Biotechnological Potential of Bdellovibrio and Like Organisms and Their Secreted Enzymes.

Bdellovibrio and like organisms (BALOs) are obligate predatory micro organism that selectively prey on a broad vary of Gram-negative micro organism, together with multidrug-resistant human pathogens. Due to their distinctive way of life, they’ve been lengthy acknowledged as a possible therapeutic and biocontrol agent.

Research on BALOs has quickly grown over the latest decade, leading to many publications regarding molecular particulars of bacterial predation in addition to purposes thereof in medication and biotechnology.

This evaluation summarizes the present information on biotechnological potential of obligate predatory micro organism and their secreted enzymes.

Biotechnological Potential of Bdellovibrio and Like Organisms and Their Secreted Enzymes.
Biotechnological Potential of Bdellovibrio and Like Organisms and Their Secreted Enzymes.

The Cellular Response to Lanthanum Is Substrate Specific and Reveals a Novel Route for Glycerol Metabolism in Pseudomonas putida KT2440.

Ever because the discovery of the primary uncommon earth component (REE)-dependent enzyme, the physiological function of lanthanides has grow to be an rising discipline of analysis because of the environmental implications and biotechnological alternatives. In Pseudomonas putida KT2440, the 2 pyrroloquinoline quinone-dependent alcohol dehydrogenases (PQQ-ADHs) PedE and PedH are inversely regulated in response to REE availability. This transcriptional swap is orchestrated by a fancy regulatory community that features the PedR2/PedS2 two-component system and is essential for environment friendly progress on a number of alcoholic volatiles.

To examine whether or not mobile responses past the REE swap exist, the differential proteomic responses that happen throughout progress on varied mannequin carbon sources had been analyzed. Apart from the Ca2+-dependent enzyme PedE, the differential abundances of most recognized proteins had been conditional. During progress on glycerol-and concomitant with the proteomic changes-lanthanum (La3+) availability affected totally different progress parameters, together with the onset of logarithmic progress and ultimate optical densities. Studies with mutant strains revealed a novel metabolic route for glycerol utilization, initiated by PedE and/or PedH exercise.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

eIF5A Antibody

48963-100ul 100ul
EUR 333.00

eIF5A Antibody

48963-50ul 50ul
EUR 239.00

EIF5A antibody

70R-49699 100 ul
EUR 244.00
Description: Purified Polyclonal EIF5A antibody

EIF5A antibody

70R-33144 100 ug
EUR 435.00
Description: Rabbit polyclonal EIF5A antibody

EIF5A Antibody

ABD6754 100 ug
EUR 438.00

EIF5A Antibody

32552-100ul 100ul
EUR 252.00

EIF5A antibody

70R-17064 50 ul
EUR 435.00
Description: Rabbit polyclonal EIF5A antibody

EIF5A Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EIF5A. Recognizes EIF5A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

EIF5A Antibody

DF6754 200ul
EUR 304.00
Description: EIF5A Antibody detects endogenous levels of total EIF5A.

EIF5A Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Anti-eIF5A Antibody

A01727-1 100ul
EUR 397.00
Description: Rabbit Polyclonal eIF5A Antibody. Validated in WB and tested in Human, Mouse, Rat.

eIF5A Conjugated Antibody

C48963 100ul
EUR 397.00

EIF5A Conjugated Antibody

C32552 100ul
EUR 397.00

EIF5A cloning plasmid

CSB-CL007573HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 465
  • Sequence: atggcagatgacttggacttcgagacaggagatgcaggggcctcagccaccttcccaatgcagtgctcagcattacgtaagaatggctttgtggtgctcaaaggccggccatgtaagatcgtcgagatgtctacttcgaagactggcaagcacggccacgccaaggtccatctggt
  • Show more
Description: A cloning plasmid for the EIF5A gene.

pSV40- Eif5a- m

PVT11661 2 ug
EUR 273.00

Anti-eIF5A (8C1)

YF-MA12806 100 ug
EUR 363.00
Description: Mouse monoclonal to eIF5A

Anti-EIF5A antibody

PAab02728 100 ug
EUR 386.00

EIF5A Blocking Peptide

DF6754-BP 1mg
EUR 195.00

EIF5A Rabbit pAb

A2016-100ul 100 ul
EUR 308.00

EIF5A Rabbit pAb

A2016-200ul 200 ul
EUR 459.00

EIF5A Rabbit pAb

A2016-20ul 20 ul
EUR 183.00

EIF5A Rabbit pAb

A2016-50ul 50 ul
EUR 223.00

eIF5A Rabbit mAb

A4414-100ul 100 ul
EUR 410.00

eIF5A Rabbit mAb

A4414-200ul 200 ul
EUR 571.00

eIF5A Rabbit mAb

A4414-20ul 20 ul
EUR 221.00

eIF5A Rabbit mAb

A4414-50ul 50 ul
EUR 287.00

anti- EIF5A antibody

FNab02728 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: eukaryotic translation initiation factor 5A
  • Uniprot ID: P63241
  • Gene ID: 1984
  • Research Area: Metabolism
Description: Antibody raised against EIF5A

