Mouse OGN(Osteoglycin) ELISA Kit

Mouse OGN(Osteoglycin) ELISA Kit

To Order Contact us:  Mark@operatiebrp.nl

Mouse Osteoglycin (OGN) ELISA Kit
RDR-OGN-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Osteoglycin (OGN) ELISA Kit
RDR-OGN-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Human Osteoglycin (OGN) ELISA Kit
DLR-OGN-Hu-48T	DL Develop	48T	EUR 517
Should the Human Osteoglycin (OGN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Osteoglycin (OGN) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Osteoglycin (OGN) ELISA Kit
DLR-OGN-Hu-96T	DL Develop	96T	EUR 673
Should the Human Osteoglycin (OGN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Osteoglycin (OGN) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Osteoglycin (OGN) ELISA Kit
RD-OGN-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Osteoglycin (OGN) ELISA Kit
RD-OGN-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Osteoglycin (OGN) ELISA Kit
RDR-OGN-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Osteoglycin (OGN) ELISA Kit
RDR-OGN-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Mouse Osteoglycin (OGN) ELISA Kit
20-abx154492	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Osteoglycin (OGN) ELISA Kit
SEC688Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Osteoglycin (OGN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Osteoglycin (OGN) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Osteoglycin (OGN) ELISA Kit
SEC688Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Osteoglycin (OGN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Osteoglycin (OGN) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Osteoglycin (OGN) ELISA Kit
SEC688Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Osteoglycin (OGN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Osteoglycin (OGN) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Osteoglycin (OGN) ELISA Kit
SEC688Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Osteoglycin (OGN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Osteoglycin (OGN) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Osteoglycin (OGN) ELISA Kit
4-SEC688Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Osteoglycin elisa. Alternative names of the recognized antigen: OIF SLRR3A Mimecan Proteoglycan Osteoinductive Factor
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Osteoglycin (OGN) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Osteoglycin ELISA Kit (OGN)
RK03091	Abclonal	96 Tests	EUR 521

Mouse Osteoglycin / Mimecan (OGN) ELISA Kit
abx571728-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

ELISA kit for Mouse OGN (Osteoglycin)
ELK7069	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Osteoglycin (OGN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Osteoglycin (OGN Show more
Description: A sandwich ELISA kit for detection of Osteoglycin from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse Osteoglycin (OGN) CLIA Kit
20-abx493842	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Mouse Osteoglycin (OGN) Protein
20-abx068402	Abbexa	EUR 704.00 EUR 286.00 EUR 2165.00 EUR 829.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Canine Osteoglycin(OGN)ELISA Kit
GA-E0083CN-48T	GenAsia Biotech	48T	EUR 402

Canine Osteoglycin(OGN)ELISA Kit
GA-E0083CN-96T	GenAsia Biotech	96T	EUR 684

Human Osteoglycin (OGN) ELISA Kit
20-abx152602	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Osteoglycin (OGN) ELISA Kit
SEC688Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Osteoglycin (OGN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Osteoglycin (OGN) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Osteoglycin (OGN) ELISA Kit
SEC688Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Osteoglycin (OGN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Osteoglycin (OGN) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Osteoglycin (OGN) ELISA Kit
SEC688Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Osteoglycin (OGN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Osteoglycin (OGN) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Osteoglycin (OGN) ELISA Kit
SEC688Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Osteoglycin (OGN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Osteoglycin (OGN) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Osteoglycin (OGN) ELISA Kit
4-SEC688Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Osteoglycin elisa. Alternative names of the recognized antigen: OIF SLRR3A Mimecan Proteoglycan Osteoinductive Factor
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Osteoglycin (OGN) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Osteoglycin ELISA Kit (OGN)
RK01988	Abclonal	96 Tests	EUR 521

Human Osteoglycin(OGN)ELISA Kit
QY-E03283	Qayee Biotechnology	96T	EUR 361

Osteoglycin (OGN) Antibody
20-abx100615	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Osteoglycin (OGN) Antibody
20-abx100616	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Osteoglycin (OGN) Antibody
20-abx100617	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Osteoglycin (OGN) Antibody
20-abx173914	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Osteoglycin (OGN) Antibody
20-abx177882	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Recombinant Osteoglycin (OGN)
4-RPC688Hu01	Cloud-Clone	EUR 494.24 EUR 235.00 EUR 1578.40 EUR 592.80 EUR 1085.60 EUR 394.00 EUR 3796.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P20774 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 14.9kDa Isoelectric Point: 9.5
Description: Recombinant Human Osteoglycin expressed in: E.coli

