Human EGLN1(Egl Nine Homolog 1) ELISA Kit
To Order Contact us: Mark@operatiebrp.nl
 ELISA Kit) Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit |
|
RD-EGLN1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 802 |
 Antibody) Egl Nine Homolog 1 (EGLN1) Antibody |
|
20-abx176226 |
Abbexa |
|
|
|
|
Egl Nine Homolog 1 (EGLN1) Antibody |
|
20-abx176227 |
Abbexa |
|
|
|
|
Egl Nine Homolog 1 (EGLN1) Antibody |
|
20-abx176228 |
Abbexa |
|
|
|
|
Egl Nine Homolog 1 (EGLN1) Antibody |
|
20-abx213651 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Egl Nine Homolog 1 (EGLN1) Antibody |
|
20-abx112250 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Egl Nine Homolog 1 (EGLN1) Antibody |
|
20-abx137353 |
Abbexa |
-
EUR 704.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Egl Nine Homolog 1 (EGLN1) Antibody |
|
20-abx141591 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 300.00
|
|
- Shipped within 5-10 working days.
|
Egl Nine Homolog 1 (EGLN1) Antibody |
|
20-abx172198 |
Abbexa |
|
|
|
|
Egl Nine Homolog 1 (EGLN1) Antibody |
|
abx030444-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Egl Nine Homolog 1 (EGLN1) Antibody |
|
abx030444-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Egl Nine Homolog 1 (EGLN1) Antibody |
|
20-abx241216 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Egl Nine Homolog 1 (EGLN1) Antibody |
|
20-abx320187 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Egl Nine Homolog 1 (EGLN1) Antibody |
|
20-abx320188 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Egl Nine Homolog 1 (EGLN1) Antibody |
|
20-abx322731 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Egl Nine Homolog 1 (EGLN1) Antibody |
|
20-abx321661 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Egl Nine Homolog 1 (EGLN1) Antibody |
|
20-abx001065 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
ELISA Kit) Human Egl Nine Homolog 1 (EGLN1)ELISA Kit |
|
201-12-2501 |
SunredBio |
96 tests |
EUR 440 |
- This Egl Nine Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 ELISA Kit) Human Egl Nine Homolog 1 (EGLN1) ELISA Kit |
|
SEL644Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5189.65 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Egl Nine Homolog 1 (EGLN1) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Egl Nine Homolog 1 (EGLN1) ELISA Kit |
|
SEL644Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 515.03 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Egl Nine Homolog 1 (EGLN1) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Egl Nine Homolog 1 (EGLN1) ELISA Kit |
|
SEL644Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 692.9 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Egl Nine Homolog 1 (EGLN1) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Egl Nine Homolog 1 (EGLN1) ELISA Kit |
|
SEL644Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2818.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Egl Nine Homolog 1 (EGLN1) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Egl Nine Homolog 1 (EGLN1) ELISA Kit |
|
4-SEL644Hu |
Cloud-Clone |
-
EUR 5240.00
-
EUR 2769.00
-
EUR 693.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Egl Nine Homolog 1 elisa. Alternative names of the recognized antigen: ECYT3
- HIFPH2
- PHD2
- C1orf12
- SM20
- ZMYND6
- HIF Prolyl Hydroxylase 2
- Prolyl hydroxylase domain-containing protein 2
- Hypoxia-inducible factor prolyl hydroxylase 2
|
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Egl Nine Homolog 1 (EGLN1) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
 Protein) Human Egl Nine Homolog 1 (EGLN1) Protein |
|
20-abx653239 |
Abbexa |
-
EUR 620.00
-
EUR 272.00
-
EUR 1859.00
-
EUR 732.00
-
EUR 453.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
ELISA Kit) Rat Egl Nine Homolog 1(EGLN1)ELISA Kit |
|
GA-E0941RT-48T |
GenAsia Biotech |
48T |
EUR 317 |
Rat Egl Nine Homolog 1(EGLN1)ELISA Kit |
|
GA-E0941RT-96T |
GenAsia Biotech |
96T |
EUR 496 |
Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit |
|
SEL644Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5333.64 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Egl Nine Homolog 1 (EGLN1) in Tissue homogenates, cell lysates and other biological fluids. |
Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit |
|