Anti-EIF5A antibody

STJ23522 100 µl
EUR 277.00

Anti-eIF5A antibody

STJ72008 100 µg
EUR 359.00

Human EIF5A shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

eIF5A recombinant monoclonal antibody

A5650 100ul X 3
EUR 595.00
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human eIF5A for WB, IHC,ELISA

Mouse Eif5a ELISA KIT

ELI-20519m 96 Tests
EUR 865.00


ELI-20279b 96 Tests
EUR 928.00


ELI-20280h 96 Tests
EUR 824.00


EF009359 96 Tests
EUR 689.00

Mouse EIF5A shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat EIF5A shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

EIF5A Recombinant Protein (Human)

RP010498 100 ug Ask for price

EIF5A Recombinant Protein (Mouse)

RP131399 100 ug Ask for price

EIF5A Recombinant Protein (Mouse)

RP131402 100 ug Ask for price

EIF5A Recombinant Protein (Mouse)

RP131405 100 ug Ask for price

EIF5A Recombinant Protein (Mouse)

RP131408 100 ug Ask for price

EIF5A Recombinant Protein (Mouse)

RP131411 100 ug Ask for price

EIF5A Recombinant Protein (Mouse)

RP131414 100 ug Ask for price

EIF5A Recombinant Protein (Mouse)

RP131417 100 ug Ask for price

EIF5A Recombinant Protein (Mouse)

RP131420 100 ug Ask for price

EIF5A Recombinant Protein (Mouse)

RP131423 100 ug Ask for price

EIF5A Recombinant Protein (Rat)

RP199424 100 ug Ask for price

EIF5A ORF Vector (Human) (pORF)

ORF003500 1.0 ug DNA
EUR 95.00

Eif5a ORF Vector (Mouse) (pORF)

ORF043802 1.0 ug DNA
EUR 506.00

Eif5a ORF Vector (Mouse) (pORF)

ORF043804 1.0 ug DNA
EUR 506.00

Eif5a ORF Vector (Rat) (pORF)

ORF066476 1.0 ug DNA
EUR 506.00

Anti-Acetylated eIF5A (Lys47) Antibody

P01727 100ul
EUR 397.00
Description: Rabbit Polyclonal Acetylated eIF5A (Lys47) Antibody. Validated in WB and tested in Human, Mouse, Rat.

Eif5a ORF Vector (Mouse) (pORF)

ORF043801 1.0 ug DNA
EUR 506.00

Eif5a ORF Vector (Mouse) (pORF)

ORF043803 1.0 ug DNA
EUR 506.00

Eif5a ORF Vector (Mouse) (pORF)

ORF043805 1.0 ug DNA
EUR 506.00

Eif5a ORF Vector (Mouse) (pORF)

ORF043806 1.0 ug DNA
EUR 506.00

Eif5a ORF Vector (Mouse) (pORF)

ORF043807 1.0 ug DNA
EUR 506.00

Eif5a ORF Vector (Mouse) (pORF)

ORF043808 1.0 ug DNA
EUR 506.00

Eif5a ORF Vector (Mouse) (pORF)

ORF043809 1.0 ug DNA
EUR 506.00

Anti-eIF5A Rabbit Monoclonal Antibody

M01727 100ug/vial
EUR 397.00
Description: Rabbit Monoclonal eIF5A Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.

[One Step] EIF5A Antibody Kit

RK05645 50 ul
EUR 240.00

Monoclonal EIF5A Antibody, Clone: 4E10G8

APG03268G 0.1ml
EUR 528.00
Description: A Monoclonal antibody against Human EIF5A. The antibodies are raised in Mouse and are from clone 4E10G8. This antibody is applicable in WB and IHC, FC, ICC, E

Anti-Acetyl-eIF5A/eIF5A2 (K47) Antibody

A05688 100ul
EUR 397.00
Description: Rabbit Polyclonal Antibody for Acetyl-eIF5A/eIF5A2 (K47) Antibody (EIF5A2) detection.tested for WB in Human, Mouse, Rat.

