Mouse PCYOX1(Prenylcysteine Oxidase 1) ELISA Kit

Mouse PCYOX1(Prenylcysteine Oxidase 1) ELISA Kit

To Order Contact us:  Mark@operatiebrp.nl

Mouse Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit
RD-PCYOX1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit
RD-PCYOX1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Mouse Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit
RDR-PCYOX1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit
RDR-PCYOX1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit
DLR-PCYOX1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Prenylcysteine Oxidase 1 (PCYOX1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit
DLR-PCYOX1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Prenylcysteine Oxidase 1 (PCYOX1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit
RD-PCYOX1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit
RD-PCYOX1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit
RDR-PCYOX1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit
RDR-PCYOX1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Mouse Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit
20-abx154511	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit
SEH428Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Prenylcysteine Oxidase 1 (PCYOX1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Prenylcysteine Oxidase 1 (PCYOX1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit
SEH428Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Prenylcysteine Oxidase 1 (PCYOX1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Prenylcysteine Oxidase 1 (PCYOX1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit
SEH428Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Prenylcysteine Oxidase 1 (PCYOX1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Prenylcysteine Oxidase 1 (PCYOX1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit
SEH428Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Prenylcysteine Oxidase 1 (PCYOX1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Prenylcysteine Oxidase 1 (PCYOX1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit
4-SEH428Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Prenylcysteine Oxidase 1 elisa. Alternative names of the recognized antigen: PCL1 Prenylcysteine lyase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Prenylcysteine Oxidase 1 (PCYOX1) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Prenylcysteine oxidase, Pcyox1 ELISA KIT
ELI-12394m	Lifescience Market	96 Tests	EUR 865

Prenylcysteine Oxidase 1 (PCYOX1) Antibody
20-abx114673	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Prenylcysteine Oxidase 1 (PCYOX1) Antibody
20-abx131433	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Prenylcysteine Oxidase 1 (PCYOX1) Antibody
20-abx131434	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Prenylcysteine Oxidase 1 (PCYOX1) Antibody
20-abx174153	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Prenylcysteine Oxidase 1 (PCYOX1) Antibody
20-abx178078	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Prenylcysteine Oxidase 1 (PCYOX1) Antibody
20-abx217664	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Prenylcysteine Oxidase 1 (PCYOX1) Antibody
abx340058-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Prenylcysteine Oxidase 1 (PCYOX1) Antibody
abx236231-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Recombinant Prenylcysteine Oxidase 1 (PCYOX1)
4-RPH428Hu01	Cloud-Clone	EUR 453.02 EUR 224.00 EUR 1423.84 EUR 541.28 EUR 982.56 EUR 366.00 EUR 3409.60	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9UHG3 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 67.3kDa Isoelectric Point: Inquire
Description: Recombinant Human Prenylcysteine Oxidase 1 expressed in: E.coli

Recombinant Prenylcysteine Oxidase 1 (PCYOX1)
4-RPH428Mu01	Cloud-Clone	EUR 494.24 EUR 235.00 EUR 1578.40 EUR 592.80 EUR 1085.60 EUR 394.00 EUR 3796.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9CQF9 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 32.8kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Prenylcysteine Oxidase 1 expressed in: E.coli

Mouse Prenylcysteine Oxidase 1 (PCYOX1) Protein
20-abx650731	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Prenylcysteine Oxidase 1 (PCYOX1) CLIA Kit
20-abx495449	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Prenylcysteine oxidase 1, PCYOX1 ELISA KIT
ELI-45170h	Lifescience Market	96 Tests	EUR 824

Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit
20-abx152665	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Prenylcysteine oxidase 1(PCYOX1) ELISA kit
CSB-EL017652HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Prenylcysteine oxidase 1 (PCYOX1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Prenylcysteine oxidase 1(PCYOX1) ELISA kit
1-CSB-EL017652HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Prenylcysteine oxidase 1(PCYOX1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit
SEH428Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prenylcysteine Oxidase 1 (PCYOX1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prenylcysteine Oxidase 1 (PCYOX1) in Tissue homogenates, cell lysates and other biological fluids.

Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit
SEH428Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prenylcysteine Oxidase 1 (PCYOX1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prenylcysteine Oxidase 1 (PCYOX1) in Tissue homogenates, cell lysates and other biological fluids.

Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit
SEH428Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prenylcysteine Oxidase 1 (PCYOX1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prenylcysteine Oxidase 1 (PCYOX1) in Tissue homogenates, cell lysates and other biological fluids.

Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit
SEH428Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prenylcysteine Oxidase 1 (PCYOX1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prenylcysteine Oxidase 1 (PCYOX1) in Tissue homogenates, cell lysates and other biological fluids.

Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit
4-SEH428Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Prenylcysteine Oxidase 1 elisa. Alternative names of the recognized antigen: PCL1 Prenylcysteine lyase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Prenylcysteine Oxidase 1 (PCYOX1) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Mouse PCYOX1 (Prenylcysteine Oxidase 1)
ELK6955	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Prenylcysteine Oxidase 1 (PCYOX1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Show more
Description: A sandwich ELISA kit for detection of Prenylcysteine Oxidase 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse Prenylcysteine oxidase 1 (PCYOX1)
KTE70784-48T	Abbkine	48T	EUR 332
Prenylcysteine is released during the degradation of prenylated proteins. PCYOX1 catalyzes the degradation of prenylcysteine to yield free cysteines and a hydrophobic isoprenoid product . The deduced 505-amino acid protein contains a predicted signal Show more
Description: Quantitative sandwich ELISA for measuring Mouse Prenylcysteine oxidase 1 (PCYOX1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Prenylcysteine oxidase 1 (PCYOX1)
KTE70784-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Prenylcysteine is released during the degradation of prenylated proteins. PCYOX1 catalyzes the degradation of prenylcysteine to yield free cysteines and a hydrophobic isoprenoid product . The deduced 505-amino acid protein contains a predicted signal Show more
Description: Quantitative sandwich ELISA for measuring Mouse Prenylcysteine oxidase 1 (PCYOX1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Prenylcysteine oxidase 1 (PCYOX1)
KTE70784-96T	Abbkine	96T	EUR 539
Prenylcysteine is released during the degradation of prenylated proteins. PCYOX1 catalyzes the degradation of prenylcysteine to yield free cysteines and a hydrophobic isoprenoid product . The deduced 505-amino acid protein contains a predicted signal Show more
Description: Quantitative sandwich ELISA for measuring Mouse Prenylcysteine oxidase 1 (PCYOX1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Mouse)
4-PAH428Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PCYOX1 (Ala249~Leu505) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prenylcysteine Oxidase 1 (PCYOX1)

Human Prenylcysteine Oxidase 1 (PCYOX1) Protein
20-abx650730	Abbexa	EUR 634.00 EUR 272.00 EUR 1929.00 EUR 759.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Prenylcysteine Oxidase 1 (PCYOX1) CLIA Kit
20-abx495448	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human PCYOX1 (Prenylcysteine Oxidase 1)
ELK4169	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Prenylcysteine Oxidase 1 (PCYOX1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Show more
Description: A sandwich ELISA kit for detection of Prenylcysteine Oxidase 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Prenylcysteine oxidase 1 (PCYOX1)
KTE61281-48T	Abbkine	48T	EUR 332
Prenylcysteine is released during the degradation of prenylated proteins. PCYOX1 catalyzes the degradation of prenylcysteine to yield free cysteines and a hydrophobic isoprenoid product . The deduced 505-amino acid protein contains a predicted signal Show more
Description: Quantitative sandwich ELISA for measuring Human Prenylcysteine oxidase 1 (PCYOX1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Prenylcysteine oxidase 1 (PCYOX1)
KTE61281-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Prenylcysteine is released during the degradation of prenylated proteins. PCYOX1 catalyzes the degradation of prenylcysteine to yield free cysteines and a hydrophobic isoprenoid product . The deduced 505-amino acid protein contains a predicted signal Show more
Description: Quantitative sandwich ELISA for measuring Human Prenylcysteine oxidase 1 (PCYOX1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Prenylcysteine oxidase 1 (PCYOX1)
KTE61281-96T	Abbkine	96T	EUR 539
Prenylcysteine is released during the degradation of prenylated proteins. PCYOX1 catalyzes the degradation of prenylcysteine to yield free cysteines and a hydrophobic isoprenoid product . The deduced 505-amino acid protein contains a predicted signal Show more
Description: Quantitative sandwich ELISA for measuring Human Prenylcysteine oxidase 1 (PCYOX1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Human, Mouse)
4-PAH428Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PCYOX1 (Tyr174~Leu505) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Prenylcysteine Oxidase 1 (PCYOX1)

Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Mouse), APC
4-PAH428Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PCYOX1 (Ala249~Leu505) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with APC.

Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Mouse), Biotinylated
4-PAH428Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PCYOX1 (Ala249~Leu505) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with Biotin.

Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Mouse), Cy3
4-PAH428Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PCYOX1 (Ala249~Leu505) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with Cy3.

Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Mouse), FITC
4-PAH428Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PCYOX1 (Ala249~Leu505) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with FITC.

Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Mouse), HRP
4-PAH428Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PCYOX1 (Ala249~Leu505) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with HRP.

Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Mouse), PE
4-PAH428Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PCYOX1 (Ala249~Leu505) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with PE.

Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Human, Mouse), APC
4-PAH428Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PCYOX1 (Tyr174~Leu505) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with APC.

Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Human, Mouse), Biotinylated
4-PAH428Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PCYOX1 (Tyr174~Leu505) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with Biotin.

Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Human, Mouse), Cy3
4-PAH428Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PCYOX1 (Tyr174~Leu505) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with Cy3.

Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Human, Mouse), FITC
4-PAH428Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PCYOX1 (Tyr174~Leu505) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with FITC.

Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Human, Mouse), HRP
4-PAH428Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PCYOX1 (Tyr174~Leu505) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with HRP.

Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Human, Mouse), PE
4-PAH428Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PCYOX1 (Tyr174~Leu505) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with PE.

Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Mouse), APC-Cy7
4-PAH428Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PCYOX1 (Ala249~Leu505) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with APC-Cy7.

Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Human, Mouse), APC-Cy7
4-PAH428Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PCYOX1 (Tyr174~Leu505) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with APC-Cy7.

Mouse Prenylcysteine oxidase- like, Pcyox1l ELISA KIT
ELI-45171m	Lifescience Market	96 Tests	EUR 865

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Bovine Prenylcysteine oxidase- like, PCYOX1L ELISA KIT
ELI-43159b	Lifescience Market	96 Tests	EUR 928

Human Prenylcysteine oxidase- like, PCYOX1L ELISA KIT
ELI-43160h	Lifescience Market	96 Tests	EUR 824

Prenylcysteine Oxidase-Like (PCYXL) Antibody
abx032568-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Prenylcysteine Oxidase-Like (PCYXL) Antibody
abx032568-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Pcyox1/ Rat Pcyox1 ELISA Kit
ELI-14590r	Lifescience Market	96 Tests	EUR 886

PCYOX1 ELISA Kit (Mouse) (OKCD09052)
OKCD09052	Aviva Systems Biology	96 Wells	EUR 1001
Description: Description of target: Involved in the degradation of prenylated proteins. cleaves the thioether bond of prenyl-l-cysteines, such as farnesylcysteine and geranylgeranylcysteine (by similarity).;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.072ng/mL

PCYOX1 ELISA Kit (Mouse) (OKDD00815)
OKDD00815	Aviva Systems Biology	96 Wells	EUR 988
Description: Description of target: Involved in the degradation of prenylated proteins. cleaves the thioether bond of prenyl-l-cysteines, such as farnesylcysteine and geranylgeranylcysteine (by similarity).;Species reactivity: Mouse;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.072ng/mL

PCYOX1 ELISA KIT|Human
EF001621	Lifescience Market	96 Tests	EUR 689

PCYOX1 ELISA Kit (Human) (OKCD01032)
OKCD01032	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Involved in the degradation of prenylated proteins. Cleaves the thioether bond of prenyl-L-cysteines, such as farnesylcysteine and geranylgeranylcysteine. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.118 ng/mL

Mouse PCYOX1 shRNA Plasmid
20-abx975836	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

PCYOX1 Recombinant Protein (Mouse)
RP160775	ABM	100 ug	Ask for price

PCYOX1 siRNA
20-abx903878	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PCYOX1 siRNA
20-abx928016	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PCYOX1 siRNA
20-abx928017	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PCYOX1 Antibody
ABD8332	Lifescience Market	100 ug	EUR 438

PCYOX1 Antibody
45274-100ul	SAB	100ul	EUR 252

PCYOX1 Antibody
45274-50ul	SAB	50ul	EUR 187

PCYOX1 antibody
70R-19165	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal PCYOX1 antibody

PCYOX1 Antibody
DF8332	Affbiotech	200ul	EUR 304
Description: PCYOX1 Antibody detects endogenous levels of total PCYOX1.