Recombinant Osteoglycin (OGN)
4-RPC688Mu01	Cloud-Clone	EUR 503.20 EUR 238.00 EUR 1612.00 EUR 604.00 EUR 1108.00 EUR 400.00 EUR 3880.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q62000 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 15.2kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Osteoglycin expressed in: E.coli

Recombinant Osteoglycin (OGN)
4-RPC688Ra01	Cloud-Clone	EUR 535.46 EUR 246.00 EUR 1732.96 EUR 644.32 EUR 1188.64 EUR 421.00 EUR 4182.40	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: D3ZVB7 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 15.2kDa Isoelectric Point: 9.6
Description: Recombinant Rat Osteoglycin expressed in: E.coli

Osteoglycin (OGN) Polyclonal Antibody (Mouse)
4-PAC688Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OGN (Leu180~Phe298) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Osteoglycin (OGN)

Cow Osteoglycin / Mimecan (OGN) ELISA Kit
abx520882-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Chicken Osteoglycin / Mimecan (OGN) ELISA Kit
abx520883-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Osteoglycin / Mimecan (OGN) ELISA Kit
abx572443-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

ELISA kit for Human OGN (Osteoglycin)
E-EL-H2163	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's OGN ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human OGN. Standards or samples are added to the micro ELISA plate wells and combined with the Show more
Description: A sandwich ELISA kit for quantitative measurement of Human OGN (Osteoglycin) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human OGN (Osteoglycin)
ELK3335	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Osteoglycin (OGN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Osteoglycin (OGN Show more
Description: A sandwich ELISA kit for detection of Osteoglycin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Osteoglycin / Mimecan (OGN) ELISA Kit
abx251775-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Human Osteoglycin (OGN) CLIA Kit
20-abx493841	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Osteoglycin (OGN) Protein
20-abx068401	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Rat Osteoglycin (OGN) Protein
20-abx068403	Abbexa	EUR 746.00 EUR 300.00 EUR 2332.00 EUR 885.00 EUR 523.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Osteoglycin (OGN) Antibody (Biotin)
20-abx272291	Abbexa	EUR 453.00 EUR 244.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Osteoglycin (OGN) Antibody (Biotin)
20-abx272961	Abbexa	EUR 467.00 EUR 244.00 EUR 1344.00 EUR 634.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Osteoglycin (OGN) Antibody (Biotin)
20-abx273373	Abbexa	EUR 481.00 EUR 244.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Osteoglycin (OGN) Polyclonal Antibody (Mouse), APC
4-PAC688Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OGN (Leu180~Phe298) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Osteoglycin (OGN). This antibody is labeled with APC.

Osteoglycin (OGN) Polyclonal Antibody (Mouse), Biotinylated
4-PAC688Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OGN (Leu180~Phe298) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Osteoglycin (OGN). This antibody is labeled with Biotin.

Osteoglycin (OGN) Polyclonal Antibody (Mouse), Cy3
4-PAC688Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OGN (Leu180~Phe298) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Osteoglycin (OGN). This antibody is labeled with Cy3.

Osteoglycin (OGN) Polyclonal Antibody (Mouse), FITC
4-PAC688Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OGN (Leu180~Phe298) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Osteoglycin (OGN). This antibody is labeled with FITC.

Osteoglycin (OGN) Polyclonal Antibody (Mouse), HRP
4-PAC688Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OGN (Leu180~Phe298) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Osteoglycin (OGN). This antibody is labeled with HRP.

Osteoglycin (OGN) Polyclonal Antibody (Mouse), PE
4-PAC688Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OGN (Leu180~Phe298) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Osteoglycin (OGN). This antibody is labeled with PE.

Osteoglycin (OGN) Polyclonal Antibody (Human)
4-PAC688Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OGN (Leu180~Phe298) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Osteoglycin (OGN)

Osteoglycin (OGN) Polyclonal Antibody (Rat)
4-PAC688Ra01	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OGN (Leu180~Phe298) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Osteoglycin (OGN)

Osteoglycin (OGN) Polyclonal Antibody (Mouse), APC-Cy7
4-PAC688Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OGN (Leu180~Phe298) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Osteoglycin (OGN). This antibody is labeled with APC-Cy7.

Osteoglycin (OGN) Polyclonal Antibody (Human), APC
4-PAC688Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OGN (Leu180~Phe298) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Osteoglycin (OGN). This antibody is labeled with APC.