Acetyl eIF5A/eIF5A2 (K47) Polyclonal Antibody

ABP50097-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from the human eIF5A/eIF5A2 around the acetylation site of K47
  • Applications tips:
Description: A polyclonal antibody for detection of Acetyl eIF5A/eIF5A2 K47) from Human, Mouse, Rat. This Acetyl eIF5A/eIF5A2 K47) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the human eIF5A/eIF5A2 around the acetylation site of K47

Acetyl eIF5A/eIF5A2 (K47) Polyclonal Antibody

ABP50097-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from the human eIF5A/eIF5A2 around the acetylation site of K47
  • Applications tips:
Description: A polyclonal antibody for detection of Acetyl eIF5A/eIF5A2 K47) from Human, Mouse, Rat. This Acetyl eIF5A/eIF5A2 K47) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the human eIF5A/eIF5A2 around the acetylation site of K47

Acetyl eIF5A/eIF5A2 (K47) Polyclonal Antibody

ABP50097-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from the human eIF5A/eIF5A2 around the acetylation site of K47
  • Applications tips:
Description: A polyclonal antibody for detection of Acetyl eIF5A/eIF5A2 K47) from Human, Mouse, Rat. This Acetyl eIF5A/eIF5A2 K47) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the human eIF5A/eIF5A2 around the acetylation site of K47

Acetyl eIF5A/eIF5A2 (K47) Polyclonal Antibody

ES1096-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against Acetyl eIF5A/eIF5A2 (K47) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Acetyl eIF5A/eIF5A2 (K47) Polyclonal Antibody

ES1096-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against Acetyl eIF5A/eIF5A2 (K47) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

EIF5A sgRNA CRISPR Lentivector set (Human)

K0671401 3 x 1.0 ug
EUR 339.00

Eif5a sgRNA CRISPR Lentivector set (Rat)

K7466501 3 x 1.0 ug
EUR 339.00

Eif5a sgRNA CRISPR Lentivector set (Mouse)

K4544001 3 x 1.0 ug
EUR 339.00

Anti-eIF5A/eIF5A2 (Acetyl K47) antibody

STJ90136 200 µl
EUR 197.00
Description: Rabbit polyclonal to Acetyl-eIF5A/eIF5A2 (K47).

EIF5A sgRNA CRISPR Lentivector (Human) (Target 1)

K0671402 1.0 ug DNA
EUR 154.00

EIF5A sgRNA CRISPR Lentivector (Human) (Target 2)

K0671403 1.0 ug DNA
EUR 154.00

EIF5A sgRNA CRISPR Lentivector (Human) (Target 3)

K0671404 1.0 ug DNA
EUR 154.00

Eif5a sgRNA CRISPR Lentivector (Rat) (Target 1)

K7466502 1.0 ug DNA
EUR 154.00

Eif5a sgRNA CRISPR Lentivector (Rat) (Target 2)

K7466503 1.0 ug DNA
EUR 154.00

Eif5a sgRNA CRISPR Lentivector (Rat) (Target 3)

K7466504 1.0 ug DNA
EUR 154.00

Eif5a sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4544002 1.0 ug DNA
EUR 154.00

Eif5a sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4544003 1.0 ug DNA
EUR 154.00

Eif5a sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4544004 1.0 ug DNA
EUR 154.00

EIF5A Protein Vector (Rat) (pPB-C-His)

PV265902 500 ng
EUR 603.00

EIF5A Protein Vector (Rat) (pPB-N-His)

PV265903 500 ng
EUR 603.00

EIF5A Protein Vector (Rat) (pPM-C-HA)

PV265904 500 ng
EUR 603.00

EIF5A Protein Vector (Rat) (pPM-C-His)

PV265905 500 ng
EUR 603.00

EIF5A 3'UTR Luciferase Stable Cell Line

TU006797 1.0 ml
EUR 2333.00

EIF5A 3'UTR GFP Stable Cell Line

TU056797 1.0 ml
EUR 2333.00

EIF5A Protein Vector (Mouse) (pPB-C-His)

PV175202 500 ng
EUR 603.00

EIF5A Protein Vector (Mouse) (pPB-N-His)

PV175203 500 ng
EUR 603.00

EIF5A Protein Vector (Mouse) (pPM-C-HA)

PV175204 500 ng
EUR 603.00

EIF5A Protein Vector (Mouse) (pPM-C-His)

PV175205 500 ng
EUR 603.00

EIF5A Protein Vector (Mouse) (pPB-C-His)

PV175206 500 ng
EUR 603.00

EIF5A Protein Vector (Mouse) (pPB-N-His)

PV175207 500 ng
EUR 603.00

EIF5A Protein Vector (Mouse) (pPM-C-HA)

PV175208 500 ng
EUR 603.00

EIF5A Protein Vector (Mouse) (pPM-C-His)

PV175209 500 ng
EUR 603.00

EIF5A Protein Vector (Mouse) (pPB-C-His)

PV175210 500 ng
EUR 603.00

EIF5A Protein Vector (Mouse) (pPB-N-His)