PCYOX1 Antibody
1-CSB-PA017652GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PCYOX1. Recognizes PCYOX1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

anti-PCYOX1
YF-PA26185	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to PCYOX1

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

Pcyox1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3674502	ABM	1.0 ug DNA	EUR 154

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

Mouse Aldehyde Oxidase 1 (AOX1) ELISA Kit
abx520547-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Mouse NADPH oxidase 1 (NOX1) ELISA Kit
abx520821-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Mouse Sulfhydryl Oxidase 1 (QSOX1) ELISA Kit
abx576447-96tests	Abbexa	96 tests	EUR 668
Shipped within 1-2 months.

Mouse Dual oxidase 1(DUOX1) ELISA kit
E03D0296-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Dual oxidase 1(DUOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Dual oxidase 1(DUOX1) ELISA kit
E03D0296-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Dual oxidase 1(DUOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Dual oxidase 1(DUOX1) ELISA kit
E03D0296-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Dual oxidase 1(DUOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Quiescin Sulfhydryl Oxidase 1 ELISA kit
E03Q0001-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Quiescin Sulfhydryl Oxidase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Quiescin Sulfhydryl Oxidase 1 ELISA kit
E03Q0001-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Quiescin Sulfhydryl Oxidase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Quiescin Sulfhydryl Oxidase 1 ELISA kit
E03Q0001-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Quiescin Sulfhydryl Oxidase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Sulfhydryl oxidase 1(QSOX1) ELISA kit
E03S0347-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Sulfhydryl oxidase 1(QSOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Sulfhydryl oxidase 1(QSOX1) ELISA kit
E03S0347-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Sulfhydryl oxidase 1(QSOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Sulfhydryl oxidase 1(QSOX1) ELISA kit
E03S0347-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Sulfhydryl oxidase 1(QSOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Mouse NADPH oxidase 1
EK4834	SAB	96 tests	EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse NADPH oxidase 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Mouse Nox1/ NADPH oxidase 1 ELISA Kit
E1043Mo	Sunlong	1 Kit	EUR 632

Mouse NADPH oxidase 1, Nox1 ELISA KIT
ELI-07626m	Lifescience Market	96 Tests	EUR 865

Mouse Hydroxyacid oxidase 1, Hao1 ELISA KIT
ELI-08008m	Lifescience Market	96 Tests	EUR 865

Mouse Sulfhydryl oxidase 1, Qsox1 ELISA KIT
ELI-43054m	Lifescience Market	96 Tests	EUR 865

Mouse Nox1(NADPH oxidase 1) ELISA Kit
EM0800	FN Test	96T	EUR 567.6
Detection range: 15.6-1000 pg/ml Uniprot ID: Q8CIZ9 Alias: Nox1/NOH-1/Mitogenic oxidase 1(MOX-1)/NADH/NADPH mitogenic oxidase subunit P65-MOX/Nicotinamide Adenine Dinucleotide Phosphate Oxidase 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 9.375pg/ml

Mouse NADPH Oxidase 1 (NOX1) ELISA Kit
abx255148-96tests	Abbexa	96 tests	EUR 746
Shipped within 5-12 working days.

Mouse Hydroxyacid oxidase 1(HAO1) ELISA kit
CSB-EL010127MO-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Hydroxyacid oxidase 1 (HAO1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Hydroxyacid oxidase 1(HAO1) ELISA kit
1-CSB-EL010127MO	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Hydroxyacid oxidase 1(HAO1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Aox1/ Aldehyde oxidase 1 ELISA Kit
E0105Mo	Sunlong	1 Kit	EUR 571

Qsox1 ELISA Kit| Mouse Sulfhydryl oxidase 1 ELISA Kit
EF016016	Lifescience Market	96 Tests	EUR 689

Nox1 ELISA Kit| Mouse NADPH oxidase 1 ELISA Kit
EF013410	Lifescience Market	96 Tests	EUR 689

Pcyox1 ORF Vector (Mouse) (pORF)
ORF053593	ABM	1.0 ug DNA	EUR 506

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

Mouse Xanthione oxidase ELISA kit
E03X0001-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Xanthione oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Xanthione oxidase ELISA kit
E03X0001-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Xanthione oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Xanthione oxidase ELISA kit
E03X0001-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Xanthione oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Lysyl oxidase ELISA kit
E03L0305-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Lysyl oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Lysyl oxidase ELISA kit
E03L0305-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Lysyl oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Lysyl oxidase ELISA kit
E03L0305-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Lysyl oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Monoamine Oxidase ELISA kit
E03M0224-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Monoamine Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Monoamine Oxidase ELISA kit
E03M0224-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Monoamine Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Monoamine Oxidase ELISA kit
E03M0224-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Monoamine Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Diamine Oxidase ELISA kit
E03D0032-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Diamine Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Diamine Oxidase ELISA kit
E03D0032-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Diamine Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Diamine Oxidase ELISA kit
E03D0032-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Diamine Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Glucose Oxidase ELISA kit
E03G0341-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Glucose Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Glucose Oxidase ELISA kit
E03G0341-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Glucose Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Glucose Oxidase ELISA kit
E03G0341-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Glucose Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