Osteoglycin (OGN) Polyclonal Antibody (Human), Biotinylated
4-PAC688Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OGN (Leu180~Phe298) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Osteoglycin (OGN). This antibody is labeled with Biotin.

Osteoglycin (OGN) Polyclonal Antibody (Human), Cy3
4-PAC688Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OGN (Leu180~Phe298) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Osteoglycin (OGN). This antibody is labeled with Cy3.

Osteoglycin (OGN) Polyclonal Antibody (Human), FITC
4-PAC688Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OGN (Leu180~Phe298) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Osteoglycin (OGN). This antibody is labeled with FITC.

Osteoglycin (OGN) Polyclonal Antibody (Human), HRP
4-PAC688Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OGN (Leu180~Phe298) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Osteoglycin (OGN). This antibody is labeled with HRP.

Osteoglycin (OGN) Polyclonal Antibody (Human), PE
4-PAC688Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OGN (Leu180~Phe298) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Osteoglycin (OGN). This antibody is labeled with PE.

Osteoglycin (OGN) Polyclonal Antibody (Rat), APC
4-PAC688Ra01-APC	Cloud-Clone	EUR 364.00 EUR 3545.00 EUR 980.00 EUR 467.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OGN (Leu180~Phe298) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Osteoglycin (OGN). This antibody is labeled with APC.

Osteoglycin (OGN) Polyclonal Antibody (Rat), Biotinylated
4-PAC688Ra01-Biotin	Cloud-Clone	EUR 325.00 EUR 2658.00 EUR 777.00 EUR 400.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OGN (Leu180~Phe298) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Osteoglycin (OGN). This antibody is labeled with Biotin.

Osteoglycin (OGN) Polyclonal Antibody (Rat), Cy3
4-PAC688Ra01-Cy3	Cloud-Clone	EUR 444.00 EUR 4685.00 EUR 1265.00 EUR 581.00 EUR 261.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OGN (Leu180~Phe298) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Osteoglycin (OGN). This antibody is labeled with Cy3.

Osteoglycin (OGN) Polyclonal Antibody (Rat), FITC
4-PAC688Ra01-FITC	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OGN (Leu180~Phe298) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Osteoglycin (OGN). This antibody is labeled with FITC.

Osteoglycin (OGN) Polyclonal Antibody (Rat), HRP
4-PAC688Ra01-HRP	Cloud-Clone	EUR 332.00 EUR 3089.00 EUR 866.00 EUR 421.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OGN (Leu180~Phe298) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Osteoglycin (OGN). This antibody is labeled with HRP.

Osteoglycin (OGN) Polyclonal Antibody (Rat), PE
4-PAC688Ra01-PE	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OGN (Leu180~Phe298) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Osteoglycin (OGN). This antibody is labeled with PE.

Osteoglycin (OGN) Polyclonal Antibody (Human), APC-Cy7
4-PAC688Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OGN (Leu180~Phe298) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Osteoglycin (OGN). This antibody is labeled with APC-Cy7.

Osteoglycin (OGN) Polyclonal Antibody (Rat), APC-Cy7
4-PAC688Ra01-APC-Cy7	Cloud-Clone	EUR 608.00 EUR 6970.00 EUR 1840.00 EUR 814.00 EUR 335.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OGN (Leu180~Phe298) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Osteoglycin (OGN). This antibody is labeled with APC-Cy7.

Mouse Osteoglycin ELISA kit
E03O0853-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Osteoglycin ELISA kit
E03O0853-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Osteoglycin ELISA kit
E03O0853-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Recombinant Human OGN/ osteoglycin Protein, His, E.coli-100ug
QP6449-ec-100ug	EnQuireBio	100ug	EUR 408

Recombinant Human OGN/ osteoglycin Protein, His, E.coli-10ug
QP6449-ec-10ug	EnQuireBio	10ug	EUR 200

Recombinant Human OGN/ osteoglycin Protein, His, E.coli-1mg
QP6449-ec-1mg	EnQuireBio	1mg	EUR 1632

Recombinant Human OGN/ osteoglycin Protein, His, E.coli-200ug
QP6449-ec-200ug	EnQuireBio	200ug	EUR 634

Recombinant Human OGN/ osteoglycin Protein, His, E.coli-500ug
QP6449-ec-500ug	EnQuireBio	500ug	EUR 1060

Recombinant Human OGN/ osteoglycin Protein, His, E.coli-50ug
QP6449-ec-50ug	EnQuireBio	50ug	EUR 263