SEL644Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 526.89 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Egl Nine Homolog 1 (EGLN1) in Tissue homogenates, cell lysates and other biological fluids. |
Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit |
|
SEL644Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 709.84 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Egl Nine Homolog 1 (EGLN1) in Tissue homogenates, cell lysates and other biological fluids. |
Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit |
|
SEL644Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2894.28 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Egl Nine Homolog 1 (EGLN1) in Tissue homogenates, cell lysates and other biological fluids. |
Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit |
|
4-SEL644Mu |
Cloud-Clone |
-
EUR 5384.00
-
EUR 2845.00
-
EUR 710.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Egl Nine Homolog 1 elisa. Alternative names of the recognized antigen: ECYT3
- HIFPH2
- PHD2
- C1orf12
- SM20
- ZMYND6
- HIF Prolyl Hydroxylase 2
- Prolyl hydroxylase domain-containing protein 2
- Hypoxia-inducible factor prolyl hydroxylase 2
|
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Egl Nine Homolog 1 (EGLN1) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
 CLIA Kit) Human Egl Nine Homolog 1 (EGLN1) CLIA Kit |
|
20-abx495954 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
|
) ELISA kit for Human EGLN1 (Egl Nine Homolog 1) |
|
ELK7299 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Egl Nine Homolog 1 (EGLN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Egl Nin
- Show more
|
|
Description: A sandwich ELISA kit for detection of Egl Nine Homolog 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
) ELISA kit for Human Egl nine homolog 1 (EGLN1) |
|
KTE61942-48T |
Abbkine |
48T |
EUR 354 |
- EGLN1 catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular ox
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human Egl nine homolog 1 (EGLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Egl nine homolog 1 (EGLN1) |
|
KTE61942-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- EGLN1 catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular ox
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human Egl nine homolog 1 (EGLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Egl nine homolog 1 (EGLN1) |
|
KTE61942-96T |
Abbkine |
96T |
EUR 572 |
- EGLN1 catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular ox
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human Egl nine homolog 1 (EGLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
 Protein) Mouse Egl Nine Homolog 1 (EGLN1) Protein |
|
20-abx653237 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Mouse Egl Nine Homolog 1 (EGLN1) Protein |
|
20-abx653238 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
 polyclonal antibody) Egl nine homolog 1 (EGLN1) polyclonal antibody |
|
ABP-PAB-11633 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Miscellaneous
- Brand:
|
 CLIA Kit) Mouse Egl Nine Homolog 1 (EGLN1) CLIA Kit |
|
20-abx495955 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
|
) ELISA kit for Mouse EGLN1 (Egl Nine Homolog 1) |
|
ELK7994 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Egl Nine Homolog 1 (EGLN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Egl Nin
- Show more
|
|
Description: A sandwich ELISA kit for detection of Egl Nine Homolog 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
) ELISA kit for Mouse Egl nine homolog 1 (EGLN1) |
|
KTE71217-48T |
Abbkine |
48T |
EUR 332 |
- EGLN1 catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular ox
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Mouse Egl nine homolog 1 (EGLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Egl nine homolog 1 (EGLN1) |
|
KTE71217-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- EGLN1 catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular ox
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Mouse Egl nine homolog 1 (EGLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Egl nine homolog 1 (EGLN1) |
|
KTE71217-96T |
Abbkine |
96T |
EUR 539 |
- EGLN1 catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular ox
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Mouse Egl nine homolog 1 (EGLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