PCYOX1 Conjugated Antibody
C45274	SAB	100ul	EUR 397

PCYOX1 cloning plasmid
CSB-CL017652HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1518 Sequence: atggggcgcgtcgtcgcggagcttgtctcctcgctgctggggttgtggctgttgctgtgcagctgcggatgccccgagggcgccgagctgcgtgctccgccagataaaatcgcgattattggagccggaattggtggcacttcagcagcctattacctgcggcagaaatttggga Show more
Description: A cloning plasmid for the PCYOX1 gene.

anti- PCYOX1 antibody
FNab06231	FN Test	100µg	EUR 505.25
Immunogen: prenylcysteine oxidase 1 Uniprot ID: Q9UHG3 Gene ID: 51449 Research Area: Metabolism
Description: Antibody raised against PCYOX1

PCYOX1 Blocking Peptide
DF8332-BP	Affbiotech	1mg	EUR 195

Anti-PCYOX1 antibody
PAab06231	Lifescience Market	100 ug	EUR 355

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

Mouse Lysyl Oxidase Like 1 (LOXL1) ELISA Kit
abx575650-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Mouse NADPH oxidase organizer 1, Noxo1 ELISA KIT
ELI-21241m	Lifescience Market	96 Tests	EUR 865

Mouse NADPH oxidase activator 1, Noxa1 ELISA KIT
ELI-35317m	Lifescience Market	96 Tests	EUR 865

Mouse NADPH oxidase activator 1 (NOXA1) ELISA Kit
abx389985-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse NADPH oxidase organizer 1 (NOXO1) ELISA Kit
abx389986-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

ELISA kit for Mouse Sulfhydryl oxidase 1 (QSOX1)
KTE70579-48T	Abbkine	48T	EUR 332
Sulfhydryl oxidase 1 is a protein that contains domains of thioredoxin and ERV1, members of two long-standing gene families. The gene expression is induced as fibroblasts begin to exit the proliferative cycle and enter quiescence, suggesting that thi Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sulfhydryl oxidase 1 (QSOX1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Sulfhydryl oxidase 1 (QSOX1)
KTE70579-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Sulfhydryl oxidase 1 is a protein that contains domains of thioredoxin and ERV1, members of two long-standing gene families. The gene expression is induced as fibroblasts begin to exit the proliferative cycle and enter quiescence, suggesting that thi Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sulfhydryl oxidase 1 (QSOX1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Sulfhydryl oxidase 1 (QSOX1)
KTE70579-96T	Abbkine	96T	EUR 539
Sulfhydryl oxidase 1 is a protein that contains domains of thioredoxin and ERV1, members of two long-standing gene families. The gene expression is induced as fibroblasts begin to exit the proliferative cycle and enter quiescence, suggesting that thi Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sulfhydryl oxidase 1 (QSOX1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Noxa1 ELISA Kit| Mouse NADPH oxidase activator 1 ELISA Kit
EF015624	Lifescience Market	96 Tests	EUR 689

Noxo1 ELISA Kit| Mouse NADPH oxidase organizer 1 ELISA Kit
EF015625	Lifescience Market	96 Tests	EUR 689

