Argentina’s Local Crop Biotechnology Developments: Why Have They Not Reached the Market Yet?

Plant biotechnology in Argentina began at the finish of the 1980s, resulting in the growth of quite a few analysis teams in public establishments and, a decade later, to some native personal initiatives. The quite a few scientific and technological capacities present in the nation allowed the early structure in 1991 of a sound genetically modified organisms biosafety regulatory system.

The first business approvals started in 1996, and thus far, 59 occasions have obtained permits to be positioned on the market, nonetheless, solely two have been developed regionally by public-private partnerships. The transgenic occasions developed at public establishments pursue completely different goals in various crops. However, as soon as these occasions have been developed in laboratories, it’s troublesome to maneuver towards a attainable business approval.

In this work, we analyze a number of causes that would clarify why native developments haven’t reached approvals for commercialization, highlighting facets associated to the lack of strategic imaginative and prescient in the establishments to focus assets on initiatives to develop biotechnological merchandise.

Although progress has been made in producing regulatory guidelines tailored to analysis institutes (resembling the laws for biosafety greenhouses and methods of presenting purposes), analysisers nonetheless don’t conceive regulatory science as a self-discipline.

They typically desire to not be concerned in the design of regulatory subject trials or regulatory points associated to the analysis of occasions. In that sense, a few of the facets thought-about a regulatory affairs platform for the public scientific system and the reinforcement of laboratories that carry out checks required underneath the Argentine regulation.

Argentina's Local Crop Biotechnology Developments: Why Have They Not Reached the Market Yet?
Argentina’s Local Crop Biotechnology Developments: Why Have They Not Reached the Market Yet?

O6-alkylguanine-DNA Alkyltransferases in Microbes Living on the Edge: From Stability to Applicability.

The genome of residing cells is constantly uncovered to endogenous and exogenous assaults, and that is significantly amplified at excessive temperatures. Alkylating brokers trigger DNA harm, resulting in mutations and cell loss of life; for that reason, additionally they play a central function in chemotherapy therapies. A category of enzymes often known as AGTs (alkylguanine-DNA-alkyltransferases) protects the DNA from mutations attributable to alkylating brokers, specifically in the recognition and restore of alkylated guanines in O6-position.

EIF4H Antibody

1-CSB-PA007571GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EIF4H. Recognizes EIF4H from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA

EIF4H Antibody

39943-100ul 100ul
EUR 390

EIF4H antibody

70R-4728 50 ug
EUR 467
Description: Rabbit polyclonal EIF4H antibody raised against the C terminal of EIF4H

EIF4H siRNA

20-abx901690
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EIF4H siRNA

20-abx915219
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EIF4H siRNA

20-abx915220
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EIF4H Antibody

DF12975 200ul
EUR 304
Description: EIF4H Antibody detects endogenous levels of EIF4H.

EIF4H antibody

70R-17063 50 ul
EUR 435
Description: Rabbit polyclonal EIF4H antibody

EIF4H cloning plasmid

CSB-CL007571HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 687
  • Sequence: atggcggacttcgacacctacgacgatcgggcctacagcagcttcggcggcggcagagggtcccgcggcagtgctggtggccatggttcccgtagccagaaggagttgcccacagagcccccctacacagcatacgtaggaaatctacctttcaatacggttcagggcgacataga
  • Show more
Description: A cloning plasmid for the EIF4H gene.

EIF4H Blocking Peptide

33R-9032 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EIF4H antibody, catalog no. 70R-4728

EIF4H Polyclonal Antibody

31785-100ul 100ul
EUR 252

EIF4H Polyclonal Antibody

31785-50ul 50ul
EUR 187

EIF4H Blocking Peptide

DF12975-BP 1mg
EUR 195

EIF4H Rabbit pAb

A9953-100ul 100 ul
EUR 308

EIF4H Rabbit pAb

A9953-200ul 200 ul
EUR 459

EIF4H Rabbit pAb

A9953-20ul 20 ul
EUR 183

EIF4H Rabbit pAb

A9953-50ul 50 ul
EUR 223

anti- EIF4H antibody

FNab02726 100µg
EUR 548.75
  • Immunogen: eukaryotic translation initiation factor 4H
  • Uniprot ID: Q15056
  • Gene ID: 7458
  • Research Area: Metabolism
Description: Antibody raised against EIF4H

Anti-EIF4H antibody

PAab02726 100 ug
EUR 386

Anti-EIF4H antibody

STJ111994 100 µl
EUR 277
Description: This gene encodes one of the translation initiation factors, which functions to stimulate the initiation of protein synthesis at the level of mRNA utilization. This gene is deleted in Williams syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at 7q11.23. Alternative splicing of this gene generates 2 transcript variants.