PV175211 500 ng
EUR 603.00

EIF5A Protein Vector (Mouse) (pPM-C-HA)

PV175212 500 ng
EUR 603.00

EIF5A Protein Vector (Mouse) (pPM-C-His)

PV175213 500 ng
EUR 603.00

EIF5A Protein Vector (Mouse) (pPB-C-His)

PV175214 500 ng
EUR 603.00

EIF5A Protein Vector (Mouse) (pPB-N-His)

PV175215 500 ng
EUR 603.00

EIF5A Protein Vector (Mouse) (pPM-C-HA)

PV175216 500 ng
EUR 603.00

EIF5A Protein Vector (Mouse) (pPM-C-His)

PV175217 500 ng
EUR 603.00

EIF5A Protein Vector (Mouse) (pPB-C-His)

PV175218 500 ng
EUR 603.00

EIF5A Protein Vector (Mouse) (pPB-N-His)

PV175219 500 ng
EUR 603.00

EIF5A Protein Vector (Mouse) (pPM-C-HA)

PV175220 500 ng
EUR 603.00

EIF5A Protein Vector (Mouse) (pPM-C-His)

PV175221 500 ng
EUR 603.00

EIF5A Protein Vector (Mouse) (pPB-C-His)

PV175222 500 ng
EUR 603.00

EIF5A Protein Vector (Mouse) (pPB-N-His)

PV175223 500 ng
EUR 603.00

EIF5A Protein Vector (Mouse) (pPM-C-HA)

PV175224 500 ng
EUR 603.00

EIF5A Protein Vector (Mouse) (pPM-C-His)

PV175225 500 ng
EUR 603.00

EIF5A Protein Vector (Mouse) (pPB-C-His)

PV175226 500 ng
EUR 603.00

EIF5A Protein Vector (Mouse) (pPB-N-His)

PV175227 500 ng
EUR 603.00

EIF5A Protein Vector (Mouse) (pPM-C-HA)

PV175228 500 ng
EUR 603.00

EIF5A Protein Vector (Mouse) (pPM-C-His)

PV175229 500 ng
EUR 603.00

EIF5A Protein Vector (Mouse) (pPB-C-His)

PV175230 500 ng
EUR 603.00

EIF5A Protein Vector (Mouse) (pPB-N-His)

PV175231 500 ng
EUR 603.00

EIF5A Protein Vector (Mouse) (pPM-C-HA)

PV175232 500 ng
EUR 603.00

EIF5A Protein Vector (Mouse) (pPM-C-His)

PV175233 500 ng
EUR 603.00

EIF5A Protein Vector (Mouse) (pPB-C-His)

PV175234 500 ng
EUR 603.00

EIF5A Protein Vector (Mouse) (pPB-N-His)

PV175235 500 ng
EUR 603.00

EIF5A Protein Vector (Mouse) (pPM-C-HA)

PV175236 500 ng
EUR 603.00

EIF5A Protein Vector (Mouse) (pPM-C-His)

PV175237 500 ng
EUR 603.00

Eif5a 3'UTR GFP Stable Cell Line

TU155743 1.0 ml Ask for price

Eif5a 3'UTR GFP Stable Cell Line

TU253910 1.0 ml Ask for price

Eif5a 3'UTR Luciferase Stable Cell Line

TU203910 1.0 ml Ask for price

Upon oxidation to glycerate by way of glyceraldehyde, phosphorylation by the glycerate kinase GarK almost definitely yields glycerate-2-phosphate, which is finally channeled into the central metabolism of the cell. This new route capabilities in parallel with the primary degradation pathway encoded by the glpFKRD operon and offers a progress benefit to the cells by permitting an earlier onset of progress with glycerol as the only real supply of carbon and power.IMPORTANCE The organic function of REEs has lengthy been underestimated, and analysis has primarily targeted on methanotrophic and methylotrophic micro organism.

We have lately demonstrated that P. putida, a plant growth-promoting bacterium that thrives within the rhizosphere of varied meals crops, possesses a REE-dependent alcohol dehydrogenase (PedH), however information about REE-specific results on physiological traits in nonmethylotrophic micro organism remains to be scarce. This examine demonstrates that the mobile response of P. putida to lanthanum (La3+) is generally substrate particular and that La3+ availability extremely impacts the expansion of cells on glycerol.

Further, a novel route for glycerol metabolism is recognized, which is initiated by PedE and/or PedH exercise and offers a progress benefit to this biotechnologically related organism by permitting a sooner onset of progress. Overall, these findings reveal that lanthanides can have an effect on physiological traits in nonmethylotrophic micro organism and may affect their competitiveness in varied environmental niches.

Leave a Reply

Your email address will not be published. Required fields are marked *