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

Pcyox1 sgRNA CRISPR Lentivector set (Mouse)
K3674501	ABM	3 x 1.0 ug	EUR 339

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-1	CORNING	1/pk	EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Mouse Spermine oxidase (SMOX) ELISA Kit
abx572544-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Mouse Xanthine dehydrogenase/oxidase ELISA kit
E03X0012-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Xanthine dehydrogenase/oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Xanthine dehydrogenase/oxidase ELISA kit
E03X0012-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Xanthine dehydrogenase/oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Xanthine dehydrogenase/oxidase ELISA kit
E03X0012-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Xanthine dehydrogenase/oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Monoamine oxidase A ELISA kit
E03M0225-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Monoamine oxidase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Monoamine oxidase A ELISA kit
E03M0225-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Monoamine oxidase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Monoamine oxidase A ELISA kit
E03M0225-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Monoamine oxidase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cytochrome c oxidase ELISA kit
E03C0015-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cytochrome c oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cytochrome c oxidase ELISA kit
E03C0015-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cytochrome c oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cytochrome c oxidase ELISA kit
E03C0015-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cytochrome c oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cytochrome Oxidase 4 ELISA kit
E03C0103-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cytochrome Oxidase 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cytochrome Oxidase 4 ELISA kit
E03C0103-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cytochrome Oxidase 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cytochrome Oxidase 4 ELISA kit
E03C0103-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cytochrome Oxidase 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Acetyl CoA oxidase ELISA kit
E03A0641-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Acetyl CoA oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Acetyl CoA oxidase ELISA kit
E03A0641-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Acetyl CoA oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Acetyl CoA oxidase ELISA kit
E03A0641-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Acetyl CoA oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Aldehyde oxidase(AOX1) ELISA kit
E03A1553-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Aldehyde oxidase(AOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Aldehyde oxidase(AOX1) ELISA kit
E03A1553-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Aldehyde oxidase(AOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Aldehyde oxidase(AOX1) ELISA kit
E03A1553-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Aldehyde oxidase(AOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Mouse Spermine oxidase
EK4455	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Spermine oxidase in samples from serum, plasma, tissue homogenates and other biological fluids.

Mouse Smox/ Spermine oxidase ELISA Kit
E1382Mo	Sunlong	1 Kit	EUR 571

Mouse Lathosterol oxidase, Sc5dl ELISA KIT
ELI-20154m	Lifescience Market	96 Tests	EUR 865

Mouse Sulfite Oxidase, SUOX ELISA Kit
ELI-06779m	Lifescience Market	96 Tests	EUR 865

Mouse Spermine oxidase, Smox ELISA KIT
ELI-07250m	Lifescience Market	96 Tests	EUR 865

Mouse Aldehyde oxidase, Aox1 ELISA KIT
ELI-07559m	Lifescience Market	96 Tests	EUR 865

Mouse diamine oxidase(DAO)ELISA Kit
GA-E0588MS-48T	GenAsia Biotech	48T	EUR 336

Mouse diamine oxidase(DAO)ELISA Kit
GA-E0588MS-96T	GenAsia Biotech	96T	EUR 534

Mouse Protoporphyrinogen oxidase, Ppox ELISA KIT
ELI-36548m	Lifescience Market	96 Tests	EUR 865

Mouse Smox(Spermine oxidase) ELISA Kit
EM0749	FN Test	96T	EUR 567.6
Detection range: 0.312-20 ng/ml Uniprot ID: Q99K82 Alias: Smox/SMOX(Spermine oxidase)Polyamine oxidase 1/PAO-1/PAOh1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.188 ng/ml

Mouse DAO(Diamine Oxidase) ELISA Kit
EM0980	FN Test	96T	EUR 524.1
Detection range: 3.906-250 ng/ml Uniprot ID: P18894 Alias: DAO/AOC1/DAO/Diamine Oxidase/Histaminase/KAO/ABP/amiloride binding protein 1(amine oxidase(copper-containing))/Amiloride-binding protein/amiloride-sensitive amine oxidase/amiloride-sensitive Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 2.344 ng/ml

Mouse LOX(Lysyl Oxidase) ELISA Kit
EM1614	FN Test	96T	EUR 567.6
Detection range: 0.313-20 ng/ml Alias: Lysyl Oxidase
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.188 ng/ml

Mouse XOD(Xantine oxidase) ELISA Kit
EM1865	FN Test	96T	EUR 567.6
Detection range: 78-5000 pg/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 46.9pg/ml

Mouse Lysyl Oxidase (LOX) ELISA Kit
20-abx154350	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Polyamine Oxidase (PAOX) ELISA Kit
20-abx154565	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Spermine Oxidase (SMOX) ELISA Kit
20-abx154701	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Sulfite Oxidase (SUOX) ELISA Kit
20-abx154719	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Monoamine Oxidase (MAO) ELISA Kit
abx350797-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Mouse Spermine oxidase (SMOX) ELISA Kit
abx255097-96tests	Abbexa	96 tests	EUR 746
Shipped within 5-12 working days.