Recombinant Human OGN/ osteoglycin Protein, His, Yeast-100ug
QP6449-ye-100ug	EnQuireBio	100ug	EUR 480

Recombinant Human OGN/ osteoglycin Protein, His, Yeast-10ug
QP6449-ye-10ug	EnQuireBio	10ug	EUR 236

Recombinant Human OGN/ osteoglycin Protein, His, Yeast-1mg
QP6449-ye-1mg	EnQuireBio	1mg	EUR 1885

Recombinant Human OGN/ osteoglycin Protein, His, Yeast-200ug
QP6449-ye-200ug	EnQuireBio	200ug	EUR 744

Recombinant Human OGN/ osteoglycin Protein, His, Yeast-500ug
QP6449-ye-500ug	EnQuireBio	500ug	EUR 1206

Recombinant Human OGN/ osteoglycin Protein, His, Yeast-50ug
QP6449-ye-50ug	EnQuireBio	50ug	EUR 299

Mouse Ogn/ Mimecan ELISA Kit
E1077Mo	Sunlong	1 Kit	EUR 632

Mouse Mimecan, Ogn ELISA KIT
ELI-14029m	Lifescience Market	96 Tests	EUR 865

OGN ELISA Kit (Mouse) (OKCD02775)
OKCD02775	Aviva Systems Biology	96 Wells	EUR 857
Description: Description of target: Induces bone formation in conjunction with TGF-beta-1 or TGF-beta-2. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.063 ng/mL

Ogn ELISA Kit (Mouse) (OKBB01131)
OKBB01131	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: Osteoglycin (also called mimecan) is a protein that in humans is encoded by the OGN gene. This gene encodes a protein which induces ectopic bone formation in conjunction with transforming growth factor beta. This protein is a small proteoglycan which contains tandem leucine-rich repeats (LRR). The level of expression of this gene has been correlated with enlarged hearts and more specifically left ventricular hypertrophy. Mimecan belongs to a family of small leucine-rich proteoglycans (SLRPs). The mimecan gene was expressed at a moderate level in the mouse pituitary gland by Northern blot analysis. Expression of mimecan mRNA and protein is also observed in the human anterior pituitary gland. The OGN gene was mapped to chromosome 9q22.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <12pg/ml

Osteoglycin (Osteoglycin) Antibody
abx236032-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Rat Osteoglycin ELISA kit
E02O0853-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Osteoglycin ELISA kit
E02O0853-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Osteoglycin ELISA kit
E02O0853-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Osteoglycin ELISA kit
E04O0853-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Osteoglycin ELISA kit
E04O0853-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Osteoglycin ELISA kit
E04O0853-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Osteoglycin ELISA kit
E01O0853-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Osteoglycin ELISA kit
E01O0853-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Osteoglycin ELISA kit
E01O0853-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Osteoglycin ELISA kit
E06O0853-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Osteoglycin ELISA kit
E06O0853-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Osteoglycin ELISA kit
E06O0853-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Osteoglycin ELISA kit
E07O0853-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Osteoglycin ELISA kit
E07O0853-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Osteoglycin ELISA kit
E07O0853-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Osteoglycin ELISA kit
E08O0853-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Osteoglycin ELISA kit
E08O0853-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Osteoglycin ELISA kit
E08O0853-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Osteoglycin ELISA kit
E09O0853-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Osteoglycin ELISA kit
E09O0853-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Osteoglycin ELISA kit
E09O0853-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Osteoglycin ELISA KIT|Human
EF001495	Lifescience Market	96 Tests	EUR 689

Ogn ELISA Kit| Mouse Mimecan ELISA Kit
EF015766	Lifescience Market	96 Tests	EUR 689

Human OGN ELISA Kit
ELA-E8943h	Lifescience Market	96 Tests	EUR 824

OGN ELISA KIT|Human
EF006459	Lifescience Market	96 Tests	EUR 689

Guinea pig Osteoglycin ELISA kit
E05O0853-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Osteoglycin ELISA kit
E05O0853-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Osteoglycin ELISA kit
E05O0853-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human OGN/ Mimecan ELISA Kit
E1824Hu	Sunlong	1 Kit	EUR 605

Human OGN(Mimecan) ELISA Kit
EH2412	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: P20774 Alias: OGN/Osteoglycin/Osteoinductive factor/KSPG25/OIF/SLRR3A/DKFZp586P2421/mimecan/mimecan proteoglycan/OIFOG/Osteoglycin/osteoglycin/osteoglycin(osteoinductive factor)/Osteoinductive factor/SLRR3A Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Bovine Mimecan, OGN ELISA KIT
ELI-15762b	Lifescience Market	96 Tests	EUR 928

