Mouse PCYOX1(Prenylcysteine Oxidase 1) ELISA Kit

Mouse PCYOX1(Prenylcysteine Oxidase 1) ELISA Kit

To Order Contact us:

Mouse Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit
RD-PCYOX1-Mu-48Tests 48 Tests
EUR 533
Mouse Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit
RD-PCYOX1-Mu-96Tests 96 Tests
EUR 740
Mouse Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit
RDR-PCYOX1-Mu-48Tests 48 Tests
EUR 557
Mouse Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit
RDR-PCYOX1-Mu-96Tests 96 Tests
EUR 774
Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit
EUR 517
  • Should the Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Prenylcysteine Oxidase 1 (PCYOX1) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit
EUR 673
  • Should the Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Prenylcysteine Oxidase 1 (PCYOX1) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit
RD-PCYOX1-Hu-48Tests 48 Tests
EUR 521
Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit
RD-PCYOX1-Hu-96Tests 96 Tests
EUR 723
Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit
RDR-PCYOX1-Hu-48Tests 48 Tests
EUR 544
Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit
RDR-PCYOX1-Hu-96Tests 96 Tests
EUR 756
Mouse Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Mouse Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit
SEH428Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Prenylcysteine Oxidase 1 (PCYOX1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Prenylcysteine Oxidase 1 (PCYOX1) in Tissue homogenates, cell lysates and other biological fluids.
Mouse Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit
SEH428Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Prenylcysteine Oxidase 1 (PCYOX1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Prenylcysteine Oxidase 1 (PCYOX1) in Tissue homogenates, cell lysates and other biological fluids.
Mouse Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit
SEH428Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Prenylcysteine Oxidase 1 (PCYOX1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Prenylcysteine Oxidase 1 (PCYOX1) in Tissue homogenates, cell lysates and other biological fluids.
Mouse Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit
SEH428Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Prenylcysteine Oxidase 1 (PCYOX1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Prenylcysteine Oxidase 1 (PCYOX1) in Tissue homogenates, cell lysates and other biological fluids.
Mouse Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Prenylcysteine Oxidase 1 elisa. Alternative names of the recognized antigen: PCL1
  • Prenylcysteine lyase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Prenylcysteine Oxidase 1 (PCYOX1) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Mouse Prenylcysteine oxidase, Pcyox1 ELISA KIT
ELI-12394m 96 Tests
EUR 865
Prenylcysteine Oxidase 1 (PCYOX1) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Prenylcysteine Oxidase 1 (PCYOX1) Antibody
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Prenylcysteine Oxidase 1 (PCYOX1) Antibody
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Prenylcysteine Oxidase 1 (PCYOX1) Antibody
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Prenylcysteine Oxidase 1 (PCYOX1) Antibody
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.
Prenylcysteine Oxidase 1 (PCYOX1) Antibody
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Prenylcysteine Oxidase 1 (PCYOX1) Antibody
abx340058-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Prenylcysteine Oxidase 1 (PCYOX1) Antibody
abx236231-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Recombinant Prenylcysteine Oxidase 1 (PCYOX1)
  • EUR 453.02
  • EUR 224.00
  • EUR 1423.84
  • EUR 541.28
  • EUR 982.56
  • EUR 366.00
  • EUR 3409.60
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9UHG3
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 67.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Prenylcysteine Oxidase 1 expressed in: E.coli
Recombinant Prenylcysteine Oxidase 1 (PCYOX1)
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9CQF9
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 32.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Prenylcysteine Oxidase 1 expressed in: E.coli
Mouse Prenylcysteine Oxidase 1 (PCYOX1) Protein
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Mouse Prenylcysteine Oxidase 1 (PCYOX1) CLIA Kit
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Human Prenylcysteine oxidase 1, PCYOX1 ELISA KIT
ELI-45170h 96 Tests
EUR 824
Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Prenylcysteine oxidase 1(PCYOX1) ELISA kit
CSB-EL017652HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Prenylcysteine oxidase 1 (PCYOX1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Prenylcysteine oxidase 1(PCYOX1) ELISA kit
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Prenylcysteine oxidase 1(PCYOX1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit
SEH428Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prenylcysteine Oxidase 1 (PCYOX1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prenylcysteine Oxidase 1 (PCYOX1) in Tissue homogenates, cell lysates and other biological fluids.
Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit
SEH428Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prenylcysteine Oxidase 1 (PCYOX1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prenylcysteine Oxidase 1 (PCYOX1) in Tissue homogenates, cell lysates and other biological fluids.
Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit
SEH428Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prenylcysteine Oxidase 1 (PCYOX1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prenylcysteine Oxidase 1 (PCYOX1) in Tissue homogenates, cell lysates and other biological fluids.
Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit
SEH428Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prenylcysteine Oxidase 1 (PCYOX1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prenylcysteine Oxidase 1 (PCYOX1) in Tissue homogenates, cell lysates and other biological fluids.
Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Prenylcysteine Oxidase 1 elisa. Alternative names of the recognized antigen: PCL1
  • Prenylcysteine lyase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Prenylcysteine Oxidase 1 (PCYOX1) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
ELISA kit for Mouse PCYOX1 (Prenylcysteine Oxidase 1)
ELK6955 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Prenylcysteine Oxidase 1 (PCYOX1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
  • Show more
Description: A sandwich ELISA kit for detection of Prenylcysteine Oxidase 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Mouse Prenylcysteine oxidase 1 (PCYOX1)
KTE70784-48T 48T
EUR 332
  • Prenylcysteine is released during the degradation of prenylated proteins. PCYOX1 catalyzes the degradation of prenylcysteine to yield free cysteines and a hydrophobic isoprenoid product . The deduced 505-amino acid protein contains a predicted signal
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Prenylcysteine oxidase 1 (PCYOX1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Prenylcysteine oxidase 1 (PCYOX1)
KTE70784-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Prenylcysteine is released during the degradation of prenylated proteins. PCYOX1 catalyzes the degradation of prenylcysteine to yield free cysteines and a hydrophobic isoprenoid product . The deduced 505-amino acid protein contains a predicted signal
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Prenylcysteine oxidase 1 (PCYOX1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Prenylcysteine oxidase 1 (PCYOX1)
KTE70784-96T 96T
EUR 539
  • Prenylcysteine is released during the degradation of prenylated proteins. PCYOX1 catalyzes the degradation of prenylcysteine to yield free cysteines and a hydrophobic isoprenoid product . The deduced 505-amino acid protein contains a predicted signal
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Prenylcysteine oxidase 1 (PCYOX1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Mouse)
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCYOX1 (Ala249~Leu505)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prenylcysteine Oxidase 1 (PCYOX1)
Human Prenylcysteine Oxidase 1 (PCYOX1) Protein
  • EUR 634.00
  • EUR 272.00
  • EUR 1929.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Human Prenylcysteine Oxidase 1 (PCYOX1) CLIA Kit
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
ELISA kit for Human PCYOX1 (Prenylcysteine Oxidase 1)
ELK4169 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Prenylcysteine Oxidase 1 (PCYOX1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
  • Show more
Description: A sandwich ELISA kit for detection of Prenylcysteine Oxidase 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Human Prenylcysteine oxidase 1 (PCYOX1)
KTE61281-48T 48T
EUR 332
  • Prenylcysteine is released during the degradation of prenylated proteins. PCYOX1 catalyzes the degradation of prenylcysteine to yield free cysteines and a hydrophobic isoprenoid product . The deduced 505-amino acid protein contains a predicted signal
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Prenylcysteine oxidase 1 (PCYOX1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Prenylcysteine oxidase 1 (PCYOX1)
KTE61281-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Prenylcysteine is released during the degradation of prenylated proteins. PCYOX1 catalyzes the degradation of prenylcysteine to yield free cysteines and a hydrophobic isoprenoid product . The deduced 505-amino acid protein contains a predicted signal
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Prenylcysteine oxidase 1 (PCYOX1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Prenylcysteine oxidase 1 (PCYOX1)
KTE61281-96T 96T
EUR 539
  • Prenylcysteine is released during the degradation of prenylated proteins. PCYOX1 catalyzes the degradation of prenylcysteine to yield free cysteines and a hydrophobic isoprenoid product . The deduced 505-amino acid protein contains a predicted signal
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Prenylcysteine oxidase 1 (PCYOX1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Human, Mouse)
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCYOX1 (Tyr174~Leu505)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Prenylcysteine Oxidase 1 (PCYOX1)
Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Mouse), APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCYOX1 (Ala249~Leu505)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with APC.
Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Mouse), Biotinylated
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCYOX1 (Ala249~Leu505)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with Biotin.
Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Mouse), Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCYOX1 (Ala249~Leu505)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with Cy3.
Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Mouse), FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCYOX1 (Ala249~Leu505)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with FITC.
Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Mouse), HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCYOX1 (Ala249~Leu505)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with HRP.
Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Mouse), PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCYOX1 (Ala249~Leu505)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with PE.
Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Human, Mouse), APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCYOX1 (Tyr174~Leu505)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with APC.
Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Human, Mouse), Biotinylated
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCYOX1 (Tyr174~Leu505)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with Biotin.
Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Human, Mouse), Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCYOX1 (Tyr174~Leu505)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with Cy3.
Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Human, Mouse), FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCYOX1 (Tyr174~Leu505)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with FITC.
Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Human, Mouse), HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCYOX1 (Tyr174~Leu505)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with HRP.
Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Human, Mouse), PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCYOX1 (Tyr174~Leu505)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with PE.
Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Mouse), APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCYOX1 (Ala249~Leu505)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with APC-Cy7.
Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Human, Mouse), APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCYOX1 (Tyr174~Leu505)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with APC-Cy7.
Mouse Prenylcysteine oxidase- like, Pcyox1l ELISA KIT
ELI-45171m 96 Tests
EUR 865
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
EUR 202
Bovine Prenylcysteine oxidase- like, PCYOX1L ELISA KIT
ELI-43159b 96 Tests
EUR 928
Human Prenylcysteine oxidase- like, PCYOX1L ELISA KIT
ELI-43160h 96 Tests
EUR 824
Prenylcysteine Oxidase-Like (PCYXL) Antibody
abx032568-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Prenylcysteine Oxidase-Like (PCYXL) Antibody
abx032568-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Pcyox1/ Rat Pcyox1 ELISA Kit
ELI-14590r 96 Tests
EUR 886
PCYOX1 ELISA Kit (Mouse) (OKCD09052)
OKCD09052 96 Wells
EUR 1001
Description: Description of target: Involved in the degradation of prenylated proteins. cleaves the thioether bond of prenyl-l-cysteines, such as farnesylcysteine and geranylgeranylcysteine (by similarity).;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.072ng/mL
PCYOX1 ELISA Kit (Mouse) (OKDD00815)
OKDD00815 96 Wells
EUR 988
Description: Description of target: Involved in the degradation of prenylated proteins. cleaves the thioether bond of prenyl-l-cysteines, such as farnesylcysteine and geranylgeranylcysteine (by similarity).;Species reactivity: Mouse;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.072ng/mL
EF001621 96 Tests
EUR 689
PCYOX1 ELISA Kit (Human) (OKCD01032)
OKCD01032 96 Wells
EUR 831
Description: Description of target: Involved in the degradation of prenylated proteins. Cleaves the thioether bond of prenyl-L-cysteines, such as farnesylcysteine and geranylgeranylcysteine. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.118 ng/mL
Mouse PCYOX1 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
PCYOX1 Recombinant Protein (Mouse)
RP160775 100 ug Ask for price
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PCYOX1 Antibody
ABD8332 100 ug
EUR 438
PCYOX1 Antibody
45274-100ul 100ul
EUR 252
PCYOX1 Antibody
45274-50ul 50ul
EUR 187
PCYOX1 antibody
70R-19165 50 ul
EUR 435
Description: Rabbit polyclonal PCYOX1 antibody
PCYOX1 Antibody
DF8332 200ul
EUR 304
Description: PCYOX1 Antibody detects endogenous levels of total PCYOX1.
PCYOX1 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PCYOX1. Recognizes PCYOX1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
YF-PA26185 50 ul
EUR 334
Description: Mouse polyclonal to PCYOX1
mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products
Pcyox1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3674502 1.0 ug DNA
EUR 154
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools
Mouse Aldehyde Oxidase 1 (AOX1) ELISA Kit
abx520547-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Mouse NADPH oxidase 1 (NOX1) ELISA Kit
abx520821-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Mouse Sulfhydryl Oxidase 1 (QSOX1) ELISA Kit
abx576447-96tests 96 tests
EUR 668
  • Shipped within 1-2 months.
Mouse Dual oxidase 1(DUOX1) ELISA kit
E03D0296-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Dual oxidase 1(DUOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Dual oxidase 1(DUOX1) ELISA kit
E03D0296-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Dual oxidase 1(DUOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Dual oxidase 1(DUOX1) ELISA kit
E03D0296-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Dual oxidase 1(DUOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Quiescin Sulfhydryl Oxidase 1 ELISA kit
E03Q0001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Quiescin Sulfhydryl Oxidase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Quiescin Sulfhydryl Oxidase 1 ELISA kit
E03Q0001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Quiescin Sulfhydryl Oxidase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Quiescin Sulfhydryl Oxidase 1 ELISA kit
E03Q0001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Quiescin Sulfhydryl Oxidase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Sulfhydryl oxidase 1(QSOX1) ELISA kit
E03S0347-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Sulfhydryl oxidase 1(QSOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Sulfhydryl oxidase 1(QSOX1) ELISA kit
E03S0347-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Sulfhydryl oxidase 1(QSOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Sulfhydryl oxidase 1(QSOX1) ELISA kit
E03S0347-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Sulfhydryl oxidase 1(QSOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
ELISA kit for Mouse NADPH oxidase 1
EK4834 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse NADPH oxidase 1 in samples from serum, plasma, tissue homogenates and other biological fluids.