Mouse Lysyl Oxidase (LOX) ELISA Kit
abx257820-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Mouse Polyamine Oxidase (PAOX) ELISA Kit
DLR-PAOX-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Polyamine Oxidase (PAOX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Polyamine Oxidase (PAOX) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Polyamine Oxidase (PAOX) ELISA Kit
DLR-PAOX-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Polyamine Oxidase (PAOX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Polyamine Oxidase (PAOX) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Spermine Oxidase (SMOX) ELISA Kit
DLR-SMOX-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Spermine Oxidase (SMOX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Spermine Oxidase (SMOX) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Spermine Oxidase (SMOX) ELISA Kit
DLR-SMOX-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Spermine Oxidase (SMOX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Spermine Oxidase (SMOX) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Lysyl Oxidase (LOX) ELISA Kit
DLR-LOX-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Lysyl Oxidase (LOX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Lysyl Oxidase (LOX) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Lysyl Oxidase (LOX) ELISA Kit
DLR-LOX-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Lysyl Oxidase (LOX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Lysyl Oxidase (LOX) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Sulfite Oxidase (SUOX) ELISA Kit
DLR-SUOX-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Sulfite Oxidase (SUOX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Sulfite Oxidase (SUOX) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Sulfite Oxidase (SUOX) ELISA Kit
DLR-SUOX-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Sulfite Oxidase (SUOX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Sulfite Oxidase (SUOX) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse diamine oxidase, DAO ELISA Kit
CSB-E10090m-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse diamine oxidase, DAO in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse diamine oxidase, DAO ELISA Kit
1-CSB-E10090m	Cusabio	EUR 946.00 EUR 5782.00 EUR 3060.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse diamine oxidase, DAO in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse diamine oxidase,DAO ELISA Kit
CN-02511M1	ChemNorm	96T	EUR 436

Mouse diamine oxidase,DAO ELISA Kit
CN-02511M2	ChemNorm	48T	EUR 287

Mouse Spermine Oxidase (SMOX) ELISA Kit
SEC852Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Spermine Oxidase (SMOX) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Spermine Oxidase (SMOX) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Spermine Oxidase (SMOX) ELISA Kit
SEC852Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Spermine Oxidase (SMOX) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Spermine Oxidase (SMOX) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Spermine Oxidase (SMOX) ELISA Kit
SEC852Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Spermine Oxidase (SMOX) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Spermine Oxidase (SMOX) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Spermine Oxidase (SMOX) ELISA Kit
SEC852Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Spermine Oxidase (SMOX) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Spermine Oxidase (SMOX) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Spermine Oxidase (SMOX) ELISA Kit
4-SEC852Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Spermine Oxidase elisa. Alternative names of the recognized antigen: SMO PAO PAOh1 C20orf16 Polyamine oxidase 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Spermine Oxidase (SMOX) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Lysyl Oxidase (LOX) ELISA Kit
SEC580Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Lysyl Oxidase (LOX) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Lysyl Oxidase (LOX) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Lysyl Oxidase (LOX) ELISA Kit
SEC580Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Lysyl Oxidase (LOX) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Lysyl Oxidase (LOX) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Lysyl Oxidase (LOX) ELISA Kit
SEC580Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Lysyl Oxidase (LOX) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Lysyl Oxidase (LOX) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Lysyl Oxidase (LOX) ELISA Kit
SEC580Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Lysyl Oxidase (LOX) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Lysyl Oxidase (LOX) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Lysyl Oxidase (LOX) ELISA Kit
4-SEC580Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Lysyl Oxidase elisa. Alternative names of the recognized antigen: Protein-Lysine 6-Oxidase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Lysyl Oxidase (LOX) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Diamine Oxidase (DAO) ELISA Kit
SEA656Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4391.16
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Diamine Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Diamine Oxidase (DAO) ELISA Kit
SEA656Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 449.27
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Diamine Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Diamine Oxidase (DAO) ELISA Kit
SEA656Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 598.96
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Diamine Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Diamine Oxidase (DAO) ELISA Kit
SEA656Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2395.32
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Diamine Oxidase (DAO) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Diamine Oxidase (DAO) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Diamine Oxidase (DAO) ELISA Kit
4-SEA656Mu	Cloud-Clone	EUR 4442.00 EUR 2346.00 EUR 599.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Diamine Oxidase elisa. Alternative names of the recognized antigen: AOC1 ABP1 KAO Histaminase Kidney amine oxidase Amiloride Binding Protein 1 Amiloride-sensitive amine oxidase Amine oxidase copper domain-containing protein 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Diamine Oxidase (DAO) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Diamine Oxidase ELISA Kit (DAO)
RK02737	Abclonal	96 Tests	EUR 521