 ELISA Kit) Human Egl Nine-Like Protein 1 (EGLN1) ELISA Kit |
|
20-abx151386 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
 ELISA Kit) Mouse Egl Nine-Like Protein 1 (EGLN1) ELISA Kit |
|
20-abx153943 |
Abbexa |
-
EUR 7504.00
-
EUR 3996.00
-
EUR 926.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
 Egl nine homolog 2 Antibody |
|
20-abx109745 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Egl nine homolog 3 Antibody |
|
20-abx109746 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Egl Nine Homolog 3 Protein |
|
20-abx263290 |
Abbexa |
-
EUR 1609.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
) Human Egl nine homolog 2 (EGLN2) |
|
1-CSB-EP007482HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 18.1 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
|
Description: Recombinant Human Egl nine homolog 2(EGLN2),partial expressed in E.coli |
 ELISA Kit) Human Egl Nine Homolog 2 (EGLN2) ELISA Kit |
|
abx259775-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
) Egl nine homolog 2 Antibody (Biotin) |
|
20-abx105369 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
) Egl nine homolog 3 Antibody (Biotin) |
|
20-abx105370 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
) Egl nine homolog 2 Antibody (FITC) |
|
20-abx106788 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
) Egl nine homolog 3 Antibody (FITC) |
|
20-abx106789 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
) Egl nine homolog 2 Antibody (HRP) |
|
20-abx108207 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
) Egl nine homolog 3 Antibody (HRP) |
|
20-abx108208 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
) Mouse Egl nine homolog 3 protein (Egln3) |
|
1-CSB-RP147974m |
Cusabio |
-
EUR 505.00
-
EUR 265.00
-
EUR 1827.00
-
EUR 766.00
-
EUR 1218.00
-
EUR 335.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 31.2 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
|
Description: Recombinant Mouse Egl nine homolog 3 protein(Egln3) expressed in E.coli |
 Antibody) Egl Nine Homolog 2 (C. Elegans) Antibody |
|
20-abx112251 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Antibody) Egl Nine Homolog 3 (C. Elegans) Antibody |
|
20-abx112252 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 polyclonal antibody) Egl nine homolog 2 (EGLN2) polyclonal antibody |
|
ABP-PAB-11634 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Miscellaneous
- Brand:
|
 polyclonal antibody) Egl nine homolog 3 (EGLN3) polyclonal antibody |
|
ABP-PAB-11635 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Miscellaneous
- Brand:
|
 EGLN3 Egl Nine Homolog 3 Human Recombinant Protein |
|
PROTQ9H6Z9 |
BosterBio |
Regular: 10ug |
EUR 317 |
|
Description: EGLN3 Human Recombinant produced in E. coli is a single polypeptide chain containing 263 amino acids (1-239) and having a molecular mass of 29.8 kDa.;EGLN3 is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
 Recombinant Human Egl nine homolog 2 Protein, His, E.coli-100ug |
|
QP5968-ec-100ug |
EnQuireBio |
100ug |
EUR 408 |
 Recombinant Human Egl nine homolog 2 Protein, His, E.coli-10ug |
|
QP5968-ec-10ug |
EnQuireBio |
10ug |
EUR 200 |
 Recombinant Human Egl nine homolog 2 Protein, His, E.coli-1mg |
|
QP5968-ec-1mg |
EnQuireBio |
1mg |
EUR 1632 |
 Recombinant Human Egl nine homolog 2 Protein, His, E.coli-200ug |
|
QP5968-ec-200ug |
EnQuireBio |
200ug |
EUR 634 |
 Recombinant Human Egl nine homolog 2 Protein, His, E.coli-500ug |
|
QP5968-ec-500ug |
EnQuireBio |
500ug |
EUR 1060 |
 Recombinant Human Egl nine homolog 2 Protein, His, E.coli-50ug |
|
QP5968-ec-50ug |
EnQuireBio |
50ug |
EUR 263 |
 Recombinant Mouse Egl nine homolog 3 Protein, His, E.coli-100ug |
|
QP8813-ec-100ug |
EnQuireBio |
100ug |
EUR 571 |
 Recombinant Mouse Egl nine homolog 3 Protein, His, E.coli-10ug |
|
QP8813-ec-10ug |
EnQuireBio |
10ug |
EUR 272 |
 Recombinant Mouse Egl nine homolog 3 Protein, His, E.coli-1mg |
|
QP8813-ec-1mg |
EnQuireBio |
1mg |
EUR 2303 |
 Recombinant Mouse Egl nine homolog 3 Protein, His, E.coli-200ug |
|
QP8813-ec-200ug |
EnQuireBio |
200ug |
EUR 898 |
 Recombinant Mouse Egl nine homolog 3 Protein, His, E.coli-500ug |
|
QP8813-ec-500ug |
EnQuireBio |
500ug |
EUR 1514 |
 Recombinant Mouse Egl nine homolog 3 Protein, His, E.coli-50ug |
|
QP8813-ec-50ug |
EnQuireBio |
50ug |