Mouse Nox1/ NADPH oxidase 1 ELISA Kit
E1043Mo 1 Kit
EUR 632
Mouse NADPH oxidase 1, Nox1 ELISA KIT
ELI-07626m 96 Tests
EUR 865
Mouse Hydroxyacid oxidase 1, Hao1 ELISA KIT
ELI-08008m 96 Tests
EUR 865
Mouse Sulfhydryl oxidase 1, Qsox1 ELISA KIT
ELI-43054m 96 Tests
EUR 865
Mouse Nox1(NADPH oxidase 1) ELISA Kit
EM0800 96T
EUR 567.6
  • Detection range: 15.6-1000 pg/ml
  • Uniprot ID: Q8CIZ9
  • Alias: Nox1/NOH-1/Mitogenic oxidase 1(MOX-1)/NADH/NADPH mitogenic oxidase subunit P65-MOX/Nicotinamide Adenine Dinucleotide Phosphate Oxidase 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 9.375pg/ml
Mouse NADPH Oxidase 1 (NOX1) ELISA Kit
abx255148-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.
Mouse Hydroxyacid oxidase 1(HAO1) ELISA kit
CSB-EL010127MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Hydroxyacid oxidase 1 (HAO1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Mouse Hydroxyacid oxidase 1(HAO1) ELISA kit
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Hydroxyacid oxidase 1(HAO1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Mouse Aox1/ Aldehyde oxidase 1 ELISA Kit
E0105Mo 1 Kit
EUR 571
Qsox1 ELISA Kit| Mouse Sulfhydryl oxidase 1 ELISA Kit
EF016016 96 Tests
EUR 689
Nox1 ELISA Kit| Mouse NADPH oxidase 1 ELISA Kit
EF013410 96 Tests
EUR 689
Pcyox1 ORF Vector (Mouse) (pORF)
ORF053593 1.0 ug DNA
EUR 506
ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes
Mouse Xanthione oxidase ELISA kit
E03X0001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Xanthione oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Xanthione oxidase ELISA kit
E03X0001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Xanthione oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Xanthione oxidase ELISA kit
E03X0001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Xanthione oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Lysyl oxidase ELISA kit
E03L0305-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Lysyl oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Lysyl oxidase ELISA kit
E03L0305-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Lysyl oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Lysyl oxidase ELISA kit
E03L0305-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Lysyl oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Monoamine Oxidase ELISA kit
E03M0224-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Monoamine Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Monoamine Oxidase ELISA kit
E03M0224-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Monoamine Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Monoamine Oxidase ELISA kit
E03M0224-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Monoamine Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Diamine Oxidase ELISA kit
E03D0032-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Diamine Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Diamine Oxidase ELISA kit
E03D0032-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Diamine Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Diamine Oxidase ELISA kit
E03D0032-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Diamine Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Glucose Oxidase ELISA kit
E03G0341-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Glucose Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Glucose Oxidase ELISA kit
E03G0341-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Glucose Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Glucose Oxidase ELISA kit
E03G0341-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Glucose Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
PCYOX1 Conjugated Antibody
C45274 100ul
EUR 397
PCYOX1 cloning plasmid
CSB-CL017652HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1518
  • Sequence: atggggcgcgtcgtcgcggagcttgtctcctcgctgctggggttgtggctgttgctgtgcagctgcggatgccccgagggcgccgagctgcgtgctccgccagataaaatcgcgattattggagccggaattggtggcacttcagcagcctattacctgcggcagaaatttggga
  • Show more
Description: A cloning plasmid for the PCYOX1 gene.