Mouse Lysyl Oxidase ELISA Kit (LOX)
RK02992	Abclonal	96 Tests	EUR 521

Mouse Polyamine Oxidase (PAOX) ELISA Kit
RD-PAOX-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Polyamine Oxidase (PAOX) ELISA Kit
RD-PAOX-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Mouse Spermine Oxidase (SMOX) ELISA Kit
RD-SMOX-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Spermine Oxidase (SMOX) ELISA Kit
RD-SMOX-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Mouse Sulfite Oxidase (SUOX) ELISA Kit
RD-SUOX-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Sulfite Oxidase (SUOX) ELISA Kit
RD-SUOX-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Mouse Lysyl Oxidase (LOX) ELISA Kit
RD-LOX-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Lysyl Oxidase (LOX) ELISA Kit
RD-LOX-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Mouse Lysyl Oxidase (LOX) ELISA Kit
RDR-LOX-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Lysyl Oxidase (LOX) ELISA Kit
RDR-LOX-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Mouse Polyamine Oxidase (PAOX) ELISA Kit
RDR-PAOX-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Polyamine Oxidase (PAOX) ELISA Kit
RDR-PAOX-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Mouse Spermine Oxidase (SMOX) ELISA Kit
RDR-SMOX-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Spermine Oxidase (SMOX) ELISA Kit
RDR-SMOX-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Mouse Sulfite Oxidase (SUOX) ELISA Kit
RDR-SUOX-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Sulfite Oxidase (SUOX) ELISA Kit
RDR-SUOX-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Mouse monoamine oxidase(MAO)ELISA Kit
QY-E21019	Qayee Biotechnology	96T	EUR 361

Mouse diamine oxidase(DAO)ELISA Kit
QY-E20470	Qayee Biotechnology	96T	EUR 361

Mouse Polyamine Oxidase (PAOX) ELISA Kit
SEG817Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Polyamine Oxidase (PAOX) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Polyamine Oxidase (PAOX) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Polyamine Oxidase (PAOX) ELISA Kit
SEG817Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Polyamine Oxidase (PAOX) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Polyamine Oxidase (PAOX) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Polyamine Oxidase (PAOX) ELISA Kit
SEG817Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Polyamine Oxidase (PAOX) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Polyamine Oxidase (PAOX) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Polyamine Oxidase (PAOX) ELISA Kit
SEG817Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Polyamine Oxidase (PAOX) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Polyamine Oxidase (PAOX) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Polyamine Oxidase (PAOX) ELISA Kit
4-SEG817Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Polyamine Oxidase elisa. Alternative names of the recognized antigen: PAO Peroxisomal N(1)-Acetyl-Spermine/Spermidine Oxidase(Exo-N4-Amino)
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Polyamine Oxidase (PAOX) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Sulfite Oxidase (SUOX) ELISA Kit
SEH097Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sulfite Oxidase (SUOX) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sulfite Oxidase (SUOX) in Tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Sulfite Oxidase (SUOX) ELISA Kit
SEH097Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sulfite Oxidase (SUOX) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sulfite Oxidase (SUOX) in Tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Sulfite Oxidase (SUOX) ELISA Kit
SEH097Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sulfite Oxidase (SUOX) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sulfite Oxidase (SUOX) in Tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Sulfite Oxidase (SUOX) ELISA Kit
SEH097Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sulfite Oxidase (SUOX) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sulfite Oxidase (SUOX) in Tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Sulfite Oxidase (SUOX) ELISA Kit
4-SEH097Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Sulfite Oxidase elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Sulfite Oxidase (SUOX) in samples from Tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mtco1 ELISA Kit| Mouse Cytochrome c oxidase subunit 1 ELISA Kit
EF014609	Lifescience Market	96 Tests	EUR 689

Anti-AOX1/Aldehyde Oxidase Antibody
A02144-1	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for AOX1 Antibody (AOX1) detection.tested for WB in Human, Rat.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 1 ELISA kit
E03N0042-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 1 ELISA kit
E03N0042-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 1 ELISA kit
E03N0042-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Mouse Cytochrome c oxidase subunit 1
EK4805	SAB	96 tests	EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Cytochrome c oxidase subunit 1 in samples from serum, plasma, tissue homogenates and other biological fluids.