EUR 689

Atrn ELISA Kit| Rat Attractin ELISA Kit

EF018356 96 Tests
EUR 689

Bsnd ELISA Kit| Rat Barttin ELISA Kit

EF018361 96 Tests
EUR 689

Bfsp1 ELISA Kit| Rat Filensin ELISA Kit

EF018367 96 Tests
EUR 689

Bscl2 ELISA Kit| Rat Seipin ELISA Kit

EF018368 96 Tests
EUR 689

Bgn ELISA Kit| Rat Biglycan ELISA Kit

EF018374 96 Tests
EUR 689

Btd ELISA Kit| Rat Biotinidase ELISA Kit

EF018377 96 Tests
EUR 689

Ccin ELISA Kit| Rat Calicin ELISA Kit

EF018416 96 Tests
EUR 689

Cdca8 ELISA Kit| Rat Borealin ELISA Kit

EF018458 96 Tests
EUR 689

Cntln ELISA Kit| Rat Centlein ELISA Kit

EF018460 96 Tests
EUR 689

Chad ELISA Kit| Rat Chondroadherin ELISA Kit

EF018480 96 Tests
EUR 689

Cygb ELISA Kit| Rat Cytoglobin ELISA Kit

EF018543 96 Tests
EUR 689

Dfnb31 ELISA Kit| Rat Whirlin ELISA Kit

EF018555 96 Tests
EUR 689

Dstn ELISA Kit| Rat Destrin ELISA Kit

EF018573 96 Tests
EUR 689

Dpys ELISA Kit| Rat Dihydropyrimidinase ELISA Kit

EF018581 96 Tests
EUR 689

Dixdc1 ELISA Kit| Rat Dixin ELISA Kit

EF018596 96 Tests
EUR 689

Dbn1 ELISA Kit| Rat Drebrin ELISA Kit

EF018604 96 Tests
EUR 689

Dym ELISA Kit| Rat Dymeclin ELISA Kit

EF018613 96 Tests
EUR 689

Dtnbp1 ELISA Kit| Rat Dysbindin ELISA Kit

EF018621 96 Tests
EUR 689

Emb ELISA Kit| Rat Embigin ELISA Kit

EF018628 96 Tests
EUR 689

Emd ELISA Kit| Rat Emerin ELISA Kit

EF018629 96 Tests
EUR 689

Emcn ELISA Kit| Rat Endomucin ELISA Kit

EF018631 96 Tests
EUR 689

Ermn ELISA Kit| Rat Ermin ELISA Kit

EF018647 96 Tests
EUR 689

Espn ELISA Kit| Rat Espin ELISA Kit

EF018649 96 Tests
EUR 689

Flcn ELISA Kit| Rat Folliculin ELISA Kit

EF018702 96 Tests
EUR 689