Anti-eIF4H (4B2)

YF-MA16068 100 ug
EUR 363
Description: Mouse monoclonal to eIF4H

EIF4H Polyclonal Conjugated Antibody

C31785 100ul
EUR 397

Rat EIF4H shRNA Plasmid

20-abx988329
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human EIF4H shRNA Plasmid

20-abx955102
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse EIF4H shRNA Plasmid

20-abx973390
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

EIF4H protein (His tag)

80R-2302 100 ug
EUR 424
Description: Purified recombinant Human EIF4H Protein (His tag)

Human EIF4H ELISA KIT

ELI-43380h 96 Tests
EUR 824

Bovine EIF4H ELISA KIT

ELI-20276b 96 Tests
EUR 928

Mouse Eif4h ELISA KIT

ELI-21438m 96 Tests
EUR 865

EIF4H ELISA KIT|Human

EF009357 96 Tests
EUR 689

EIF4H Recombinant Protein (Human)

RP010489 100 ug Ask for price

EIF4H Recombinant Protein (Rat)

RP199418 100 ug Ask for price

EIF4H Recombinant Protein (Mouse)

RP131390 100 ug Ask for price

EIF4H ORF Vector (Human) (pORF)

ORF003497 1.0 ug DNA
EUR 95

Eif4h ORF Vector (Mouse) (pORF)

ORF043798 1.0 ug DNA
EUR 506

Eif4h ORF Vector (Rat) (pORF)

ORF066474 1.0 ug DNA
EUR 506

EIF4H sgRNA CRISPR Lentivector set (Human)

K0671201 3 x 1.0 ug
EUR 339

Eif4h sgRNA CRISPR Lentivector set (Rat)

K7189901 3 x 1.0 ug
EUR 339

Eif4h sgRNA CRISPR Lentivector set (Mouse)

K4922101 3 x 1.0 ug
EUR 339

Eukaryotic Translation Initiation Factor 4H (EIF4H) Antibody

20-abx112389
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 4H (EIF4H) Antibody

abx026917-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 4H (EIF4H) Antibody

abx026917-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 4H (EIF4H) Antibody

abx036584-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 4H (EIF4H) Antibody

20-abx135873
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 4H (EIF4H) Antibody

20-abx176332
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Eukaryotic Translation Initiation Factor 4H (EIF4H) Antibody

abx232726-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

EIF4H sgRNA CRISPR Lentivector (Human) (Target 1)

K0671202 1.0 ug DNA
EUR 154

EIF4H sgRNA CRISPR Lentivector (Human) (Target 2)

K0671203 1.0 ug DNA
EUR 154

EIF4H sgRNA CRISPR Lentivector (Human) (Target 3)

K0671204 1.0 ug DNA
EUR 154

Eif4h sgRNA CRISPR Lentivector (Rat) (Target 1)

K7189902 1.0 ug DNA
EUR 154

Eif4h sgRNA CRISPR Lentivector (Rat) (Target 2)

K7189903 1.0 ug DNA
EUR 154

Eif4h sgRNA CRISPR Lentivector (Rat) (Target 3)

K7189904 1.0 ug DNA
EUR 154

Eif4h sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4922102 1.0 ug DNA
EUR 154

Eif4h sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4922103 1.0 ug DNA
EUR 154

Eif4h sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4922104 1.0 ug DNA
EUR 154

EIF4H Protein Vector (Rat) (pPB-C-His)

PV265894 500 ng
EUR 603

EIF4H Protein Vector (Rat) (pPB-N-His)

PV265895 500 ng
EUR 603

EIF4H Protein Vector (Rat) (pPM-C-HA)

PV265896 500 ng
EUR 603

EIF4H Protein Vector (Rat) (pPM-C-His)

PV265897 500 ng
EUR 603

EIF4H Protein Vector (Mouse) (pPB-C-His)

PV175190 500 ng
EUR 603

EIF4H Protein Vector (Mouse) (pPB-N-His)

PV175191 500 ng
EUR 603

EIF4H Protein Vector (Mouse) (pPM-C-HA)