anti- PCYOX1 antibody
FNab06231 100µg
EUR 505.25
  • Immunogen: prenylcysteine oxidase 1
  • Uniprot ID: Q9UHG3
  • Gene ID: 51449
  • Research Area: Metabolism
Description: Antibody raised against PCYOX1
PCYOX1 Blocking Peptide
DF8332-BP 1mg
EUR 195
Anti-PCYOX1 antibody
PAab06231 100 ug
EUR 355
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9
PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools
Mouse Lysyl Oxidase Like 1 (LOXL1) ELISA Kit
abx575650-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Mouse NADPH oxidase organizer 1, Noxo1 ELISA KIT
ELI-21241m 96 Tests
EUR 865
Mouse NADPH oxidase activator 1, Noxa1 ELISA KIT
ELI-35317m 96 Tests
EUR 865
Mouse NADPH oxidase activator 1 (NOXA1) ELISA Kit
abx389985-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Mouse NADPH oxidase organizer 1 (NOXO1) ELISA Kit
abx389986-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
ELISA kit for Mouse Sulfhydryl oxidase 1 (QSOX1)
KTE70579-48T 48T
EUR 332
  • Sulfhydryl oxidase 1 is a protein that contains domains of thioredoxin and ERV1, members of two long-standing gene families. The gene expression is induced as fibroblasts begin to exit the proliferative cycle and enter quiescence, suggesting that thi
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sulfhydryl oxidase 1 (QSOX1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Sulfhydryl oxidase 1 (QSOX1)
KTE70579-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Sulfhydryl oxidase 1 is a protein that contains domains of thioredoxin and ERV1, members of two long-standing gene families. The gene expression is induced as fibroblasts begin to exit the proliferative cycle and enter quiescence, suggesting that thi
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sulfhydryl oxidase 1 (QSOX1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Sulfhydryl oxidase 1 (QSOX1)
KTE70579-96T 96T
EUR 539
  • Sulfhydryl oxidase 1 is a protein that contains domains of thioredoxin and ERV1, members of two long-standing gene families. The gene expression is induced as fibroblasts begin to exit the proliferative cycle and enter quiescence, suggesting that thi
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sulfhydryl oxidase 1 (QSOX1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Noxa1 ELISA Kit| Mouse NADPH oxidase activator 1 ELISA Kit
EF015624 96 Tests
EUR 689
Noxo1 ELISA Kit| Mouse NADPH oxidase organizer 1 ELISA Kit
EF015625 96 Tests
EUR 689
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools
Pcyox1 sgRNA CRISPR Lentivector set (Mouse)
K3674501 3 x 1.0 ug
EUR 339
AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller
Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
Mouse Spermine oxidase (SMOX) ELISA Kit
abx572544-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Mouse Xanthine dehydrogenase/oxidase ELISA kit
E03X0012-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Xanthine dehydrogenase/oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Xanthine dehydrogenase/oxidase ELISA kit
E03X0012-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Xanthine dehydrogenase/oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Xanthine dehydrogenase/oxidase ELISA kit
E03X0012-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Xanthine dehydrogenase/oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Monoamine oxidase A ELISA kit
E03M0225-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Monoamine oxidase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Monoamine oxidase A ELISA kit
E03M0225-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Monoamine oxidase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Monoamine oxidase A ELISA kit
E03M0225-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Monoamine oxidase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Cytochrome c oxidase ELISA kit
E03C0015-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cytochrome c oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Cytochrome c oxidase ELISA kit
E03C0015-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cytochrome c oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Cytochrome c oxidase ELISA kit
E03C0015-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cytochrome c oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Cytochrome Oxidase 4 ELISA kit
E03C0103-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cytochrome Oxidase 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Cytochrome Oxidase 4 ELISA kit
E03C0103-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cytochrome Oxidase 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Cytochrome Oxidase 4 ELISA kit
E03C0103-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cytochrome Oxidase 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Acetyl CoA oxidase ELISA kit
E03A0641-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Acetyl CoA oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Acetyl CoA oxidase ELISA kit
E03A0641-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Acetyl CoA oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Acetyl CoA oxidase ELISA kit
E03A0641-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Acetyl CoA oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Aldehyde oxidase(AOX1) ELISA kit
E03A1553-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Aldehyde oxidase(AOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Aldehyde oxidase(AOX1) ELISA kit
E03A1553-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Aldehyde oxidase(AOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Aldehyde oxidase(AOX1) ELISA kit
E03A1553-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Aldehyde oxidase(AOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
ELISA kit for Mouse Spermine oxidase
EK4455 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Spermine oxidase in samples from serum, plasma, tissue homogenates and other biological fluids.