EUR 362 |
 Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
|
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
 (OKCD02054)) EGLN1 ELISA Kit (Human) (OKCD02054) |
|
OKCD02054 |
Aviva Systems Biology |
96 Wells |
EUR 909 |
|
Description: Description of target: Cellular oxygen sensor that catalyzes, under normoxic conditions, the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. Hydroxylates a specific proline found in each of the oxygen-dependent degradation (ODD) domains (N-terminal, NODD, and C-terminal, CODD) of HIF1A. Also hydroxylates HIF2A. Has a preference for the CODD site for both HIF1A and HIF1B. Hydroxylated HIFs are then targeted for proteasomal degradation via the von Hippel-Lindau ubiquitination complex. Under hypoxic conditions, the hydroxylation reaction is attenuated allowing HIFs to escape degradation resulting in their translocation to the nucleus, heterodimerization with HIF1B, and increased expression of hypoxy-inducible genes. EGLN1 is the most important isozyme under normoxia and, through regulating the stability of HIF1, involved in various hypoxia-influenced processes such as angiogenesis in retinal and cardiac functionality. Target proteins are preferentially recognized via a LXXLAP motif.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 12.2 pg/mL |
 (OKCA02095)) EGLN1 ELISA Kit (Human) (OKCA02095) |
|
OKCA02095 |
Aviva Systems Biology |
96 Wells |
EUR 917 |
|
Description: Description of target: Cellular oxygen sensor that catalyzes, under normoxic conditions, the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. Hydroxylates a specific proline found in each of the oxygen-dependent degradation (ODD) domains (N-terminal, NODD, and C-terminal, CODD) of HIF1A. Also hydroxylates HIF2A. Has a preference for the CODD site for both HIF1A and HIF1B. Hydroxylated HIFs are then targeted for proteasomal degradation via the von Hippel-Lindau ubiquitination complex. Under hypoxic conditions, the hydroxylation reaction is attenuated allowing HIFs to escape degradation resulting in their translocation to the nucleus, heterodimerization with HIF1B, and increased expression of hypoxy-inducible genes. EGLN1 is the most important isozyme under normoxia and, through regulating the stability of HIF1, involved in various hypoxia-influenced processes such as angiogenesis in retinal and cardiac functionality. Target proteins are preferentially recognized via a LXXLAP motif.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.8 pg/mL |
 (OKCD02055)) Egln1 ELISA Kit (Mouse) (OKCD02055) |
|
OKCD02055 |
Aviva Systems Biology |
96 Wells |
EUR 936 |
|
Description: Description of target: Cellular oxygen sensor that catalyzes, under normoxic conditions, the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. Hydroxylates a specific proline found in each of the oxygen-dependent degradation (ODD) domains (N-terminal, NODD, and C-terminal, CODD) of HIF1A. Also hydroxylates HIF2A. Has a preference for the CODD site for both HIF1A and HIF1B. Hydroxylated HIFs are then targeted for proteasomal degradation via the von Hippel-Lindau ubiquitination complex. Under hypoxic conditions, the hydroxylation reaction is attenuated allowing HIFs to escape degradation resulting in their translocation to the nucleus, heterodimerization with HIF1B, and increased expression of hypoxy-inducible genes. EGLN1 is the most important isozyme under normoxia and, through regulating the stability of HIF1, involved in various hypoxia-influenced processes such as angiogenesis in retinal and cardiac functionality. Target proteins are preferentially recognized via a LXXLAP motif.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.116 ng/mL |
 EGLN1 antibody |
|
70R-17019 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal EGLN1 antibody |
 EGLN1 Antibody |
|
32185-100ul |
SAB |
100ul |
EUR 252 |
EGLN1 antibody |
|
10R-1165 |
Fitzgerald |
100 ul |
EUR 316 |
|
Description: Mouse monoclonal EGLN1 antibody |
EGLN1 Antibody |
|
42722-100ul |
SAB |
100ul |
EUR 252 |
EGLN1 Antibody |
|
1-CSB-PA958222 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against EGLN1. Recognizes EGLN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:10-1:50 |
EGLN1 Antibody |
|
1-CSB-PA863932ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against EGLN1. Recognizes EGLN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