PV175192 500 ng
EUR 603

EIF4H Protein Vector (Mouse) (pPM-C-His)

PV175193 500 ng
EUR 603

EIF4H Protein Vector (Human) (pPB-C-His)

PV013985 500 ng
EUR 329

EIF4H Protein Vector (Human) (pPB-N-His)

PV013986 500 ng
EUR 329

EIF4H Protein Vector (Human) (pPM-C-HA)

PV013987 500 ng
EUR 329

EIF4H Protein Vector (Human) (pPM-C-His)

PV013988 500 ng
EUR 329

Recombinant Human EIF4H Protein, His, E.coli-1mg

QP11774-1mg 1mg
EUR 3655

Recombinant Human EIF4H Protein, His, E.coli-20ug

QP11774-20ug 20ug
EUR 201

Recombinant Human EIF4H Protein, His, E.coli-5ug

QP11774-5ug 5ug
EUR 155

Recombinant Eukaryotic Translation Initiation Factor 4H (EIF4H)

4-RPF019Hu01
  • EUR 279.20
  • EUR 178.00
  • EUR 772.00
  • EUR 324.00
  • EUR 548.00
  • EUR 250.00
  • EUR 1780.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q15056
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 30.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Eukaryotic Translation Initiation Factor 4H expressed in: E.coli

Eif4h 3'UTR Luciferase Stable Cell Line

TU105741 1.0 ml Ask for price

Eif4h 3'UTR GFP Stable Cell Line

TU155741 1.0 ml Ask for price

EIF4H 3'UTR Luciferase Stable Cell Line

TU006795 1.0 ml
EUR 1521

Eif4h 3'UTR Luciferase Stable Cell Line

TU203908 1.0 ml Ask for price

EIF4H 3'UTR GFP Stable Cell Line

TU056795 1.0 ml
EUR 1521

Eif4h 3'UTR GFP Stable Cell Line

TU253908 1.0 ml Ask for price

Human Eukaryotic Translation Initiation Factor 4H (EIF4H) Protein

20-abx650630
  • EUR 411.00
  • EUR 217.00
  • EUR 1052.00
  • EUR 467.00
  • EUR 300.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

EIF4H Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV671851 1.0 ug DNA
EUR 514

EIF4H Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV671855 1.0 ug DNA
EUR 514

EIF4H Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV671856 1.0 ug DNA
EUR 514

Human Eukaryotic Translation Initiation Factor 4H (EIF4H) ELISA Kit

abx387111-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

EIF4H Eukaryotic Translation Initiation Factor 4H Human Recombinant Protein

PROTQ15056 Regular: 20ug
EUR 317
Description: EIF4H Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 272 amino acids (1-248 a.a) and having a molecular mass of 29.9kDa.;EIF4H is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

EIF4H sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0671205 3 x 1.0 ug
EUR 376

Eif4h sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7189905 3 x 1.0 ug
EUR 376

Eif4h sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4922105 3 x 1.0 ug
EUR 376

EIF4H sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0671206 1.0 ug DNA
EUR 167

EIF4H sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0671207 1.0 ug DNA
EUR 167

EIF4H sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0671208 1.0 ug DNA
EUR 167

EIF4H Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV671852 1.0 ug DNA
EUR 514

EIF4H Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV671853 1.0 ug DNA
EUR 572

EIF4H Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV671854 1.0 ug DNA
EUR 572

Eif4h sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K7189906 1.0 ug DNA
EUR 167

Eif4h sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K7189907 1.0 ug DNA
EUR 167

Eif4h sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K7189908 1.0 ug DNA
EUR 167

Eif4h sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4922106 1.0 ug DNA
EUR 167

Eif4h sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4922107 1.0 ug DNA
EUR 167

Eif4h sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4922108 1.0 ug DNA
EUR 167

The peculiar irreversible self-alkylation response of those enzymes triggered quite a few research, particularly on the human homologue, with the intention to establish efficient inhibitors in the combat towards most cancers. In fashionable biotechnology, engineered variants of AGTs are developed for use as proteintags for the attachment of chemical ligands.

In the final decade, analysis on AGTs from (hyper)thermophilic sources proved helpful as a mannequin system to make clear quite a few phenomena, additionally frequent for mesophilic enzymes. This evaluate traces latest progress on this class of thermozymes, emphasizing their usefulness in fundamental analysis and their consequent benefits for in vivo and in vitro biotechnological purposes.

Leave a Reply

Your email address will not be published. Required fields are marked *