Mouse Smox/ Spermine oxidase ELISA Kit
E1382Mo 1 Kit
EUR 571
Mouse Lathosterol oxidase, Sc5dl ELISA KIT
ELI-20154m 96 Tests
EUR 865
Mouse Sulfite Oxidase, SUOX ELISA Kit
ELI-06779m 96 Tests
EUR 865
Mouse Spermine oxidase, Smox ELISA KIT
ELI-07250m 96 Tests
EUR 865
Mouse Aldehyde oxidase, Aox1 ELISA KIT
ELI-07559m 96 Tests
EUR 865
Mouse diamine oxidase(DAO)ELISA Kit    
GA-E0588MS-48T 48T
EUR 336
Mouse diamine oxidase(DAO)ELISA Kit    
GA-E0588MS-96T 96T
EUR 534
Mouse Protoporphyrinogen oxidase, Ppox ELISA KIT
ELI-36548m 96 Tests
EUR 865
Mouse Smox(Spermine oxidase) ELISA Kit
EM0749 96T
EUR 567.6
  • Detection range: 0.312-20 ng/ml
  • Uniprot ID: Q99K82
  • Alias: Smox/SMOX(Spermine oxidase)Polyamine oxidase 1/PAO-1/PAOh1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.188 ng/ml
Mouse DAO(Diamine Oxidase) ELISA Kit
EM0980 96T
EUR 524.1
  • Detection range: 3.906-250 ng/ml
  • Uniprot ID: P18894
  • Alias: DAO/AOC1/DAO/Diamine Oxidase/Histaminase/KAO/ABP/amiloride binding protein 1(amine oxidase(copper-containing))/Amiloride-binding protein/amiloride-sensitive amine oxidase/amiloride-sensitive
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 2.344 ng/ml
Mouse LOX(Lysyl Oxidase) ELISA Kit
EM1614 96T
EUR 567.6
  • Detection range: 0.313-20 ng/ml
  • Alias: Lysyl Oxidase
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.188 ng/ml
Mouse XOD(Xantine oxidase) ELISA Kit
EM1865 96T
EUR 567.6
  • Detection range: 78-5000 pg/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 46.9pg/ml
Mouse Lysyl Oxidase (LOX) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Mouse Polyamine Oxidase (PAOX) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Mouse Spermine Oxidase (SMOX) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Mouse Sulfite Oxidase (SUOX) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Mouse Monoamine Oxidase (MAO) ELISA Kit
abx350797-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.
Mouse Spermine oxidase (SMOX) ELISA Kit
abx255097-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.
Mouse Lysyl Oxidase (LOX) ELISA Kit
abx257820-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.
Mouse Polyamine Oxidase (PAOX) ELISA Kit
EUR 527
  • Should the Mouse Polyamine Oxidase (PAOX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Polyamine Oxidase (PAOX) in samples from serum, plasma, tissue homogenates or other biological fluids.
Mouse Polyamine Oxidase (PAOX) ELISA Kit
EUR 688
  • Should the Mouse Polyamine Oxidase (PAOX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Polyamine Oxidase (PAOX) in samples from serum, plasma, tissue homogenates or other biological fluids.
Mouse Spermine Oxidase (SMOX) ELISA Kit
EUR 527
  • Should the Mouse Spermine Oxidase (SMOX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Spermine Oxidase (SMOX) in samples from tissue homogenates, cell lysates or other biological fluids.
Mouse Spermine Oxidase (SMOX) ELISA Kit
EUR 688
  • Should the Mouse Spermine Oxidase (SMOX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Spermine Oxidase (SMOX) in samples from tissue homogenates, cell lysates or other biological fluids.
Mouse Lysyl Oxidase (LOX) ELISA Kit
DLR-LOX-Mu-48T 48T
EUR 527
  • Should the Mouse Lysyl Oxidase (LOX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Lysyl Oxidase (LOX) in samples from serum, plasma, tissue homogenates or other biological fluids.
Mouse Lysyl Oxidase (LOX) ELISA Kit
DLR-LOX-Mu-96T 96T
EUR 688
  • Should the Mouse Lysyl Oxidase (LOX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Lysyl Oxidase (LOX) in samples from serum, plasma, tissue homogenates or other biological fluids.
Mouse Sulfite Oxidase (SUOX) ELISA Kit
EUR 527
  • Should the Mouse Sulfite Oxidase (SUOX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Sulfite Oxidase (SUOX) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Mouse Sulfite Oxidase (SUOX) ELISA Kit
EUR 688
  • Should the Mouse Sulfite Oxidase (SUOX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Sulfite Oxidase (SUOX) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Mouse diamine oxidase, DAO ELISA Kit
CSB-E10090m-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse diamine oxidase, DAO in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Mouse diamine oxidase, DAO ELISA Kit
  • EUR 946.00
  • EUR 5782.00
  • EUR 3060.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse diamine oxidase, DAO in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Mouse diamine oxidase,DAO ELISA Kit
CN-02511M1 96T
EUR 436
Mouse diamine oxidase,DAO ELISA Kit
CN-02511M2 48T
EUR 287
Mouse Spermine Oxidase (SMOX) ELISA Kit
SEC852Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Spermine Oxidase (SMOX) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Spermine Oxidase (SMOX) in Tissue homogenates, cell lysates and other biological fluids.