EGLN1 Antibody |
|
1-CSB-PA863932ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against EGLN1. Recognizes EGLN1 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200 |
EGLN1 Antibody |
|
DF6285 |
Affbiotech |
200ul |
EUR 304 |
|
Description: EGLN1 Antibody detects endogenous levels of total EGLN1. |
EGLN1 Antibody |
|
1-CSB-PA519093 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against EGLN1. Recognizes EGLN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
EGLN1 Antibody |
|
1-CSB-PA007481GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
|
Description: A polyclonal antibody against EGLN1. Recognizes EGLN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF |
 EGLN1 siRNA |
|
20-abx915075 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EGLN1 siRNA |
|
20-abx915076 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 with goat anti-rabbit HRP secondary antibody) ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody |
|
EXOAB-KIT-1 |
SBI |
25 ul each |
EUR 627 |
|
|
) mRNAExpress mRNA Synthesis kit (5 reactions) |
|
MR-KIT-1 |
SBI |
5 reactions |
EUR 1152 |
- Category: Stem Cell Products
|
) PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
|
PIN320A-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
) PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
|
PIN340iPS-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
 Human EGLN1 shRNA Plasmid |
|
20-abx960144 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) EGLN1 Recombinant Protein (Human) |
|
RP010303 |
ABM |
100 ug |
Ask for price |
 (Target 1)) EGLN1 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0662402 |
ABM |
1.0 ug DNA |
EUR 154 |
 EGLN1 Blocking Peptide |
|
DF6285-BP |
Affbiotech |
1mg |
EUR 195 |
 EGLN1 Polyclonal Antibody |
|
A-2702 |
EpiGentek |
100 µl |
EUR 483.55 |
|
Description: fast delivery possible |
 EGLN1 / EGLN2 Antibody |
|
20-abx125802 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
 EGLN1 Conjugated Antibody |
|
C32185 |
SAB |
100ul |
EUR 397 |
 Polyclonal EGLN1 Antibody |
|
APR07662G |
Leading Biology |
0.1mg |
EUR 528 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EGLN1 . This antibody is tested and proven to work in the following applications: |
 EGLN1 cloning plasmid |
|
CSB-CL863932HU-10ug |
Cusabio |
10ug |
EUR 217 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 387
- Sequence: atggttgcttgttatccgggcaatggaacgggttatgtacgtcatgttgataatccaaatggagatggaagatgtgtgacatgtatatattatcttaataaagactgggatgccaaggtaagtggaggtatacttcgaatttttccagaaggcaaagcccagtttgctgacattga
- Show more
|
|
Description: A cloning plasmid for the EGLN1 gene. |
 EGLN1 Rabbit pAb |
|
A2314-100ul |
Abclonal |
100 ul |
EUR 308 |
EGLN1 Rabbit pAb |
|
A2314-200ul |
Abclonal |
200 ul |
EUR 459 |
EGLN1 Rabbit pAb |
|
A2314-20ul |
Abclonal |
20 ul |
EUR 183 |
EGLN1 Rabbit pAb |
|
A2314-50ul |
Abclonal |
50 ul |
EUR 223 |
 anti- EGLN1 antibody |
|
FNab10184 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: IHC: 1:50-1:500
- Immunogen: Egl nine homolog 1
- Uniprot ID: Q9GZT9
- Gene ID: 54583
|
|
Description: Antibody raised against EGLN1 |
 Anti-EGLN1 antibody |
|
STJ116175 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: The protein encoded by this gene catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular oxygen sensor, and under normal oxygen concentration, modification by prolyl hydroxylation is a key regulatory event that targets HIF subunits for proteasomal destruction via the von Hippel-Lindau ubiquitylation complex. Mutations in this gene are associated with erythrocytosis familial type 3 (ECYT3). |
Anti-EGLN1 antibody |
|
STJ116768 |
St John's Laboratory |
100 µl |
EUR 413 |
|
Description: The protein encoded by this gene catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular oxygen sensor, and under normal oxygen concentration, modification by prolyl hydroxylation is a key regulatory event that targets HIF subunits for proteasomal destruction via the von Hippel-Lindau ubiquitylation complex. Mutations in this gene are associated with erythrocytosis familial type 3 (ECYT3). |
Anti-EGLN1 antibody |
|