Rabbit Mimecan, OGN ELISA KIT
ELI-37245Ra	Lifescience Market	96 Tests	EUR 928

Chicken Mimecan, OGN ELISA KIT
ELI-45626c	Lifescience Market	96 Tests	EUR 928

Human Mimecan, OGN ELISA KIT
ELI-45627h	Lifescience Market	96 Tests	EUR 824

Human Mimecan (OGN) ELISA kit
CSB-EL016314HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Mimecan (OGN) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Mimecan (OGN) ELISA kit
1-CSB-EL016314HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Mimecan (OGN) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

OGN ELISA Kit (Human) (OKAN06221)
OKAN06221	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene encodes a member of the small leucine-rich proteoglycan (SLRP) family of proteins. The encoded protein induces ectopic bone formation in conjunction with transforming growth factor beta and may regulate osteoblast differentiation. High expression of the encoded protein may be associated with elevated heart left ventricular mass. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 12.5 pg/mL

OGN ELISA Kit (Human) (OKCD08228)
OKCD08228	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab);Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 12.5pg/mL

OGN ELISA Kit (Human) (OKEH01881)
OKEH01881	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: This gene encodes a member of the small leucine-rich proteoglycan (SLRP) family of proteins. The encoded protein induces ectopic bone formation in conjunction with transforming growth factor beta and may regulate osteoblast differentiation. High expression of the encoded protein may be associated with elevated heart left ventricular mass. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.046 ng/mL

OGN ELISA Kit (Chicken) (OKEH08716)
OKEH08716	Aviva Systems Biology	96 Wells	EUR 1184
Description: Description of target: ;Species reactivity: Chicken;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

OGN ELISA Kit| Bovine Mimecan ELISA Kit
EF011699	Lifescience Market	96 Tests	EUR 689

OGN ELISA Kit| chicken Mimecan ELISA Kit
EF012446	Lifescience Market	96 Tests	EUR 689

Mouse OGN shRNA Plasmid
20-abx971861	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

OGN Recombinant Protein (Mouse)
RP155843	ABM	100 ug	Ask for price

OGN siRNA
20-abx926812	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

OGN siRNA
20-abx926813	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

OGN antibody
70R-19033	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal OGN antibody

OGN Antibody
1-CSB-PA005349	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against OGN. Recognizes OGN from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

OGN Antibody
1-CSB-PA016314ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against OGN. Recognizes OGN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

OGN Antibody
1-CSB-PA016314GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against OGN. Recognizes OGN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

OGN Antibody
1-CSB-PA016314LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against OGN. Recognizes OGN from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:300, IF:1:50-1:200

Osteoglycin Polyclonal Antibody
ES4024-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Osteoglycin from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Osteoglycin Polyclonal Antibody
ES4024-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Osteoglycin from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

anti- Osteoglycin antibody
FNab06032	FN Test	100µg	EUR 505.25
Immunogen: osteoglycin Uniprot ID: P20774 Research Area: Immunology, Signal Transduction
Description: Antibody raised against Osteoglycin

Osteoglycin Polyclonal Antibody
20-abx116879	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Osteoglycin Polyclonal Antibody
ABP53025-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the C-terminal region of human Osteoglycin Applications tips:
Description: A polyclonal antibody for detection of Osteoglycin from Human, Mouse. This Osteoglycin antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human Osteoglycin

Osteoglycin Polyclonal Antibody
ABP53025-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the C-terminal region of human Osteoglycin Applications tips:
Description: A polyclonal antibody for detection of Osteoglycin from Human, Mouse. This Osteoglycin antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human Osteoglycin

Osteoglycin Polyclonal Antibody
ABP53025-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the C-terminal region of human Osteoglycin Applications tips:
Description: A polyclonal antibody for detection of Osteoglycin from Human, Mouse. This Osteoglycin antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human Osteoglycin

Anti-Osteoglycin Antibody
A07061	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for Osteoglycin Antibody (OGN) detection. Tested with WB in Human, Mouse.

Osteoglycin Polyclonal Antibody
41700-100ul	SAB	100ul	EUR 252

Osteoglycin Polyclonal Antibody
41700-50ul	SAB	50ul	EUR 187

Anti-Osteoglycin antibody
PAab06032	Lifescience Market	100 ug	EUR 355

Anti-Osteoglycin antibody
STJ96659	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to Osteoglycin.