Mouse Spermine Oxidase (SMOX) ELISA Kit
SEC852Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Spermine Oxidase (SMOX) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Spermine Oxidase (SMOX) in Tissue homogenates, cell lysates and other biological fluids.
Mouse Spermine Oxidase (SMOX) ELISA Kit
SEC852Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Spermine Oxidase (SMOX) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Spermine Oxidase (SMOX) in Tissue homogenates, cell lysates and other biological fluids.
Mouse Spermine Oxidase (SMOX) ELISA Kit
SEC852Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Spermine Oxidase (SMOX) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Spermine Oxidase (SMOX) in Tissue homogenates, cell lysates and other biological fluids.
Mouse Spermine Oxidase (SMOX) ELISA Kit
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Spermine Oxidase elisa. Alternative names of the recognized antigen: SMO
  • PAO
  • PAOh1
  • C20orf16
  • Polyamine oxidase 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Spermine Oxidase (SMOX) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Mouse Lysyl Oxidase (LOX) ELISA Kit
SEC580Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Lysyl Oxidase (LOX) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Lysyl Oxidase (LOX) in serum, plasma, tissue homogenates and other biological fluids.
Mouse Lysyl Oxidase (LOX) ELISA Kit
SEC580Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Lysyl Oxidase (LOX) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Lysyl Oxidase (LOX) in serum, plasma, tissue homogenates and other biological fluids.
Mouse Lysyl Oxidase (LOX) ELISA Kit
SEC580Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Lysyl Oxidase (LOX) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Lysyl Oxidase (LOX) in serum, plasma, tissue homogenates and other biological fluids.
Mouse Lysyl Oxidase (LOX) ELISA Kit
SEC580Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Lysyl Oxidase (LOX) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Lysyl Oxidase (LOX) in serum, plasma, tissue homogenates and other biological fluids.
Mouse Lysyl Oxidase (LOX) ELISA Kit
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Lysyl Oxidase elisa. Alternative names of the recognized antigen: Protein-Lysine 6-Oxidase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Lysyl Oxidase (LOX) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.
Mouse Diamine Oxidase (DAO) ELISA Kit
SEA656Mu-10x96wellstestplate 10x96-wells test plate
EUR 4391.16
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Diamine Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.
Mouse Diamine Oxidase (DAO) ELISA Kit
SEA656Mu-1x48wellstestplate 1x48-wells test plate
EUR 449.27
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Diamine Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.
Mouse Diamine Oxidase (DAO) ELISA Kit
SEA656Mu-1x96wellstestplate 1x96-wells test plate
EUR 598.96
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Diamine Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.
Mouse Diamine Oxidase (DAO) ELISA Kit
SEA656Mu-5x96wellstestplate 5x96-wells test plate
EUR 2395.32
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Diamine Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.
Mouse Diamine Oxidase (DAO) ELISA Kit
  • EUR 4442.00
  • EUR 2346.00
  • EUR 599.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Diamine Oxidase elisa. Alternative names of the recognized antigen: AOC1
  • ABP1
  • KAO
  • Histaminase
  • Kidney amine oxidase
  • Amiloride Binding Protein 1
  • Amiloride-sensitive amine oxidase
  • Amine oxidase copper domain-containing protein 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Diamine Oxidase (DAO) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.