STJ23492 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: The protein encoded by this gene catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular oxygen sensor, and under normal oxygen concentration, modification by prolyl hydroxylation is a key regulatory event that targets HIF subunits for proteasomal destruction via the von Hippel-Lindau ubiquitylation complex. Mutations in this gene are associated with erythrocytosis familial type 3 (ECYT3). |
) PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
|
PIN300A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
) T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
|
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
|
 Anti-CELSR3/Flamingo Homolog 1 Antibody |
|
A07204-1 |
BosterBio |
100ul |
EUR 397 |
|
Description: Rabbit Polyclonal CELSR3/Flamingo Homolog 1 Antibody. Validated in IF and tested in Human, Mouse, Rat. |
) PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
|
PIN400A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
 Human Notch Homolog 1 ELISA kit |
|
E01N0594-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Notch Homolog 1 ELISA kit |
|
E01N0594-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Notch Homolog 1 ELISA kit |
|
E01N0594-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
) PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
|
PIN410A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
) PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
|
PIN412A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
 (pORF)) EGLN1 ORF Vector (Human) (pORF) |
|
ORF003435 |
ABM |
1.0 ug DNA |
EUR 95 |
 AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS |
|
AP-STR-KIT-1 |
CORNING |
1/pk |
EUR 355 |
|
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller |
 Frit Kit |
|
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
|
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
 Column Packing Kit |
|
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
|
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
 Human Hexokinase-1 AssayMax ELISA Kit |
|
EH3101-1 |
AssayPro |
96 Well Plate |
EUR 477 |
 Human Complexin-1 AssayMax ELISA Kit |
|
EC3505-1 |
AssayPro |
96 Well Plate |
EUR 417 |
 Human Glutaredoxin-1 AssayMax ELISA Kit |
|
EG2153-1 |
AssayPro |
96 Well Plate |
EUR 417 |
ELISA Kit) Human Frizzled Homolog 1 (FZD1)ELISA Kit |
|
201-12-2369 |
SunredBio |
96 tests |
EUR 440 |
- This Frizzled Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
ELISA Kit) Human Slit Homolog 1 (Slit1)ELISA Kit |
|
201-12-2565 |
SunredBio |
96 tests |
EUR 440 |
- This Slit Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
ELISA Kit) Human Diaphanous Homolog 1 (DIAPH1)ELISA Kit |
|
201-12-2655 |
SunredBio |
96 tests |
EUR 440 |
- This Diaphanous Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
ELISA Kit) Human Disabled Homolog 1 (DAB1)ELISA Kit |
|
201-12-2657 |
SunredBio |
96 tests |
EUR 440 |
- This Disabled Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
ELISA Kit) Human Atonal Homolog 1 (ATOH1)ELISA Kit |
|
201-12-2838 |
SunredBio |
96 tests |
EUR 440 |
- This Atonal Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
ELISA Kit) Human Chromobox Homolog 1 (CBX1)ELISA Kit |
|
201-12-2894 |
SunredBio |
96 tests |
EUR 440 |
- This Chromobox Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 ELISA Kit) Human Disabled Homolog 1 (DAB1) ELISA Kit |
|
DLR-DAB1-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Disabled Homolog 1 (DAB1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Disabled Homolog 1 (DAB1) in samples from tissue homogenates or other biological fluids. |
Human Disabled Homolog 1 (DAB1) ELISA Kit |
|
DLR-DAB1-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Disabled Homolog 1 (DAB1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Disabled Homolog 1 (DAB1) in samples from tissue homogenates or other biological fluids. |
 ELISA Kit) Human Slit Homolog 1 (Slit1) ELISA Kit |
|
DLR-Slit1-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Slit Homolog 1 (Slit1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Slit Homolog 1 (Slit1) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Slit Homolog 1 (Slit1) ELISA Kit |
|
DLR-Slit1-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Slit Homolog 1 (Slit1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Slit Homolog 1 (Slit1) in samples from serum, plasma, tissue homogenates or other biological fluids. |
ELISA Kit)
ELISA Kit)