Ogn ORF Vector (Mouse) (pORF)
ORF051949	ABM	1.0 ug DNA	EUR 506

OGN cloning plasmid
CSB-CL016314HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 897 Sequence: atgaagactctgcagtctacacttctcctgttactgcttgtgcctctgataaagccagcaccaccaacccagcaggactcacgcattatctatgattatggaacagataattttgaagaatccatatttagccaagattatgaggataaatacctggatggaaaaaatattaagga Show more
Description: A cloning plasmid for the OGN gene.

Mimecan (OGN) Antibody
20-abx006381	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Mimecan (OGN) Antibody
abx026375-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Mimecan (OGN) Antibody
abx026375-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Mimecan (OGN) Antibody
20-abx325478	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Mimecan (OGN) Antibody
20-abx320764	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Mimecan (OGN) Antibody
20-abx304702	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

OGN Polyclonal Antibody
A57045	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

OGN Rabbit pAb
A6679-100ul	Abclonal	100 ul	EUR 308

OGN Rabbit pAb
A6679-200ul	Abclonal	200 ul	EUR 459

OGN Rabbit pAb
A6679-20ul	Abclonal	20 ul	EUR 183

OGN Rabbit pAb
A6679-50ul	Abclonal	50 ul	EUR 223

OGN Polyclonal Antibody
30722-100ul	SAB	100ul	EUR 252

OGN Polyclonal Antibody
30722-50ul	SAB	50ul	EUR 187

Human Mimecan (OGN)
1-CSB-YP016314HU	Cusabio	EUR 430.00 EUR 234.00 EUR 1508.00 EUR 642.00 EUR 1009.00 EUR 291.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 33.7 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Mimecan(OGN) expressed in Yeast

Human Mimecan (OGN)
1-CSB-EP016314HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 35.7 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Mimecan(OGN) expressed in E.coli

Anti-OGN antibody
STJ28762	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the small leucine-rich proteoglycan (SLRP) family of proteins. The encoded protein induces ectopic bone formation in conjunction with transforming growth factor beta and may regulate osteoblast differentiation. High expression of the encoded protein may be associated with elevated heart left ventricular mass. Alternative splicing results in multiple transcript variants.

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Osteoglycin Polyclonal Conjugated Antibody
C41700	SAB	100ul	EUR 397

Ogn sgRNA CRISPR Lentivector set (Mouse)
K3415701	ABM	3 x 1.0 ug	EUR 339

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

OGN Polyclonal Conjugated Antibody
C30722	SAB	100ul	EUR 397

Mimecan (OGN) Antibody (HRP)
20-abx304703	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Mimecan (OGN) Antibody (FITC)
20-abx304704	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Mimecan (OGN) Antibody (Biotin)
20-abx304705	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Human OGN shRNA Plasmid
20-abx953298	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Anti-OIF/Ogn Antibody
A07061-1	BosterBio	100ug/vial	EUR 294

OGN Antibody, HRP conjugated
1-CSB-PA016314LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against OGN. Recognizes OGN from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

OGN Antibody, FITC conjugated
1-CSB-PA016314LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against OGN. Recognizes OGN from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

OGN Antibody, Biotin conjugated
1-CSB-PA016314LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against OGN. Recognizes OGN from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

OGN Recombinant Protein (Human)
RP022081	ABM	100 ug	Ask for price

OGN Recombinant Protein (Rat)
RP215105	ABM	100 ug	Ask for price

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

Ogn sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3415702	ABM	1.0 ug DNA	EUR 154

Ogn sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3415703	ABM	1.0 ug DNA	EUR 154

Ogn sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3415704	ABM	1.0 ug DNA	EUR 154

OGN Protein Vector (Mouse) (pPB-C-His)
PV207794	ABM	500 ng	EUR 603

OGN Protein Vector (Mouse) (pPB-N-His)
PV207795	ABM	500 ng	EUR 603

OGN Protein Vector (Mouse) (pPM-C-HA)
PV207796	ABM	500 ng	EUR 603

OGN Protein Vector (Mouse) (pPM-C-His)
PV207797	ABM	500 ng	EUR 603

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT	SBI	1 Kit	EUR 153
Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

Polyclonal OGN Antibody (C-term)
APR03595G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human OGN (C-term). This antibody is tested and proven to work in the following applications:

OGN Polyclonal Antibody, HRP Conjugated
A57046	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

OGN Polyclonal Antibody, FITC Conjugated
A57047	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research