Mouse Diamine Oxidase ELISA Kit (DAO)
RK02737 96 Tests
EUR 521
Mouse Lysyl Oxidase ELISA Kit (LOX)
RK02992 96 Tests
EUR 521
Mouse Polyamine Oxidase (PAOX) ELISA Kit
RD-PAOX-Mu-48Tests 48 Tests
EUR 533
Mouse Polyamine Oxidase (PAOX) ELISA Kit
RD-PAOX-Mu-96Tests 96 Tests
EUR 740
Mouse Spermine Oxidase (SMOX) ELISA Kit
RD-SMOX-Mu-48Tests 48 Tests
EUR 533
Mouse Spermine Oxidase (SMOX) ELISA Kit
RD-SMOX-Mu-96Tests 96 Tests
EUR 740
Mouse Sulfite Oxidase (SUOX) ELISA Kit
RD-SUOX-Mu-48Tests 48 Tests
EUR 533
Mouse Sulfite Oxidase (SUOX) ELISA Kit
RD-SUOX-Mu-96Tests 96 Tests
EUR 740
Mouse Lysyl Oxidase (LOX) ELISA Kit
RD-LOX-Mu-48Tests 48 Tests
EUR 533
Mouse Lysyl Oxidase (LOX) ELISA Kit
RD-LOX-Mu-96Tests 96 Tests
EUR 740
Mouse Lysyl Oxidase (LOX) ELISA Kit
RDR-LOX-Mu-48Tests 48 Tests
EUR 557
Mouse Lysyl Oxidase (LOX) ELISA Kit
RDR-LOX-Mu-96Tests 96 Tests
EUR 774
Mouse Polyamine Oxidase (PAOX) ELISA Kit
RDR-PAOX-Mu-48Tests 48 Tests
EUR 557
Mouse Polyamine Oxidase (PAOX) ELISA Kit
RDR-PAOX-Mu-96Tests 96 Tests
EUR 774
Mouse Spermine Oxidase (SMOX) ELISA Kit
RDR-SMOX-Mu-48Tests 48 Tests
EUR 557
Mouse Spermine Oxidase (SMOX) ELISA Kit
RDR-SMOX-Mu-96Tests 96 Tests
EUR 774
Mouse Sulfite Oxidase (SUOX) ELISA Kit
RDR-SUOX-Mu-48Tests 48 Tests
EUR 557
Mouse Sulfite Oxidase (SUOX) ELISA Kit
RDR-SUOX-Mu-96Tests 96 Tests
EUR 774
Mouse monoamine oxidase(MAO)ELISA Kit
QY-E21019 96T
EUR 361
Mouse diamine oxidase(DAO)ELISA Kit
QY-E20470 96T
EUR 361
Mouse Polyamine Oxidase (PAOX) ELISA Kit
SEG817Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Polyamine Oxidase (PAOX) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Polyamine Oxidase (PAOX) in serum, plasma, tissue homogenates and other biological fluids.
Mouse Polyamine Oxidase (PAOX) ELISA Kit
SEG817Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Polyamine Oxidase (PAOX) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Polyamine Oxidase (PAOX) in serum, plasma, tissue homogenates and other biological fluids.
Mouse Polyamine Oxidase (PAOX) ELISA Kit
SEG817Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Polyamine Oxidase (PAOX) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Polyamine Oxidase (PAOX) in serum, plasma, tissue homogenates and other biological fluids.
Mouse Polyamine Oxidase (PAOX) ELISA Kit
SEG817Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Polyamine Oxidase (PAOX) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Polyamine Oxidase (PAOX) in serum, plasma, tissue homogenates and other biological fluids.
Mouse Polyamine Oxidase (PAOX) ELISA Kit
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Polyamine Oxidase elisa. Alternative names of the recognized antigen: PAO
  • Peroxisomal N(1)-Acetyl-Spermine/Spermidine Oxidase(Exo-N4-Amino)
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Polyamine Oxidase (PAOX) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Mouse Sulfite Oxidase (SUOX) ELISA Kit
SEH097Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sulfite Oxidase (SUOX) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sulfite Oxidase (SUOX) in Tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Mouse Sulfite Oxidase (SUOX) ELISA Kit
SEH097Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sulfite Oxidase (SUOX) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sulfite Oxidase (SUOX) in Tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Mouse Sulfite Oxidase (SUOX) ELISA Kit
SEH097Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sulfite Oxidase (SUOX) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sulfite Oxidase (SUOX) in Tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Mouse Sulfite Oxidase (SUOX) ELISA Kit
SEH097Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sulfite Oxidase (SUOX) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sulfite Oxidase (SUOX) in Tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Mouse Sulfite Oxidase (SUOX) ELISA Kit
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Sulfite Oxidase elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Sulfite Oxidase (SUOX) in samples from Tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.
Mtco1 ELISA Kit| Mouse Cytochrome c oxidase subunit 1 ELISA Kit
EF014609 96 Tests
EUR 689
Anti-AOX1/Aldehyde Oxidase Antibody
A02144-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for AOX1 Antibody (AOX1) detection.tested for WB in Human, Rat.
Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 1 ELISA kit
E03N0042-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 1 ELISA kit
E03N0042-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 1 ELISA kit
E03N0042-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
ELISA kit for Mouse Cytochrome c oxidase subunit 1
EK4805 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Cytochrome c oxidase subunit 1 in samples from serum, plasma, tissue homogenates and other biological fluids.